Isolation and phenotypic characterization of LAB strains
LAB strains were isolated from the GIT (crop and intestine) of apparently healthy male and female broilers from the poultry farms in Jashore, Bangladesh. Briefly, the chickens were euthanized using overdose of isoflurane anesthesia followed by cervical dislocation after which their crops and intestines were aseptically removed, placed in sterile plastic bags, and immediately brought to the laboratory for microbial analysis. All efforts were made to minimize suffering. This euthanasia method was adopted for this study due to its rapidity, efficacy, ease of use and operator safety. Also, it does not have deleterious effects on the birds. After removing the content of each section, 10 g of each of the GIT section was aseptically removed and enriched in de Man, Rogosa, Sharpe (MRS) broth (40 ml) (Hi-Media, India), homogenized and then inoculated at 37 °C for 24 h with constant homogenous shaking under aerobic conditions [26]. All the tubes showing turbidity were selected and further inoculated onto MRS agar (Hi-Media, India) plates and incubated for 24-72 h at 37 °C under aerobic conditions. Plates showing white and creamy colonies (presumptive for LAB) were selected, and individual colonies purified through three successive transfers on MRS medium.
The pure cultures were characterized as LAB by Gram staining, cell morphology, catalase, and coagulase reaction according to standard procedures [13]. Gram-positive, and catalase and coagulase-negative isolates were selected and stored at -20 °C in MRS broth plus 28% glycerol (El-Soda et al., 2003). The purified stocked cultures were resuscitated by sub-culturing twice in MRS broth before each use.
Antagonistic activity
Agar well diffusion assay
The antagonistic effect of the LAB isolates against some pathogens was first determined by the agar well diffusion technique [62]. The LAB isolates were cultured in MRS broth at 37 °C overnight, and the targeted pathogens were also pre-cultured under the same conditions in Brain Heart Infusion (BHI) broth (Liofilchem, Italy). Exactly 200 μL of the test pathogens (107 CFU/ml) was further spread onto the surface Mueller Hinton Agar (Biomark Lab, India) plates. Wells punctured into the inoculated plates were filled with 100 μL cell-free supernatant (CFS) obtained by centrifugation of LAB cultures at 6000 rpm for 10 min (Boeco, Germany). The plates were incubated at 37 °C for 24 h. Antagonistic activity of the LAB strains was assessed in terms of the formation of inhibition zones (mm) around the wells. This technique was conducted in triplicate for each LAB isolate and the mean result taken. The target pathogens tested were Escherichia coli ATCC 10536, E. coli O157: H7 ATCC 43894, Enterococus faecalis ATCC 51299, Salmonella Typhimurium ATCC 14028, S. Enteritidis ATCC 13098 and Listeria monocytogenes ATCC 19113.
Agar spot test
The antagonistic activity of the LAB strains was also conducted using the agar spot test as previously described by Armas et al. [27]. Overnight cultures of the target strains (pathogens) were diluted in BHI broth with 1 ml of each diluted culture (approximately 106 CFU/ml) inoculated onto BHI agar plates. The excess culture was removed after 5 min of contact, and plates were left to dry for 30 min. MRS broth containing overnight cultures of the LAB strains to be tested for antagonistic activity were centrifuged (10 min at 15000 g), and 3 μl of CFSC of each LAB strain was spotted on the pathogen inoculated agar surface in triplicate. Plates were left for 5 min to absorb and then incubated aerobically at 37 °C for 24 h. Clear inhibition zone > 1 mm around a spot was measured and scored as positive.
Safety of LAB probiotic strains
Haemolytic activity assay
The method of Maragkoudakis et al. [63] was used to determine the haemolytic activity of LAB isolates. Overnight cultures of LAB isolates grown in MRS broth were streaked onto blood agar base (Diagnostic Pasteur, France) plates containing 5% (v/v) of sheep blood and then incubated at 37 °C overnight. Haemolytic activities of the strains were recorded by the presence of Beta (β) haemolysis (indicated by a clear, colourless/lightened yellow zone surrounding the colonies depicting total lysis of RBC. Alpha (α) haemolysis (indicated by a small zone of greenish to brownish discoloration of the media, depicting reduction of haemoglobin to methemoglobin which diffuses around, and Gamma (ϒ) haemolysis (with no change observed in the media).
Assessment of probiotic properties of LAB strains
Bile salt tolerance test
To assess the bile salt tolerance, overnight LAB cultures were resuspended in sterile PBS (pH 7.2) after centrifugation, and further adjusted to give 108 CFU ml/L which was added into fresh MRS broth containing 0.3% bile salt (Merck KGaA, Germany) (w/v), and subsequently incubated for 6 h. The viability of cells was determined after 0, 3 and 6 h incubation by serial dilution and plating onto MRS agar [26].
Simulated gastric juice survivability test
Preparation of simulated gastric juice
As previously described by Corcoran et al [64], simulated gastric juice was prepared with modifications. The formulation was devoid of proteose peptone because it may serve as free amino acid (L-glutamate,) source, which may consequently enhance bacterial growth by extruding protons from the cell.
Simulated gastric juice survivability test with and without lysozyme (pH 2)
For each LAB strain, 1 ml of fresh culture was resuspended in an equal volume of PBS as earlier explained. Pelleted cells were then resuspended in 5 ml volume of simulated gastric juice (with and without lysozyme) and then incubated at 37 °C for 90 min with constant stirring. At different time intervals of 0, 30, 60, and 90 min, samples were taken and serially diluted in maximum-recovery diluent up to 10− 8, and finally seeded on MRS agar plates, and incubated at 37 °C for 48 h [64].
Adhesion of LAB strains to chicken ileum epithelial cells
The LAB strains were tested for adherence to chicken epithelial cells as previously described [37] with modifications. The entire GIT was removed from chicken immediately after slaughter from a local abattoir and transported to the laboratory in the icebox. Gut contents were removed aseptically, and ileal segments were opened, repeatedly washed with PBS and held in PBS at 40C for half an hour, to loosen the surface mucus. The washed ileum was divided into four small pieces (1cm2/1cm2), and each was incubated in cell suspension of LAB strains (109 CFU/mL PSB) at 37°C for 90 min. At 0, 30, 60, and 90 min time intervals, samples were taken and screened for adherence. Non-adherent bacteria were removed by gently washing of incubated ileum with PSB, then macerated and finally, serially diluted in a maximum-recovery diluent, and subsequently plated onto MRS agar plates and incubated at 37oC for 24 hrs.
Phenol tolerance test
Phenol tolerance ability of LAB strains was determined by growing the strains in MRS broth containing increasing concentration (0.1–0.4%) of phenol [43]. After sterilization, each tube containing MRS broth with specific phenol concentration was inoculated with 1% (v/v) of fresh overnight cultures of LAB strains and incubated at 370C for 24 h. Strains viability was assessed by measuring the absorbance by spectrophotometer (PG instruments, UK) at 620 nm after incubation. The experiment was repeated thrice.
Temperature and NaCl tolerance assay
Overnight LAB cultures (1% v/v) were inoculated into MRS broth and incubated at different temperatures of 4, 25, 37, 45 and 55 °C respectively for 24 h. Their growths were afterward determined by measuring their turbidity using the spectrophotometer at 600 nm, and subsequently seeded on MRS agar plates and incubated for 24 – 48 h at 37 °C. The appearance of LAB colonies on MRS agar plates corresponded and confirmed their growth in MRS broth [65]. Similarly, overnight LAB cultures (1% v/v) were inoculated into MRS broth containing increasing concentration of NaCl (0.5, 2.0, 4.0, 6.5 and 10.0%) and incubated overnight at 37 °C. Strains viability was assessed by measuring the absorbance at 600 nm. The experiment was carried out in triplicate.
Competitive adherence of LAB strains and pathogens to chicken ileum epithelial cells
Competitive pathogens exclusion is one of the primary mechanisms used by LAB in GIT. A piece of chicken ileum was prepared as previously described above and suspended in equal volumes of individual LAB strain and each pathogen (109 CFU/mL PSB) and then incubated with at 37 °C for 90 min. Samples were taken and screened for competitive adherence 0, 30, 60, and 90 min intervals. Non-adherent bacteria from each piece of the incubated ileum was removed by gently washing with PSB, and then marcerated and subsequnetly, serially diluted in maximum-recovery diluent. Each diluent was plated onto MRS agar plates for LAB, MacConkey agar (HiMedia, India) plates for both E. coli and E. coli O157:H7 and Salmonella Shigella Agar (Liofilchem, Italy) plates for S. Typhimurium and S. Enteritidis respectively and incubated at 37 °C for 24 h for enumeration.
Cell surface characteristics
Auto-aggregation assay
With some modifications, the method of Polak-Berecka et al. [66] was used in determining the auto-aggregation ability of LAB strains. LAB strains were pelleted in PBS (pH 7.2) (as previously described), and adjusted to get 108 CFU ml/L in the same solution. Exactly 5 mL of bacterial suspension was vortexed (Vision Scientific, Korea) for 10 s, and the absorbance measured by the spectrophotometer at 600 nm (ODi), and then incubated for 2 h at 37 °C. The absorbance of the supernatant after 2 h of incubation was then measured (OD2h). The auto-aggregation coefficient (AC) was determined according to the formula below:
$$ A{C}_t\left(\%\right)=\left[1-\left(O{D}_{2h}/O{D}_i\right)\right]\ X\ 100 $$
$$ Given:O{D}_i= initial\ optical\ density\ of\ the\ microbial\ suspension\ at\ 600\; nm $$
$$ O{D}_{2h}= optical\ density\ of\ the\ microbial\ suspension\ at\ 600\; nm\ after\ 2\;h $$
Co-aggregation assay
Co-aggregation assay was conducted as previously described [27, 66]. The LAB isolates grown in MRS broth were harvested by centrifugation at 6000 x g for 15 min, washed twice and resuspended with sterile PBS (pH 7.2) and adjusted to 108 CFU ml/L in the same solution. An equal volume, 2 ml of each isolate and each pathogen cultures were mixed, vortexed and incubated for 2 h at 37 °C. Each control tubes contained 4 mL of each bacterial suspension (i.e., the probiotic strain and the pathogen). The absorbance of each mixed suspension was then measured at 600 nm (ODmix) and compared to those of the control tubes containing the probiotic strain (ODstrain) and the specific pathogen (ODpathogen) at 2 h of incubation. co-aggregation was calculated using the formula below:
$$ Co- aggregation\ \left(\%\right)=\left[1- ODmix/\left( ODstrain+ ODpathogen\right)/2\right]x100 $$
LAB cell surface hydrophobicity assay
The cell surface hydrophobicity of LAB cells was assayed according to the method described previously by Abbasiliasi et al. [65]. Three tubes each containing 3 mL of each LAB strain cells suspension in PBS (pH 7.2) at 108 CFU/mL were each mixed with n-hexadecane (1 mL) (a solvent) and then vortexed for 1 min. The mixture was subsequently allowed to separate into two phases by standing for 5–10 min. The OD (at 600 nm) of the aqueous phase was measured with a spectrophotometer. Bacterial affinity to solvent (n-hexadecane) (BATS) (hydrophobicity) was expressed using the equation below:
$$ BATS\ \left(\%\right)=\left(1-{A}_{10\mathit{\min}}/{A}_{0\mathit{\min}}\right)\ x\ 100 $$
Where, A10min is the absorbance at t = 10 min, and A0min is the absorbance at t = 0 min.
α–Glucosidase inhibitory activity of LAB strains
With slight modifications, the procedure of Kim et al. [50] was used to determine the inhibitory activity of α–glucosidase by LAB strains. Overnight culture of each LAB strain was centrifuged for 15 min at 4000×g and resuspended in PBS (50 μl). Exactly 3 mM p-nitrophenol-αD-glucopyranoside (pNPG, 50 μL) and the enzymatic reaction was allowed to proceed at 37°C for 30 min and finally stopped by the addition of 50 μL of 0.1 M Na2CO3, and the absorption released of Nitrophenol was measured at 405 nm using a microplate reader. The formula; (1-A/B) x 100 was used to calculate the inhibition of α-glucosidase activity of LAB strains, where A was the absorbance of the reactants with the sample, and B was the absorbance of the reactants without the sample (negative control). Acarbose was used as the standard reference (positive control).
Characterization of LAB antimicrobial substances
LAB strains with probiotic potentials were selected and further tested for the production antimicrobial substance, mainly bacteriocins, organic acids and hydrogen peroxides using the agar well diffusion technique as previously described [67] with modifications. Overnight cultures of LAB grown in MRS broth were centrifuged at 6000 g for 10 min, and the supernatants were collected and divided into four treatments: one was heat treated (boiled) for 10 min, the second was neutralized to pH 7 with 6 N NaOH (Fisher), the third was treated with 0.5 mg/ml catalase (Hi-media) and the fourth was untreated. These supernatants were subsequently filter sterilized (0.22 μm), and 100 μl was placed into wells bored in agar plates inoculated with 1% (v/v) overnight cultures of indicator pathogens as previously listed. The plates were further incubated at 37 °C overnight, and diameter of inhibition zones were measured (mm).
Antibiotic susceptibility test
The LAB isolates were examined for antimicrobial susceptibility, using the agar disc diffusion method [68]. The LAB strains to be tested were grown in fresh MRS broth at 37 °C overnight. The bacterial suspensions were matched to McFarland’s standard 2 (108 CFU/mL) and subsequently spread onto the surface of the MRS agar plates using a sterile cotton swab. Commercially available antibiotic discs (Hi-Media, Mumbai) including penicillin G (2 units), ceftriaxone (30 μg), ampicillin (25 μg), vancomycin (30 μg), oxacillin (μg), streptomycin (10 μg), chloramphenicol (30 μg), gentamicin (10 μg), erythromycin (10 μg), tetracycline (10 μg), novobiocin (30 μg) and ciprofloxacin (10 μg) were aseptically placed on the surface of the dried inoculated agar plates, and then incubated for 24 h at 37 °C. Clear zones of microbial growth inhibition around each antibiotic were measured using a transparent ruler after 24 h incubation. Isolates were categorized as sensitive (≥21 mm), intermediate (16–20 mm), or resistant (≤ 15 mm) as previously assessed [65].
Biochemical identification of LAB strains using API 50 CHL
The carbohydrate fermentation profiles of most promising LAB probiotic strains were investigated using API 50 CH strips and API CHL medium according to the manufacturer’s instruction (API system, BioMèrieux, France). Overnight cultures of LAB grown in MRS broth were pelleted after washing twice with sterile PBS, and were re-suspended in API 50 CHL medium, using sterile pipettes. With subsequent mixing, the homogenized cells suspension were transferred into each of the 50 wells on the API 50 CH strips. The strips were covered as recommended and incubated at 30°C. Changes in color were monitored after 24 and 48 hrs of incubation. Results were represented by a positive sign (+) while a negative sign (−) was designated for no change. The apiweb™ Software version 5.0 (BioMèrieux, France) was used according to manufacturer’s instruction in the interpretation of the results.
Molecular identification by 16S rRNA sequencing
The molecular identification of LAB strains was conducted by 16S rRNA amplification, sequencing and analysis, using the universal forward and reverse primers 27F: AGAGTTTGATCMTGGCTCAG and 1492R: TACGGCTACCTTGTTACGACTT with 1500 bp product [29]. PCR reactions were conducted using a total volume of 20 μl, containing 10 μl of NZYTaq 2× Green Master Mix, 0.5 μl each of forward and reverse primers, 6 μl of DNase free water and 2 μl of DNA template. The amplification protocol of Shokryazdan et al. [29] was adopted for this study. After amplification, 10 μl of PCR products were analyzed for electrophoresis and then visualizaed by transillumination under UV light using ImageMaster (Pharmacia Biotech, UK). The PCR products with 1.5 kb as the expected size were purified and sequenced. The sequence data obtined were further compared with the database in the Genbank using the basic local alignment search tool (BLAST) fot the final idetification of the LAB strains.
Statistical analysis
All measurements were repeated independently in triplicate, and results were expressed as mean ± standard deviation (SD). Data obtained were statistically analysed using GraphPad Prism version 5.0 for Windows (GraphPad Software, San Diego, CA, USA). One-way analysis of variance was used to study significant difference between means, with significance level at P < 0.05. Duncan’s multiple ranges or t-student test was used, when necessary, to discriminate differences between means. Differences were considered statistically significant at p < 0.05.
