Open Access

Activation of gab cluster transcription in Bacillus thuringiensis by γ-aminobutyric acid or succinic semialdehyde is mediated by the Sigma 54-dependent transcriptional activator GabR

  • Qi Peng1,
  • Min Yang1,
  • Wei Wang1, 2,
  • Lili Han1,
  • Guannan Wang1, 2,
  • Pengyue Wang1, 2,
  • Jie Zhang1 and
  • Fuping Song1Email author
BMC Microbiology201414:306

https://doi.org/10.1186/s12866-014-0306-3

Received: 30 June 2014

Accepted: 24 November 2014

Published: 20 December 2014

Abstract

Background

Bacillus thuringiensis GabR is a Sigma 54-dependent transcriptional activator containing three typical domains, an N-terminal regulatory domain Per-ARNT-Sim (PAS), a central AAA+ (ATPases associated with different cellular activities) domain and a C-terminal helix-turn-helix (HTH) DNA binding domain. GabR positively regulates the expression of the gabT gene of the gab gene cluster, which is responsible for the γ-aminobutyric acid (GABA) shunt.

Results

Purified GabR was shown to specifically bind to a repeat region that mapped 58 bp upstream of the gabT start codon. The specific signal factors GABA and succinic semialdehyde (SSA) activated gabT expression, whereas GABA- and SSA-inducible gabT transcription was abolished in sigL and gabR mutants. GABA and SSA did not induce the expression of either SigL or GabR. Deletion of the PAS domain of GabR resulted in increased gabT transcriptional activity, both in the presence and absence of GABA.

Conclusions

This study identified the GabR-binding site on the gabT promoter; however, GabR does not bind to its own promoter. gabT transcription is induced by GABA and SSA, and inducible expression is dependent on SigL and activated by GabR. The PAS domain in GabR is repressing its enhancer transcriptional activity on the gabT promoter. Repression is released upon GABA addition, whereupon transcription is induced.

Keywords

GabR Sigma 54 GABA SSA PAS domain

Background

The non-coded amino acid γ-aminobutyric acid (GABA) is found in a wide range of organisms, including bacteria, yeasts, plants and animals. In the adult brain, it is the predominant inhibitory neurotransmitter [1]. The GABA shunt, in which glutamate is converted to succinate, with GABA as an intermediate, is ubiquitous in most prokaryotic and eukaryotic organisms. Two important enzymes are involved in the GABA shunt: GABA transaminase (GABA-T, EC 2.6.1.19, encoded by gabT), which catalyzes the reversible conversion of GABA to succinic semialdehyde (SSA), and succinic semialdehyde dehydrogenase (SSADH, EC 1.2.1.16, encoded by gabD), which irreversibly oxidizes SSA to succinate [2]. Both gabT and gabD have been identified in Escherichia coli[3], Rhizobium leguminosarum[4] and Bacillus subtilis[5].

Bacillus thuringiensis (Bt) has been widely commercialized throughout the world because of the production by strains of this species of insecticidal crystal proteins. During sporulation, Bt produces large crystalline parasporal inclusions. Previous studies suggested that the GABA shunt was related to the formation of Bt crystals and spores [6]. Bt possess a modified tricarboxylic acid cycle (TCA) in which α-ketoglutarate dehydrogenase is absent. Instead, α-ketoglutarate is converted to glutamate and then to succinate via γ-aminobutyric acid [7]. The GABA shunt allows circumvention of the α-ketoglutarate dehydrogenase step. Enzymatic analyses of Bt extracts suggested that a modified TCA operates during the sporulation phase of growth in conjunction with the glyoxylic acid cycle and the GABA pathway [6]. The Bt gab gene cluster is involved in GABA degradation. Previously, we proposed a model to explain the expression and regulation of the gab gene cluster in Bt strain HD73 [8]. In this model, three genes (gabT, gabR and gabD) form two transcriptional units. gabT is separately transcribed, while gabR and gabD are co-transcribed. Moreover, we found that Sigma 54 RNA polymerase holoenzyme transcribes gabT, with transcription activated by GabR.

Bacterial enhancer binding proteins (bEBPs) are transcriptional activators that assemble as hexameric rings in their active form, using ATP hydrolysis to modify the conformation of RNA polymerase containing the alternative sigma factor Sigma 54 [9]. bEBPs generally consist of three domains: the N-terminal regulatory domain plays a role in signal perception and modulates the activity of bEBP; the central AAA+ domain is responsible for nucleotide binding, ATP hydrolysis, and oligomerization, and is sufficient to activate Sigma 54-dependent transcription; and the C-terminal DNA-binding domain contains a helix-turn-helix (HTH) motif that enables enhancer site recognition by specific upstream activating sequences (UAS) [9]. The N-terminal or regulatory domains of many bEBPs respond to various environmental signals and thereby regulate the activity of the central AAA+ domain [9]. For example, NtrC, DctD, ZraR and FlgR bEBPs are part of two-component systems that couple an external stimulus to an internal response [10]-[13]. These bEBPs have response regulator domains that are phosphorylated by specific sensor kinases. Certain other Sigma 54 activators have a regulatory domain that binds to small effector molecules, such as FhlA, which contains two GAF domains that bind formate to activate transcription of the formate hydrogen lyase system [14]. PAS (Per-ARNT-Sim) domains have been shown to bind a diverse array of ligands, including heme, flavins, 4-hydroxycinnamic acid, carboxylic acids, and divalent metal ions [15]. However, very few of the signals sensed by PAS domains in bEBPs have been identified. This is the case of TyrR bEBP-like protein, which in the presence of phenylalanine, tyrosine, or tryptophan, proposed to be sensed by the PAS domain, interact with the alpha-subunit of RNA polymerase to activate transcription [16].

GabR is a Sigma 54-dependent transcriptional activator that has three typical domains: an N-terminal PAS regulatory domain, a central AAA+ domain, and a C-terminal HTH DNA-binding domain. In this study, we demonstrated that GabR binds upstream and in close proximity to the Sigma 54 binding site in the gabT promoter. Our data also show that the PAS domain in GabR is repressing its enhancer transcriptional activity on the gabT promoter. Repression is released upon GABA addition, whereupon transcription is induced.

Methods

Bacterial strains, plasmids, and growth condition

The bacterial strains and plasmids used in this study are listed in Table 1. Bt strain HD73 was used throughout the study (accession numbers CP004069) [17]. E. coli strain TG1 was used as the host for cloning experiments. The Dam/Dcm E. coli ET12567 strain (laboratory stock) was used to generate unmethylated DNA for the electrotransformation assay. Bt strains were transformed by electroporation, as described previously [18],[19]. E. coli and Bt strains were cultured in Luria-Bertani (LB) medium, with 220 rpm shaking, at 37 and 30°C, respectively. The antibiotic concentrations used for bacterial selection were as follows: 100 μg/ml kanamycin, 10 μg/ml erythromycin, and 10 μg/ml tetracycline for Bt, and 100 μg/ml ampicillin for E. coli. For β-galactosidase assays, bacteria were grown on Association of Official Analytical Chemists (AOAC) medium (Sigma, S5431, Saint-Quentin Fallavier, France) containing glucose (7 mM) and Schaeffer’s sporulation medium (SSM) [20]. Transcription from the Bt gabT promoter was induced by adding 0, 1, 2, or 5 mM of SSA and GABA to the AOAC culture medium.
Table 1

Strains and plasmids used in this study

Strain or plasmid

Relevant genotype and characteristics

Reference or source

Strains

  

HD73

Bt subsp. Kurstaki carrying the cry1Ac gene

Laboratory collection

HD(PgabT-lacZ)

Bt HD73 carrying pHT-PgabT plasmid; EmR

[8]

HD(PgabR-lacZ)

Bt HD73 carrying pHT-PgabR plasmid; EmR

[8]

HD(PgabTDR-lacZ)

Bt HD73 carrying pHT-PgabTDR plasmid; EmR

This study

HD(PgabTDI-lacZ)

Bt HD73 carrying pHT-PgabTDI plasmid; EmR

This study

HD(PsigL-lacZ)

Bt HD73 carrying pHT-PsigL plasmid; EmR

This study

ΔgabT(PgabT-lacZ)

HD(ΔgabT) carrying pHT-PgabT plasmid; EmR

[8]

ΔgabD(PgabT-lacZ)

HD(ΔgabD) carrying pHT-PgabT plasmid; EmR

[8]

ΔgabR(PgabT-lacZ)

HD(ΔgabR) carrying pHT-PgabT plasmid; EmR

[8]

ΔsigL(PgabT-lacZ)

HD(ΔsigL) carrying pHT-PgabT plasmid; EmR

[8]

DPAS(PgabT)

HD(ΔgabR) carrying pHT-PgabT and pHT1618-DPAS plasmid; EmR and TetR

This study

CgabR(PgabT)

HD(ΔgabR) carrying pHT-PgabT and pHT1618-gabR plasmid; EmR and TetR

This study

E. coli TG1

Δ(lac-proAB) supE thi hsd- 5 (F’ traD36 proA + proB + lacI q lacZ ΔM15), general purpose cloning host

Laboratory collection

E. coli ET12567

F dam-13::Tn9 dcm-6 hsdM hsdR recF143 zjj-202::Tn10 galK2 galT22 ara14 pacY1 xyl-5 leuB6 thi-1, for generation of unmethylated DNA

Laboratory collection

E.coli BL21(DE3)

E.coli B, F , dcm, ompT, hsdS(rB-mB-), gal, λ(DE3)

Laboratory collection

BL21 (pET21b-gabR)

BL21(DE3) with pET21b-gabR plasmid

This study

Plasmids

  

pET21b

Expressional vector, ApR, 5.4 kb

Laboratory collection

pHT304-18Z

Promoterless lacZ vector, EmR, ApR

Laboratory collection

pHT1618

E. coli-Bt shuttle, ApR, TetR

[25]

pET21b-gabR

pET-21b containing gabR gene, ApR

This study

pHT-PgabT

pHT304-18Z carrying promoter upstream from gabT

[8]

pHT-PgabR

pHT304-18Z carrying promoter upstream from gabR

[8]

pHT-PgabTDR

pHT304-18Z carrying promoter upstream from gabT without GabR binding site

This study

pHT-PgabTDI

pHT304-18Z carrying promoter upstream from gabT without the first 21 repeat region of GabR binding site

This study

pHT-PsigL

pHT304-18Z carrying promoter upstream from sigL

This study

pHT1618-gabR

pHT1618 containing gabR promter and gabR gene, ApR

This study

pHT1618-DPAS

pHT1618 containing gabR promter and PAS domain deletion fragment, ApR

This study

DNA manipulation techniques

PCR was performed using Taq and KOD DNA polymerase (New England BioLabs Ltd., Beijing, China). Amplified fragments were purified using Axygen purification kits (Silicon Valley, CA, USA). Bt chromosomal DNA was extracted with the Puregene kit (Gentra, Minneapolis, MN, USA). Restriction enzymes and T4 DNA ligase (TaKaRa Biotechnology, Dalian, China) were used according to the manufacturer’s instructions. Oligonucleotide primers (Table 2) were synthesized by Sangon (Shanghai, China). E. coli plasmid DNA was extracted using the Axygen Plasmid Extraction Kit. All constructs were confirmed by DNA sequencing (BGI, Beijing, China).
Table 2

Primers used in this study

oligonucleotides

sequence (5’ - 3’)a

PgabT-F

GATTGCTATGCAATTGGGGTGC

PgabT-R

CCTTTTCTTTACATTGTTTTCTC

gabTRACE

CGAGCGATCTTCACCGCGTTCTCAACT

UPM

AAGCAGTGGTATCAACGCAGAGTACGCGGG

GabR-F

CGGGATCC GATGGTTGCAGAAAAGGAACG

GabR-R

GCGTCGAC TCCAATGTTTTCTTCCTCCTCTATG

PgabTDR-F

AACTGCAG GAACAAGCCTTGATGTAGCGAA

PgabTDR-1

CTATAAAGACTCTTAAAAAGAAAGTTGGCA

PgabTDR-2

TGCCAACTTTCTTTTTAAGAGTCTTTATAG

PgabTDR-R

CGGGATCC CCTTTTCTTTACATTGTTTTCTC

PgabTDI-1

GTCTAATGTGTAAGG TTAATGAGTCTTTAT

PgabTDI-2

ATAAAGACTCATTAACCTTACACATTAGAC

PsigL-F

CCCAAGCTT ATAGAGCGGTGGTTTCCGGTAC

PsigL-R

CGGGATCC AATAATCTCCCCCTTGTTTCTATTG

PgabRD-F

AACTGCAG GTGCTGGTGTACCGATAAG

PgabRD-R

CGGGATCC CGATCCACTTCACTACCTT

CgabR-1

CGGGATCC GTGCTGGTGTACCGATAAGT

CgabR-2

CCGGAATTC TTATCCAATGTTTTCTTCCTCC

DPAS-F

GGGATCGTTGTGCGTAATCAGCTAAAAAC

DPAS-R

GTTTTTAGCTGATTACGCACAACGATCC

a Restriction enzyme sites are italics.

Total RNA isolation and 5′-RACE analysis

For total RNA purification, strain HD73 was grown as previously described in SSM medium until the T7 stage of stationary phase (corresponding to 7 h after the end of the exponential phase) [21]. cDNA synthesis and transcriptional start sites (TSSs) of the gabT gene were determined using the SMARTer™ RACE cDNA Amplification Kit (Clontech, Mountain View, CA, USA) according to the manufacturer’s instructions. Gene-specific primers, gabTRACE, and the universal primer mix (UPM) (Table 2) were used to amplify the 5′ end of gabT mRNA.

Expression and purification of GabR protein

The expression plasmid pETgabR containing gabR from Bt strain HD73 was constructed by cloning the amplified gabR gene, using primers GabR-F (with a 5’ Bam HI restriction site) and GabR-R (with a 5’ Sal I restriction site), into pET21b previously digested with Bam HI and Sal I. pETgabR was transferred into E. coli BL21(DE3). Transformant E. coli cells were grown to exponential phase in LB medium supplemented with ampicillin at 37°C. The expression of GabR-His protein was induced with 1 mM (final concentration) isopropyl-β-D-thiogalactopyranoside for 3 h at 37°C. Cells were harvested by centrifugation at 13,500 g for 10 min and suspended in 10 mM imidazole NPB buffer (10 mM imidazole, 1 M NaCl, 20 mM sodium phosphate, pH 7.4). Bacteria were lysed on ice by sonication using an ultrasonic cell disruption system (Mini-Beadbeater-96, Biospec). The bacterial lysate was centrifuged at 16,000 g for 10 min at 4°C, and supernatant containing solubilized GabR-His protein was recovered, filtered through a 0.45-μm membrane filter, and loaded onto a HiTrap chelating column (1 ml, Pharmacia). After binding the protein, the column was washed with 10 mM imidazole NPB solution and the target GabR-His protein was eluted with NPB solution containing a stepwise gradient of imidazole from 100 to 500 mM.

Gel mobility shift assays

The PgabT DNA fragment was obtained by PCR of strain HD73 genomic DNA using primers PgabT-F and PgabT-R, which were previously labeled according to a fluorescent 5′-end 6-FAM modification and confirmed by DNA sequencing. Electrophoresis mobility shift assays (EMSA) were performed as previously described [22] to analyze the binding of purified GabR protein to PgabT DNA. Briefly, the PgabT DNA probe (0.1 μg) was incubated with different concentrations of purified GabR at 25°C for 20 min in binding buffer (10 mM Tris–HCl, 0.5 mM dithiothreitol (DTT), 50 mM NaCl, 500 ng poly (dI:dC), pH 7.5 and 4% (v/v) glycerol) in a total volume of 20 μl. The DNA-protein mixtures were applied to non-denaturing 5% (w/v) polyacrylamide gels in TBE buffer (90 mM Tris-base, 90 mM boric acid, 2 mM EDTA, pH 8.0) for resolution of the complexes, using a Mini-PROTEAN system (Bio-Rad) at 160 V for 1 h. Signals were visualized directly from the gel with the FLA Imager FLA-5100 (Fujifilm). The specificity of the shift was confirmed using poly (dI:dC), and GST protein, bovine serum albumin (BSA), and as negative controls, the cry1Ac and gerE promoters (which do not bind to GabR protein; data not shown). Increasing concentrations (0.1-50 μM) of SSA or GABA were incubated with the PgabT probe and GabR to analyze the effect of SSA and GABA on the binding of GabR and PgabT.

DNase I footprinting assays

DNase I footprinting assays were performed based on a fluorescent labeling procedure [23]. Briefly, gabT promoter DNA was PCR-amplified using the fluorescently-labeled primers PgabT-F and PgabT-R (Table 2) and purified from an agarose gel. The labeled PgabT DNA probe (120 ng) was incubated for 20 min at 25°C with the indicated concentrations of purified GabR and BSA in a total volume of 50 μl of binding buffer (described above for EMSA). DNase I digestion was then carried out for 1 min at 25°C and stopped with stop buffer (Promega). After phenol-chloroform extraction and ethanol precipitation, the samples were loaded on an Applied Biosystems 3730 DNA genetic analyzer together with an internal-lane size standard (ROX-500, Applied Biosystems). A dye primer-based sequencing kit (Thermo) was used to precisely determine the sequences after their alignment wtih the capillary electrophoresis results from the reactions. Electropherograms were analyzed with GeneMarker v1.8 (Applied Biosystems).

Construction of the PgabT-lacZ fusion bearing a deletion of GabR-binding site

A fragment containing the gabT promoter with the GabR-binding site deleted was cloned in fusion with the lacZ gene. The construct was obtained as follows: The downstream and upstream regions of the gabT promoter were amplified in two PCR reactions, using strain HD73 DNA as the template, and PgabTDR-F/PgabTDR-2 and PgabTDR-1/PgabTDR-R primers, respectively. These DNA fragments were fused by overlapping PCR using the primer pair PgabTDR-F/PgabTDR-R. The resulting PCR products were digested with Pst I and Bam HI, purified, and ligated into the low-copy-number vector pHT304-18Z [24], which harbors a promoterless lacZ gene. The recombinant plasmid named pHT-PgabTDR, which has a deletion of 60 bp corresponding to the GabR-binding site, was introduced into Bt strain HD73, yielding the transformant strain HD(PgabTDR-lacZ). Another recombinant plasmid, pHT-PgabTDI, which has a deletion of the first 21-bp repeat located in the GabR-binding site region, was constructed by a similar method. The downstream and upstream regions of the gabT promoter were amplified in two PCR reactions, using strain HD73 DNA as the template, and PgabTDR-F/PgabTDI-2 and PgabTDI-1/PgabTDI-R primers, respectively. These DNA fragments were fused by overlapping PCR using the primer pair PgabTDR-F/PgabTDR-R. The PCR products were digested with Pst I and Bam HI, purified, and ligated into the vector pHT304-18Z. The resulting plasmid, pHT-PgabTDI, was introduced into Bt strain HD73 yielding the transformant strain HD(PgabTDI-lacZ).

Construction of sigL and gabR promoters with lacZ gene fusion

In strain HD73, Sigma 54 is encoded by the sigL gene. 313 bp fragment from the sigL promoter was amplified from strain HD73 DNA using primers PsigL-F (with 5′- Hin dIII) and PsigL-R (with 5′-Bam HI) (Table 2). The Hin dIII-Bam HI restriction fragment of the sigL promoter was cloned into the vector pHT304-18Z. The recombinant plasmid, pHT-PsigL, was introduced into Bt strain HD73 yielding the transformant strain HD (PsigL-lacZ).

A fragment containing 633 bp of the gabR promoter was previously cloned [8]. Here, a truncated gabR promoter fragment of 580 bp was constructed, deleting the −12/-24 conserved element. The 580-bp gabR promoter fragment was amplified from strain HD73 DNA using PgabRD-F (with 5′- Pst I) and PgabRD-R (with 5′-Bam HI) primers (Table 2). The Pst I-Bam HI fragment of gabR promoter was then ligated into the vector pHT304-18Z [24]. The recombinant plasmid pHT-PgabRD was introduced into Bt strain HD73, and the resulting strain was named HD(PgabRD-lacZ).

Complementation of the gabR mutant and deletion of PAS domain

A DNA fragment containing gabR and the gabR promoter was amplified with CgabR-1 and CgabR-2 primers (Table 2) using Bt strain HD73 DNA as template. The PCR product (1,974 bp) was digested with Bam HI and Eco RI and ligated into plasmid pHT1618 [25]. The resulting plasmid (pHT1618-gabR) was amplified in E. coli and introduced into the Bt mutant strain ΔgabR(PgabT-lacZ). This plasmid complements the gabR mutant strain and allows evaluation of the expression of the gabT promoter-lacZ fusion.

A similar plasmid carrying the gabR promoter and gabR gene but without the PAS domain encoded sequence, was constructed by amplifiying two DNA fragments using strain HD73 DNA as the template and CgabR-1/DPAS-R and DPAS-F/CgabR-2 primers, respectively (Table 2). The amplified fragments were fused by an overlapping PCR using CgabR-1 and CgabR-2 primers. The final PCR product (1,689 bp) was digested with Eco RI and Bam HI, purified and ligated into plasmid pHT1618. The resulting plasmid (pHT1618-DPAS) was amplified in E. coli and introduced into the Bt mutant strain ΔgabR(PgabT-lacZ). This plasmid complements the gabR strain, with a gabR gene where the PAS domain (amino acids 33–128 of GabR) was deleted, and allows evaluation of the gabT promoter-lacZ fusion in β-galactoside activity assays. The resulting strains CgabR(PgabT) and DPAS(PgabT) were selected based on their erythromycin and tetracycline resistance and identified by PCR.

β-galactosidase assays

Bt strains containing lacZ transcriptional fusions were cultured in AOAC medium (supplemented with 7 mM glucose) at 30°C and 220 rpm. GABA or SSA at concentrations of 0, 0.2, 1 and 5 mM was added to the cultures when the OD600 reached 1.0 (mid-exponential phase, defined as A0). For PgabT and PgabR activity assay without GABA or SSA, T0 is the end of the exponential phase (OD600 = 2.0-2.2), and Tn is n hours after the end of the exponential phase. Samples of 2.0 ml were taken at 1-h intervals after induction. Cells were harvested by centrifugation for 1 min at 12,000 g, and the supernatant was discarded. The β-galactosidase-specific activities were determined as previously described [26] and expressed as Miller units. The values reported represent averages from at least three independent assays.

Results

Determination of the transcriptional start site of gabT

To determine the transcription start site (TSS) of gabT, 5′-RACE analysis was performed as described in the Materials and Methods. According to the sequences of 16 random clones, a G located 19 bp upstream from the start codon was identified in eight, and an A residue located 16 bp upstream of the start codon in the remaining eight. Thus two TSSs were located 16 and 19 bp upstream of the ATG start codon of gabT (Figure 1). The typical ribosome binding site (RBS) sequence (−AGGATG−) was identified at an appropriate distance upstream from the start codon of gabT. The sequence TGGCATACATTTGCA was identified upstream of the gabT start codon and was similar to the −12/−24 consensus sequence (BYGG CMYRNNNYYGC W) of Sigma 54-binding sites [27].
Figure 1

Nucleotide sequence of the gabT upstream region. Transcriptional start sites (TSSs, indicated by asterisks) are located 16 and 19 bp upstream from the start codon of the gabT gene (underlined). The putative ribosome-binding-site (RBS) is indicated by an upper line. The −12, −24 sequences are double underlined. The GabR binding site (boxed region) maps 58 bp upstream of the start codon of gabT. A 21-bp repeat region (underlined, gray and arrow) maps 105 bp upstream of the gabT start codon.

However, the two TSSs were located 25 bp and 28 bp from the putative −12 promoter element. In several Sigma 54-dependent promoters, the initiation of transcription is not precisely located 12 nt downstream from the conserved GC element [28]. For instance, in the case of the Rhodospirillum centenum cheAY promoter, the TSS is located 8 nt downstream of the −12 element [29]. In the Pseudomonas aeruginosa algD promoter, the TSS and −12 elements are 21 nt apart [30].

Identification of a GabR-binding site in the gabT promoter fragment

To determine whether GabR is able to bind the gabT promoter, GabR-His protein was expressed in E. coli and purified to near-homogeneity using Ni2+-affinity chromatography. The mobility of GabR-His in SDS-PAGE corresponded well to its predicted molecular mass of 57 kDa (Figure 2A). The ability of GabR to bind to a DNA fragment containing the PgabT (286 bp) promoter was examined by EMSA. FAM-labeled fragments containing the promoter regions of gabT were incubated with different amounts of GabR and assayed for the formation of protein-DNA complexes. Slower-migrating probe-protein complexes were observed upon incubation with increasing amounts of GabR (Figure 2B). A five-fold molar excess of unlabeled PgabT probe competed with the labeled PgabT probe, indicating specific binding (Figure 2B, lane 9). GabR did not bind to other labeled promoters from strain HD73, such as cry1Ac and gerE (data not shown). These results indicate that GabR recognizes and specifically binds to sequences within the gabT promoter fragment.
Figure 2

Identification of the GabR-binding site in the gabT promoter. Panel A, SDS-PAGE analysis of GabR (57 kDa) expressed in E. coli (pET21b-gabR) and purified by nickel affinity column chromatography. M, protein marker. Panel B, Electrophoresis mobility shift assay (EMSA) of the gabT promoter fragment (286 bp) after interaction with GabR. Lane 1, FAM-labeled PgabT probe; lanes 2–8, incubation of the probe with increasing concentrations of purified GabR indicated at the top of the figure. Each lane contained 0.1 μg of probe. Lane 9, incubation of a five-fold greater amount of unlabeled PgabT probe mixed with labeled PgabT probe and 8 μM GabR. Panel C, protection of a 96-bp sequence in the gabT promoter by GabR, as revealed in a DNase I footprinting protection assay. The fluorograms correspond to the control DNA (10 μM BSA) and to the protection reactions (with 3.2, 4.8 and 8 μM of GabR). Panel D, β-galactosidase activity assay of the gabT promoter with the GabR-binding site (), without the 60-bp GabR-binding site (▲), and without the first 21-bp repeat region of the GabR-binding site (). The deletion sequence is that underlined in Figure 2C. T0 is the end of exponential phase, and Tn is n hours after T0.

To precisely determine the GabR-binding site in the gabT promoter, DNase I footprinting assays were carried out using the same gabT promoter fragment used in the EMSA. A 96-bp fragment was protected by GabR binding (Figure 2C) (corresponding to the boxed sequence in the gabT region shown in Figure 1). Moreover, a 21-bp repeat region mapped 105 bp upstream of the start codon of gabT (Figure 1), with the 21-pb inverted repeat separated by 5 bp (shaded gray in Figure 1).

To determine whether the proposed 96-bp sequence is the GabR binding site in vivo, a 60-bp fragment of the binding site was deleted from the gabT promoter and the promoter carrying the deletion was fused to lacZ (PgabTDR-lacZ). The deleted sequence is underlined in Figure 2C. Another deletion fragment, in which the first 21-bp repeat located at the GabR-binding site region was removed, was similarly fused to lacZ (PgabTDI-lacZ). The deleted sequence is double-underlined in Figure 2C. The β-galactosidase assay showed that the activities of HD(PgabTDR-lacZ) and HD(PgabTDI-lacZ) strains were sharply decreased compared with that of wild-type strain HD73 carrying the gabT promoter fused to lacZ (PgabT-lacZ) (Figure 2D). This result shows that disruption of the proposed GabR-binding site prevents GabT expression in vivo.

GABA and SSA induce gabT expression

The PgabT-lacZ fusion showed lower activity in AOAC medium (Figure 3) than in SSM (Figure 2D). To analyze the inducible activity of the gabT promoter, cells were cultured in AOAC medium. The addition of 0.2, 1 and 5 mM GABA or SSA induced the expression of a PgabT-lacZ fusion (Figure 3A and B), confirming the induction of gabT expression by these two signaling molecules. However, they differed in their gabT transcription induction patterns: GABA caused induction after A3 (3 hours after the mid-exponential phase), whereas SSA caused nearly immediate induction. These results might be explained if we hypothesize that SSA is the direct signal, while GABA is the precursor of SSA signal synthesis.
Figure 3

Induction of gabT transcription by GABA and SSA. Bt strains containing a PgabT-lacZ transcriptional fusion were cultured in AOAC medium. At OD600 = 1.0 (A0), GABA and SSA were added at different concentrations. Samples were collected at 1-h intervals for 6 h after induction and β-galactosidase activity was assayed. Panel A, GABA was added to strain HD(PgabT-lacZ) at a final concentration of 0 mM (■), 0.2 mM (), 1 mM () and 5 mM (▲). Panel B, SSA was added to strain HD(PgabT-lacZ) at a final concentration of 0 mM (■), 0.2 mM (), 1 mM () and 5 mM (). A0 is mid-exponential phase (OD600 = 1.0), and An is n hours after A0.

Induction of gabT promoter activity by GABA and SSA depends on Sigma 54 and GabR

In a previous study, we demonstrated that gabT expression is controlled by Sigma 54, via the transcription activator GabR [8]. Here, we analyzed the effect of 1 mM GABA or SSA on PgabT transcription activity in sigL (Sigma 54 coding gene in Bt) or gabR mutants. Neither GABA nor SSA induced activation of the gabT promoter in ΔsigL or ΔgabR (Figure 4A and B). These data showed that GabR and Sigma 54 are absolutely necessary for gabT transcription and that GABA- or SSA-induced gabT transcription is controlled by Sigma 54 and activated by GabR bEBP.
Figure 4

Analysis of the transcriptional activation of gabT, gabR and sigL promoters. Panel A, analysis of β-galactosidase activity induced by the gabT promoter in strain HD73, the sigL mutant and the gabR mutant with or without GABA. Strain HD(PgabT-lacZ) without (■) and with () 1 mM GABA, strain ΔsigL(PgabT-lacZ) without (▲) and with () 1 mM GABA, strain ΔgabR(PgabT-lacZ) without () and with () 1 mM GABA. Panel B, analysis of β-galactosidase activity induced by the gabT promoter in strain HD73, the sigL mutant and the gabR mutant with or without SSA. Strain HD(PgabT-lacZ) without (■) and with () 1 mM SSA, strain ΔsigL(PgabT-lacZ) without (▲) and with () 1 mM SSA, strain ΔgabR(PgabT-lacZ) without (×) and with () 1 mM SSA. Panel C, analysis of β-galactosidase activity induced by the gabR promoter in strain HD73 with or without GABA and SSA. Strain HD(PgabR-lacZ) without GABA or SSA (■), with 1 mM GABA (), and with 1 mM SSA (▲). Panel D, analysis of β-galactosidase activity induced by the sigL promoter in strain HD73 with or without GABA and SSA. Strain HD(PsigL-lacZ) without GABA or SSA (■), with 1 mM GABA (), and with 1 mM SSA (▲). A0 is mid-exponential phase (OD600 = 1.0), and An is n hours after A0.

PgabT induction is not caused by GABA or SSA enhancement of the transcriptional activity of gabR or sigL

To determine whether GABA and SSA induced transcription of the gabT promoter by affecting sigL and gabR transcription, strains carrying sigL and gabR promoter fusions with lacZ were used [HD(PsigL-lacZ) and HD(PgabR-lacZ)]. The addition of GABA and SSA had no effect on either PgabR or PsigL transcriptional activities (Figure 4C and D), suggesting that the GABA- and SSA-induced transcription from the gabT promoter is not due to the increased expression of sigL or gabR. Increasing concentrations of GABA and SSA did not enhance the binding of GabR to the gabT promoter (Additional file 1: Figure S1). Thus, the induction of PgabT by GABA and SSA is not caused by activating GabR and DNA binding.

The gabR promoter is not a Sigma 54-dependent promoter

In the following, we provide additional evidence that transcription from the gabR promoter is not dependent on SigL, nor is it activated by GabR, which differs from the conclusion reached in our previous study [8]. EMSA performed to analyze the binding of GabR to the PgabR promoter showed that GabR did not bind to its own gabR promoter (Figure 5B). The β-galactosidase activity of the gabR promoter was tested again in the sigL and gabR mutants. The results failed to showed significant difference in the gabR promoter activities of wild-type strain HD73 and the sigL and gabR mutants (Figure 5C). Furthermore, deletion of a Sigma 54-like −12/−24 conserved region in the gabR promoter (PgabRD highlighted in Figure 5A) had no effect on PgabR transcription (Figure 5D). It should be noted that several reports have shown that deletion of one or more nucleotides in the stretch included in the −24/−12 elements of Sigma 54-dependent promoters abolishes promoter function [31],[32]. Those studies proposed that there is a stringent requirement for these motifs to be positioned on the same face of the DNA helix as a necessary condition for the binding of RNA polymerase and Sigma 54 [28]. Since there are only 11 nt in −24/−12 elements of the gabR promoter, it is not a typical Sigma 54-dependent promoter. Furthermore, GABA and SSA had no effect on the binding of GabR to the gabT promoter, as judged by EMSA assays (data not shown), suggesting that GABA and SSA activation of PgabT is not caused by enhanced GabR-binding to DNA.
Figure 5

Analysis of the role of Sigma 54 and GabR on gabR transcription. Panel A, Model of the gabR upstream region. The PgabR (633 bp) fragment contains the wild-type promoter, the PgabRD(580 bp) fragment of the gabR promoter without the −12/−24-like elements, and the PgabRE(253 bp) fragment is used for GabR binding. Panel B, EMSA for PgabRE after interaction with GabR. Lane 1, FAM-labeled PgabT probe; Lane 2, probe PgabT was incubated with 5.6 μM of purified GabR. Lane 3–6, the FAM-labeled PgabRE probe was incubated with increasing concentrations of purified GabR as shown at the top of the figure. Each lane contained 0.1 μg of probe. C. β-galactosidase activity assay of PgabR in wild-type strain HD73 (▲), the sigL mutant () and the gabR mutant (■). D. β-galactosidase activity assay of PgabRD in wild-type strain HD73 (▲), the sigL mutant () and the gabR mutant (■). T0 is the end of exponential phase, and Tn is n hours after T0.

The PAS domain of GabR plays a role in the GABA-inducible transcription of gabT

GabR is a Sigma 54-dependent transcriptional activator containing three typical domains, similar to those in other bEBPs, including a PAS domain in the N-terminal region (Figure 6A). To determine the role of PAS domain in GABA-induced transcription of gabT, a PAS domain deletion in GabR was constructed and its capacity to induce the gabT promoter was compared with that of wild-type GabR. The GabR ΔPAS mutant (DPAS) and GabR wild-type (CgabR) proteins were then used to complement a GabR mutant. The transcriptional activity of gabT was determined by measuring β-galactosidase activity of the fusion protein (see Methods). As shown in Figure 6B, gabT promoter activity in strain DPAS(PgabT) was higher than that of strain CgabR(PgabT) without the addition of GABA. Interestingly, GABA had no effect on the transcriptional activity of DPAS (PgabT) (Figure 6B). These data suggest that the PAS domain in GabR is repressing its enhancer transcriptional activity on the gabT promoter. Repression is released upon GABA addition, whereupon transcription is induced.
Figure 6

Analysis of the role of the PAS domain of GabR in gabT transcription. Panel A, Domain organization of GabR. GabR is a Sigma 54-dependent activator that has three typical domains, the N-terminal regulatory domain (PAS domain, amino acids 22–119), the central AAA+ domain (amino acids 149–320) and C-terminal DNA-binding domain (HTH, amino acids 408–447). In the PAS domain deletion strain DPAS, the PAS domain from amino acids 33 to 128 is deleted from GabR. The gabR promoter region (606 bp) was used to construct the pHT1618-gabR and pHT1618-DPAS plasmids. Panel B, analysis of β-galactosidase activity induced from the gabT promoter in the Bt strain complemented with GabR or with the PAS deletion mutant in the presence or absence of GABA. Strain CgabR without (■), and with () 5 mM GABA, strain DPAS without (), and with (▲) 5 mM GABA. A0 is mid-exponential phase (OD600 = 1.0), and An is n hours after A0.

Discussion

The structure of the gab gene cluster in Bt is different from those found in E. coli and B. subtilis[8]. We confirmed that expression of gabT in Bt is positively regulated by GabR, which is a Sigma 54-dependent transcriptional activator, and that GabR specifically binds to the gabT promoter. Transcriptional activation of gabT by GabR is mediated by the signal molecules GABA and SSA. In Bt, GabR is not involved in gabR transcriptional activation and GABA and SSA had no effect on sigL or gabR transcription. By contrast, in B. subtilis, gabD and gabT form a GABA-inducible operon, with GabR, encoded by a divergent gene, gabR, acting as a transcriptional regulator of both the gabTD operon and its own gene [33]. In B. subtilis, the presence of both GABA and pyridoxal 5′-phosphate (PLP) is required for GabR-dependent activation of the gabT promoter. The efficiency of the GabR-dependent repression of the gabR transcript is not affected by the addition of PLP or GABA [33]. In this work we showed that the GABA-inducible mechanism in Bt is different from that in B. subtilis.

These different induction mechanisms can be attributed to the different GabR structures found in Bt and B. subtilis. GabR of B. subtilis is a member of the understudied MocR/GabR subfamily of the GntR family of transcription regulators [34]. GabR in B. subtilis has a short N-terminal HTH-containing domain and a long C-terminal domain that is similar to full-length aminotransferases or to the PLP-binding domain of aminotransferases [33]. The GabR structure provides a model for DNA binding at the gabR-gabT locus by one or more GabR homodimers. GabR aminotransferase-like activity involving GABA and PLP is not essential to its primary function as a transcriptional regulator [34]. However, GabR in Bt is a Sigma 54-dependent transcriptional activator, also referred to as a bacterial enhancer binding protein (bEBP). GabR comprises three domains (Figure 6A), including an N-terminal PAS domain. Here, we showed that the PAS domain of GabR, which is the signal sensor domain, is required for the regulation of GABA-inducible transcriptional activity of the gabT promoter.

The role of the N-terminal regulatory domain of bEBPs has been documented in many Sigma 54-dependent transcriptional activators, whereas little is known about the function of the PAS domain, even though PAS domain is present in many bEBPs. Indeed, only the PAS domain of the bEBP-like protein TyrR has been investigated [16]. TyrR contains both a PAS domain and an ACT domain and it facilitates the activation or repression of the transcription of genes involved in aromatic amino acid biosynthesis and transport. In this study, we found that deletion of the PAS domain of GabR in Bt results in induced gabT expression and that induction is not dependent on GABA. The gabT promoter activity in the PAS domain deletion strain was higher than that in the strain containing wild-type GabR. These data suggests that the PAS domain of GabR acts as a signal sensor domain that is repressing GabR enhancer transcriptional activity on the gabT promoter. Repression is released upon GABA addition, whereupon transcription is induced. This model agrees with the proposed function of the N-terminal regulatory domain of bEBPs in modulating the activity of bEBPs. PAS domains have been shown to bind a diverse array of ligands [15]. In the case of Bt, it is proposed that the PAS domain of GabR binds to GABA and/or SSA. It will be interesting to determine whether the PAS domain of other bEBPs functions in a similar way, i.e., by repressing bEBPs enhancer transcriptional activity after the sensing of signal ligands.

Conclusions

The data presented here improve our understanding of the regulation of the gab gene cluster in Bt and form the basis of a new regulatory model is proposed herein (Figure 7). Two transcriptional units, gabT and gabRD, in the gab gene cluster are involved in the GABA shunt. GABA and SSA are the signals involved in gabT transcription, via the PAS domain of GabR. Transcription of gabT is controlled by Sigma 54, and activated by GabR, through binding to a 96 bp region on the gabT promoter. The PAS domain of GabR acts as a signal sensor domain, modulating GabR activity. The data suggest that the PAS domain in GabR is repressing its enhancer transcriptional activity on the gabT promoter. Repression is released upon GABA addition, whereupon transcription is induced.
Figure 7

Schematic diagram of the regulatory pattern of the gab gene cluster in Bt. The hollow arrows (from left to right) indicate the gabT, gabR, and gabD genes. PgabT and PgabR are the putative promoter regions of gabT and gabR, respectively. The dashed circle indicates the TCA cycle. There are two transcriptional units, gabT and gabRD, in the gab gene cluster involved in the GABA shunt. GABA and SSA are the signals that induce gabT transcription via the PAS domain of GabR. Transcription of gabT is controlled by Sigma 54, and activated by GabR, via the binding to the 96-bp fragment of the gabT promoter.

Additional file

Declarations

Acknowledgements

This work was supported by grant from the National Natural Science Foundation of China (Nos. 31270111 and 31300085) and the National High Technology Research and Development Program of China (863 Program; 2011AA10A203). We thank Dr. Mario Soberon and Dr. Alejandra Bravo from Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, and Dr. Didier Lereclus from the Institut National de la Recherche Agronomique for their critical suggestions.

Authors’ Affiliations

(1)
State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences
(2)
College of Life Sciences, Northeast Agriculture University

References

  1. Varju P, Katarova Z, Madarasz E, Szabo G: GABA signalling during development: new data and old questions. Cell Tissue Res. 2001, 305 (2): 239-246. 10.1007/s004410100356.View ArticlePubMedGoogle Scholar
  2. Shelp BJ, Bown AW, McLean MD: Metabolism and functions of gamma-aminobutyric acid. Trends Plant Sci. 1999, 4 (11): 446-452. 10.1016/S1360-1385(99)01486-7.View ArticlePubMedGoogle Scholar
  3. Bartsch K, von Johnn-Marteville A, Schulz A: Molecular analysis of two genes of the Escherichia coli gab cluster: nucleotide sequence of the glutamate:succinic semialdehyde transaminase gene (gabT) and characterization of the succinic semialdehyde dehydrogenase gene (gabD). J Bacteriol. 1990, 172 (12): 7035-7042.PubMed CentralPubMedGoogle Scholar
  4. Prell J, Bourdes A, Karunakaran R, Lopez-Gomez M, Poole P: Pathway of gamma-aminobutyrate metabolism in Rhizobium leguminosarum 3841 and its role in symbiosis. J Bacteriol. 2009, 191 (7): 2177-2186. 10.1128/JB.01714-08.PubMed CentralView ArticlePubMedGoogle Scholar
  5. Belitsky BR, Sonenshein AL: GabR, a member of a novel protein family, regulates the utilization of gamma-aminobutyrate in Bacillus subtilis. Mol Microbiol. 2002, 45 (2): 569-583. 10.1046/j.1365-2958.2002.03036.x.View ArticlePubMedGoogle Scholar
  6. Aronson JN, Borris DP, Doerner JF, Akers E: Gamma-aminobutyric acid pathway and modified tricarboxylic acid cycle activity during growth and sporulation of Bacillus thuringiensis. Appl Microbiol. 1975, 30 (3): 489-492.PubMed CentralPubMedGoogle Scholar
  7. Nickerson KW, De Pinto J, Bulla LA: Sporulation of Bacillus thuringiensis without concurrent derepression of the tricarboxylic acid cycle. J Bacteriol. 1974, 117 (1): 321-323.PubMed CentralPubMedGoogle Scholar
  8. Zhu L, Peng Q, Song F, Jiang Y, Sun C, Zhang J, Huang D: Structure and regulation of the gab gene cluster, involved in the gamma-aminobutyric acid shunt, are controlled by a sigma54 factor in Bacillus thuringiensis. J Bacteriol. 2010, 192 (1): 346-355. 10.1128/JB.01038-09.PubMed CentralView ArticlePubMedGoogle Scholar
  9. Bush M, Dixon R: The role of bacterial enhancer binding proteins as specialized activators of sigma54-dependent transcription. Microbiol Mol Biol Rev. 2012, 76 (3): 497-529. 10.1128/MMBR.00006-12.PubMed CentralView ArticlePubMedGoogle Scholar
  10. Reitzer L: Nitrogen assimilation and global regulation in Escherichia coli. Annu Rev Microbiol. 2003, 57: 155-176. 10.1146/annurev.micro.57.030502.090820.View ArticlePubMedGoogle Scholar
  11. Meyer MG, Park S, Zeringue L, Staley M, McKinstry M, Kaufman RI, Zhang H, Yan D, Yennawar N, Yennawar H, Farber GK, Nixon BT: A dimeric two-component receiver domain inhibits the sigma54-dependent ATPase in DctD. FASEB J. 2001, 15 (7): 1326-1328.PubMedGoogle Scholar
  12. Leonhartsberger S, Huber A, Lottspeich F, Bock A: The hydH/G Genes from Escherichia coli code for a zinc and lead responsive two-component regulatory system. J Mol Biol. 2001, 307 (1): 93-105. 10.1006/jmbi.2000.4451.View ArticlePubMedGoogle Scholar
  13. Brahmachary P, Dashti MG, Olson JW, Hoover TR: Helicobacter pylori FlgR is an enhancer-independent activator of sigma54-RNA polymerase holoenzyme. J Bacteriol. 2004, 186 (14): 4535-4542. 10.1128/JB.186.14.4535-4542.2004.PubMed CentralView ArticlePubMedGoogle Scholar
  14. Hopper S, Bock A: Effector-mediated stimulation of ATPase activity by the sigma 54-dependent transcriptional activator FHLA from Escherichia coli. J Bacteriol. 1995, 177 (10): 2798-2803.PubMed CentralPubMedGoogle Scholar
  15. Henry JT, Crosson S: Ligand-binding PAS domains in a genomic, cellular, and structural context. Annu Rev Microbiol. 2011, 65: 261-286. 10.1146/annurev-micro-121809-151631.PubMed CentralView ArticlePubMedGoogle Scholar
  16. Pittard J, Camakaris H, Yang J: The TyrR regulon. Mol Microbiol. 2005, 55 (1): 16-26. 10.1111/j.1365-2958.2004.04385.x.View ArticlePubMedGoogle Scholar
  17. Liu G, Song L, Shu C, Wang P, Deng C, Peng Q, Lereclus D, Wang X, Huang D, Zhang J, Song F: Complete genome sequence of Bacillus thuringiensis subsp. kurstaki strain HD73. Genome Announcements. 2013, 1 (2): e0008013-10.1128/genomeA.00080-13.View ArticlePubMedGoogle Scholar
  18. Dower WJ, Miller JF, Ragsdale CW: High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res. 1988, 16 (13): 6127-6145. 10.1093/nar/16.13.6127.PubMed CentralView ArticlePubMedGoogle Scholar
  19. Lereclus D, Arantes O, Chaufaux J, Lecadet M: Transformation and expression of a cloned delta-endotoxin gene in Bacillus thuringiensis. FEMS Microbiol Lett. 1989, 51 (1): 211-217.PubMedGoogle Scholar
  20. Schaeffer P, Millet J, Aubert JP: Catabolic repression of bacterial sporulation. Proc Natl Acad Sci U S A. 1965, 54 (3): 704-711. 10.1073/pnas.54.3.704.PubMed CentralView ArticlePubMedGoogle Scholar
  21. Du L, Qiu L, Peng Q, Lereclus D, Zhang J, Song F, Huang D: Identification of the promoter in the intergenic region between orf1 and cry8Ea1 controlled by sigma H factor. Appl Environ Microbiol. 2012, 78 (12): 4164-4168. 10.1128/AEM.00622-12.PubMed CentralView ArticlePubMedGoogle Scholar
  22. Li R, Liu G, Xie Z, He X, Chen W, Deng Z, Tan H: PolY, a transcriptional regulator with ATPase activity, directly activates transcription of polR in polyoxin biosynthesis in Streptomyces cacaoi. Mol Microbiol. 2010, 75 (2): 349-364. 10.1111/j.1365-2958.2009.06968.x.View ArticlePubMedGoogle Scholar
  23. Zianni M, Tessanne K, Merighi M, Laguna R, Tabita FR: Identification of the DNA bases of a DNase I footprint by the use of dye primer sequencing on an automated capillary DNA analysis instrument. J Biomol Tech. 2006, 17 (2): 103-113.PubMed CentralPubMedGoogle Scholar
  24. Agaisse H, Lereclus D: Structural and functional analysis of the promoter region involved in full expression of the cryIIIA toxin gene of Bacillus thuringiensis. Mol Microbiol. 1994, 13 (1): 97-107. 10.1111/j.1365-2958.1994.tb00405.x.View ArticlePubMedGoogle Scholar
  25. Lereclus D, Arantes O:spbA locus ensures the segregational stability of pTH1030, a novel type of gram-positive replicon. Mol Microbiol. 1992, 6 (1): 35-46. 10.1111/j.1365-2958.1992.tb00835.x.View ArticlePubMedGoogle Scholar
  26. Bouillaut L, Ramarao N, Buisson C, Gilois N, Gohar M, Lereclus D, Nielsen-Leroux C: FlhA influences Bacillus thuringiensis PlcR-regulated gene transcription, protein production, and virulence. Appl Environ Microbiol. 2005, 71 (12): 8903-8910. 10.1128/AEM.71.12.8903-8910.2005.PubMed CentralView ArticlePubMedGoogle Scholar
  27. Francke C, Groot Kormelink T, Hagemeijer Y, Overmars L, Sluijter V, Moezelaar R, Siezen RJ: Comparative analyses imply that the enigmatic Sigma factor 54 is a central controller of the bacterial exterior. BMC Genomics. 2011, 12: 385-10.1186/1471-2164-12-385.PubMed CentralView ArticlePubMedGoogle Scholar
  28. Barrios H, Valderrama B, Morett E: Compilation and analysis of sigma(54)-dependent promoter sequences. Nucleic Acids Res. 1999, 27 (22): 4305-4313. 10.1093/nar/27.22.4305.PubMed CentralView ArticlePubMedGoogle Scholar
  29. Jiang ZY, Bauer CE: Analysis of a chemotaxis operon from Rhodospirillum centenum. J Bacteriol. 1997, 179 (18): 5712-5719.PubMed CentralPubMedGoogle Scholar
  30. Wozniak DJ: Integration host factor and sequences downstream of the Pseudomonas aeruginosa algD transcription start site are required for expression. J Bacteriol. 1994, 176 (16): 5068-5076.PubMed CentralPubMedGoogle Scholar
  31. Keseler IM, Kaiser D: An early A-signal-dependent gene in Myxococcus xanthus has a sigma 54-like promoter. J Bacteriol. 1995, 177 (16): 4638-4644.PubMed CentralPubMedGoogle Scholar
  32. Mullin DA, Newton A: A sigma 54 promoter and downstream sequence elements ftr2 and ftr3 are required for regulated expression of divergent transcription units flaN and flbG in Caulobacter crescentus. J Bacteriol. 1993, 175 (7): 2067-2076.PubMed CentralPubMedGoogle Scholar
  33. Belitsky BR:Bacillus subtilis GabR, a protein with DNA-binding and aminotransferase domains, is a PLP-dependent transcriptional regulator. J Mol Biol. 2004, 340 (4): 655-664. 10.1016/j.jmb.2004.05.020.View ArticlePubMedGoogle Scholar
  34. Edayathumangalam R, Wu R, Garcia R, Wang Y, Wang W, Kreinbring CA, Bach A, Liao J, Stone TA, Terwilliger TC, Hoang QQ, Belitsky BR, Petsko GA, Ringe D, Liu D: Crystal structure of Bacillus subtilis GabR, an autorepressor and transcriptional activator of gabT. Proc Natl Acad Sci U S A. 2013, 110 (44): 17820-17825. 10.1073/pnas.1315887110.PubMed CentralView ArticlePubMedGoogle Scholar

Copyright

© Peng et al.; licensee BioMed Central. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement