Skip to content

Advertisement

You're viewing the new version of our site. Please leave us feedback.

Learn more

BMC Microbiology

Open Access

Multiplex real-time PCR assay for detection of Escherichia coli O157:H7 and screening for non-O157 Shiga toxin-producing E. coli

BMC MicrobiologyBMC series – open, inclusive and trusted201717:215

https://doi.org/10.1186/s12866-017-1123-2

Received: 26 June 2017

Accepted: 27 October 2017

Published: 9 November 2017

Abstract

Background

Shiga toxin-producing Escherichia coli (STEC), including E. coli O157:H7, are responsible for numerous foodborne outbreaks annually worldwide. E. coli O157:H7, as well as pathogenic non-O157:H7 STECs, can cause life-threating complications, such as bloody diarrhea (hemolytic colitis) and hemolytic-uremic syndrome (HUS). Previously, we developed a real-time PCR assay to detect E. coli O157:H7 in foods by targeting a unique putative fimbriae protein Z3276. To extend the detection spectrum of the assay, we report a multiplex real-time PCR assay to specifically detect E. coli O157:H7 and screen for non-O157 STEC by targeting Z3276 and Shiga toxin genes (stx1 and stx2). Also, an internal amplification control (IAC) was incorporated into the assay to monitor the amplification efficiency.

Methods

The multiplex real-time PCR assay was developed using the Life Technology ABI 7500 System platform and the standard chemistry. The optimal amplification mixture of the assay contains 12.5 μl of 2 × Universal Master Mix (Life Technology), 200 nM forward and reverse primers, appropriate concentrations of four probes [(Z3276 (80 nM), stx1 (80 nM), stx2 (20 nM), and IAC (40 nM)], 2 μl of template DNA, and water (to make up to 25 μl in total volume). The amplification conditions of the assay were set as follows: activation of TaqMan at 95 °C for 10 min, then 40 cycles of denaturation at 95 °C for 10 s and annealing/extension at 60 °C for 60 s.

Results

The multiplex assay was optimized for amplification conditions. The limit of detection (LOD) for the multiplex assay was determined to be 200 fg of bacterial DNA, which is equivalent to 40 CFU per reaction which is similar to the LOD generated in single targeted PCRs. Inclusivity and exclusivity determinants were performed with 196 bacterial strains. All E. coli O157:H7 (n = 135) were detected as positive and all STEC strains (n = 33) were positive for stx1, or stx2, or stx1 and stx2 (Table 1). No cross reactivity was detected with Salmonella enterica, Shigella strains, or any other pathogenic strains tested.

Conclusions

A multiplex real-time PCR assay that can rapidly and simultaneously detect E. coli O157:H7 and screen for non-O157 STEC strains has been developed and assessed for efficacy. The inclusivity and exclusivity tests demonstrated high sensitivity and specificity of the multiplex real-time PCR assay. In addition, this multiplex assay was shown to be effective for the detection of E. coli O157:H7 from two common food matrices, beef and spinach, and may be applied for detection of E. coli O157:H7 and screening for non-O157 STEC strains from other food matrices as well.

Keywords

Multiplex real-time PCR Escherichia coli O157:H7Shiga toxins (stx1, stx2)Shiga toxin-producing E. col (STEC)non-O157Limit of detection (LOD)Pathogen detectionSensitivity

Background

Shiga toxin-producing Escherichia coli (STEC), including E. coli O157:H7, is a heterogeneous group of enteric pathogens responsible for numerous sporadic infections and large outbreaks annually worldwide [1]. Besides E. coli O157:H7, non-O157 STEC strains are important foodborne pathogens estimated to cause over 112,752 cases illnesses each year in the United States [2]. Shiga toxin (Stx) production, especially Stx2, has been implicated as an important factor in causing severe disease and hemolytic uremic syndrome (HUS) [35].

E. coli serotype O157:H7 was first recognized as a causative agent of food contamination outbreaks in 1982 in Oregon and Michigan [6]. Since then, numerous E. coli O157:H7 outbreaks have been reported worldwide [7]. In the United States alone during 2003 - 2012, 390 outbreaks of E. coli O157:H7 infections were documented, which resulted in 4,928 illnesses, 1,272 hospitalizations, and 33 deaths [8]. The typical symptoms caused by E. coli O157:H7 include abdominal pain, watery diarrhea and potential progression to bloody diarrhea (hemorrhagic colitis) [9]. The pathological features of hemorrhagic colitis are attributed to the production of Shiga like cytotoxins (Stx1 and Stx2), which consists of a 32-kDa A subunit and five identical 7.7 kDa B subunits. These toxins can bind to receptors located on membranes of eukaryotic cell and cause tissue damage resulting in pathological outcomes [4, 5, 10, 11]. Non-O157 STEC strains are foodborne pathogens and have been responsible for sporadic cases of infections and outbreaks. Although O157:H7 has garnered more attention, primarily based on historical record, recent attention has recognized the significance of non-O157 STEC strains as a pathogen [9, 1220]. Considerable attention is now drawn to non-O157 STEC strains particularly after the occurrence of a severe foodborne outbreak happened in 2011 in Germany caused by consumption of sprouts contaminated by STEC O104:H4 [21].

The clinical significance and economic burden associated with outbreaks caused by E. coli O157:H7 and non-O157 STEC have led to development of a variety of detection methods. These include the application of conventional bacteriological methods using selective media or chromogenic agar, which usually take several days to complete [1, 9, 22], and molecular-based assays such as PCR-based methods [2325], microarray [2527], and whole genomic sequencing (WGS) [25, 28, 29]. Of these molecular methods, real-time PCR is a commonly used method [9]. More importantly, real-time PCR enables detection to be coincided with the amplification process by the introduction of fluorogenic probes [23], and multiplex real-time PCR allows multiple genes to be simultaneously amplified either from one template [9] or multiple templates by using different primer pairs [24].

Multiplex real-time PCR has gained more acceptance and use due to its ability to its differentiation potential and reliability [11, 30]. Various target genes have been used in PCR detection scheme for E.coli O157:H7, including the Shiga toxin genes (stx1 and stx2) [9, 12, 13], eae [31, 32], fimA [33], rfbE [34], uidA [24, 35], and Z3276 [23, 36, 37]. Of the target genes, uidA is most commonly used. Specificity with this gene is based on a highly conserved point mutation at position 93 of the β-glucuronidase gene [38, 39]. However, when a uidA-based commercial kit was used for identification of a large number of E. coli O157:H7 isolates (n = 391), numerus strains (n = 21) did not generate an amplified product. This prompted us to search for a more specific and reliable gene target for detection of E. coli O157:H7 [23]. As a result, a real-time PCR-based on Z3276 gene, a putative unique fimbriae gene in E. coli O157:H7 [40], was developed. All the 391 isolates, including the 21 strains that were “negative” by the uidA-based commercial kit, that were tested were positively identified [23]. The primary focus of our previous study was to search for a unique genetic marker and the development of a real-time PCR assay for the detection of E.coli O157:H7, and the Shiga toxin genes were not included in that assay [23]. Since the annual number of episodes of domestically acquired foodborne illnesses caused by non-O157 STEC (112,752) is almost doubled that of E. coli O157:H7 (63,153) in the United States [2], the inclusion of the stx genes can be used as the primary characteristic for STEC detection within the heterogeneous STEC group [41]. Thus, in the present study, we incorporated in a multiplex real-time PCR assay the Z3276, stx1, and stx2 genes, as well as an internal amplification control to for detection of Escherichia coli O157:H7 and screening for non-O157 STEC. In addition, the assay was assessed with two common food matrices, beef and spinach, for specific detection of E. coli O157:H7 and non-O157 STEC strains.

Methods

Bacterial strains and growth conditions

All the E. coli O157:H7 and non-O157 STEC strains used in this study are listed in Table 1. EDL933 (ATCC 43985) was used as the E. coli O157:H7 reference strain. Strains of E. coli O157:H7 (n = 135) and non-O157 STEC (n = 33) were used for inclusivity determination. Salmonella enterica strains, Shigella strains and other pathogenic strains were used for the exclusivity test (Table 2). These strains are all from the strain collections of Division of Molecular Biology, Food and Drug Administration (FDA).
Table 1

Results of E. coli O157:H7 and non-O157 STEC strains detected by the multiplex real-time PCR assay

Strain

Serotype

Source

Target gene

Z3276

stx1

stx2

EC1275

O157:H7

CDC EDL933, hamburger meat

+

+

+

EC1225

O157:H7

WA, 1993

+

+

+

EC1759

O157:H7

USA (MI), 2003

+

+

+

EC1429

O157:H7

Denmark, 1987

+

-

+

EC4420

O157:H7

NY, 12/2006

+

-

+

EC4421

O157:H7

White Onions, NY, 12/2006

+

+

+

EC4422

O157:H7

White Onions, NY, 12/2006

+

+

+

EC4504

O157:H7

MN, 12/2006

+

+

+

EC1428

O157:H7

Argentina, 1977

+

-

+

EC1738

O157:H7

Food isolate

+

-

+

EC1530

O157:H7

Thailand, 1994

+

-

+

EC4440

O157:H7

CDC

+

+

+

EC4163

O157:H7

USA (IL)

+

-

+

EC4438

O157:H7

CDC

+

-

+

EC4431

O157:H7

NY, 12/2006

+

-

+

EC4452

O157:H7

USA (NJ), 2006

+

-

+

EC1709

O157:H7

USA (MI), 2002

+

-

+

EC1760

O157:H7

USA (MI), 2004

+

-

+

EC1431

O157:H7

Japan, 1987

+

-

+

EC4115

O157:H7

Sep-06

+

-

+

EC1734

O157:H7

MA, 2009

+

-

+

EC4302

O157:H7

NY, 12/2006

+

+

+

EC4301

O157:H7

NY, 12/2006

+

+

+

EC4429

O157:H7

NY, 12/2006

+

-

+

EC4428

O157:H7

NY, 12/2006

+

-

+

EC4437

O157:H7

NJ, 12/2006

+

-

+

EC4436

O157:H7

NJ, 12/2006

+

-

+

EC4434

O157:H7

NY, 12/2006

+

-

+

EC4433

O157:H7

NY, 12/2006

+

-

+

EC4432

O157:H7

NY, 12/2006

+

-

+

EC4449

O157:H7

NJ, 12/2006

+

-

+

EC4448

O157:H7

WI, 12/2006

+

-

+

EC4447

O157:H7

CA, 12/2006

+

+

+

EC4201

O157:H7

USA (CA), 2006

+

-

+

EC4456

O157:H7

USA (NJ),2006

+

-

+

EC4461

O157:H7

USA (NJ),2006

+

-

+

EC4502

O157:H7

USA (NJ),2006

+

+

+

EC4503

O157:H7

USA (NJ),2006

+

+

+

EC4505

O157:H7

USA (NJ),2006

+

+

+

EC4511

O157:H7

USA (NJ),2006

+

+

+

EC4200

O157:H7

USA (CA), 2006

+

-

+

EC1267

O157:H7

USA, (NH), 1991

+

+

+

EC1268

O157:H7

USA (MT), 1991

+

+

+

EC4194

O157:H7

USA (CA), 2006

+

-

+

EC1590

O157:H7

USA (WA)

+

+

+

EC4458

O157:H7

USA (NJ),2006

+

-

+

EC4197

O157:H7

USA (CA), 2006

+

-

+

EC1231

O157:H7

USA (WA), 1995

+

+

+

EC4470

O157:H7

USA (NJ),2006

+

-

+

EC4471

O157:H7

USA (NJ),2006

+

-

+

EC1244

O157:H7

USA (GA), 1992

+

+

+

EC4199

O157:H7

USA (CA), 2006

+

-

+

EC1260

O157:H7

USA (GA),1993

+

-

+

EC4167

O157:H7

USA (WI), 2006

+

-

+

EC4168

O157:H7

USA (WI), 2006

+

-

+

EC4193

O157:H7

USA (OH), 2006

+

-

+

EC1265

O157:H7

USA (CA), 1993

+

+

+

EC4184

O157:H7

USA (IL), 2006

+

-

+

EC4204

O157:H7

USA (CA), 2006

+

-

+

EC4171

O157:H7

USA (WI), 2006

+

-

+

EC4205

O157:H7

USA (CA), 2006

+

-

+

EC4206

O157:H7

USA (CA), 2006

+

-

+

EC1593

O157:H7

USA (MI), 2003

+

+

+

EC1239

O157:H7

USA (NE), 1993

+

-

+

EC4174

O157:H7

USA (IL), 2006

+

-

+

EC4187

O157:H7

USA (CT), 2006

+

-

+

EC4188

O157:H7

USA (CT), 2006

+

-

+

EC4191

O157:H7

Spinach, USA (IL), 2006

+

-

+

EC1276

O157:H7

Japan, 1996

+

+

+

EC4501

O157:H7

MN, 12/2006

+

+

+

EC558

O157:H7

Patient raw milk

+

+

+

EC867

O157:H7

USDA-FSIS-380-94

+

+

+

EC874

O157:H7

Apple cider

+

+

+

EC4162

O157:H7

Feces (New Jersey)

+

-

+

EC506

O157:H7

Feces

+

-

+

EC507

O157:H7

Feces

+

+

+

EC4443

O157:H7

CDC

+

+

+

EC4442

O157:H7

CDC

+

+

+

EC4441

O157:H7

CDC

+

+

+

EC4451

O157:H7

NJ, 12/2006

+

-

+

EC4445

O157:H7

NJ, 12/2006

+

+

+

EC4446

O157:H7

NJ, 12/2006

+

+

+

EC1601

O157:H7

USA (MI), 2002

+

+

+

EC1727

O157:H7

MI, 2002

+

+

+

EC1426

O157:H7

Canada, 1988

+

-

+

EC4419

O157:H7

NY, 12/2006

+

-

+

EC4418

O157:H7

NY, 12/2006

+

-

+

EC4417

O157:H7

NY, 12/2006

+

-

+

EC4416

O157:H7

NY, 12/2006

+

-

+

EC4423

O157:H7

NY, 12/2006

+

-

+

EC4424

O157:H7

NY, 12/2006

+

-

+

EC4427

O157:H7

NY, 12/2006

+

-

+

EC4426

O157:H7

NY, 12/2006

+

-

+

EC4435

O157:H7

NY, 12/2006

+

-

+

EC4425

O157:H7

NY, 12/2006

+

-

+

EC4164

O157:H7

USA (WI), 2006

+

-

+

EC4439

O157:H7

MS, 12/2006

+

-

+

EC4450

O157:H7

NJ, 12/2006

+

-

+

EC1217

O157:H7

2003

+

+

+

EC1577

O157:H7

USA (WA), 1995

+

+

+

EC4201

O157:H7

USA (CA), 2006

+

-

+

EC4207

O157:H7

USA (IL), 2006

+

-

+

EC4208

O157:H7

Spinach, USA (IL), 2006

+

-

+

EC1245

O157:H7

USA (GA), 1995

+

+

+

EC4506

O157:H7

USA (MN), 2006

+

+

+

EC4507

O157:H7

USA (MN), 2006

+

+

+

EC4508

O157:H7

USA (MN), 2006

+

+

+

EC4509

O157:H7

USA (MN), 2006

+

+

+

EC4510

O157:H7

USA (MN), 2006

+

+

+

EC1590

O157:H7

USA (WA)

+

+

+

EC1597

O157:H7

USA (CT), 1996

+

+

+

EC1225

O157:H7

USA (WA), 1993

+

+

+

EC1236

O157:H7

Food, USA (CA), 1993

+

+

+

EC1240

O157:H7

USA (OH), 1993

+

+

+

EC1241

O157:H7

Food, USA (OR), 1995

+

+

+

EC4472

O157:H7

USA, (NJ), 2006

+

-

+

EC1242

O157:H7

USA (GA), 1992

+

-

+

EC1243

O157:H7

USA (GA), 1992

+

+

+

EC4463

O157:H7

USA (NJ), 2006

+

-

+

EC4165

O157:H7

USA (WI), 2006

+

-

+

EC4166

O157:H7

USA (WI), 2006

+

-

+

EC4195

O157:H7

Spinach, USA (OH), 2006

+

-

+

EC4192

O157:H7

USA (CA), 2006

+

-

+

EC4182

O157:H7

USA (IL), 2006

+

-

+

EC4469

O157:H7

USA (NJ), 2006

+

-

+

EC4465

O157:H7

USA (NJ), 2006

+

-

+

EC4170

O157:H7

USA (WI), 2006

+

-

+

EC4183

O157:H7

USA (IL), 2006

+

-

+

EC4186

O157:H7

USA (IL), 2006

+

-

+

Ec4169

O157:H7

USA (WI), 2006

+

-

+

EC4189

O157:H7

USA (CT), 2006

+

-

+

EC4175

O157:H7

USA (IL), 2006

+

-

+

EC4176

O157:H7

USA (IL), 2006

+

-

+

EC4444

O157:H7

USA, NJ, 2006

+

+

+

EC4173

O157:H7

USA (IL), 2006

+

-

+

EC1892

O104:H4

STEC, Republic of Georgia, 2011

-

-

+

EC1893

O104:H4

STEC, Republic of Georgia, 2011

-

-

+

EC1891

O104:H4

STEC, Germany, 2011

-

-

+

EC1894

O104:H4

STEC, Germany, 2011

-

-

+

EC1769

O26

STEC

-

+

-

EC1770

O26

STEC

-

+

+

EC1771

O26

STEC

-

+

-

EC1773

O26:H11

STEC

-

+

-

EC1775

O26:H11

STEC

-

+

-

EC1768

O26:H2

STEC

-

+

-

EC1786

O111:NM

STEC

-

+

+

EC1787

O111:H8

STEC

-

+

+

EC1788

O111:NM

STEC

-

+

-

EC1791

O145:H25

STEC

-

-

+

EC1794

O145:NM

STEC

-

+

+

EC1801

O103:H2

STEC

-

+

-

EC1802

O103:H25

STEC

-

+

-

EC1803

O103:H11

STEC

-

+

+

EC1806

O121:H19

STEC

-

-

+

EC1807

O121:H19

STEC

-

-

+

EC1808

O121:H19

STEC

-

+

+

EC331

O26

STEC

-

+

+

EC400

O26:H11

STEC

-

+

+

EC521

O26:H11

STEC

-

+

+

EC540

O26:H-

STEC

-

+

+

EC550

O26:H-

STEC

-

+

+

EC1232

O55:H7

STEC

-

+

+

EC1235

O55:H7

STEC

-

+

+

EC1668

O111:H8

STEC

-

+

-

EC1669

O118:H16

STEC

-

-

+

EC1631

O111:H8

STEC

-

+

-

EC1655

O111:H8

STEC

-

+

-

K12

 

Negative E. coli strain control

-

-

-

NTC

  

-

-

-

Table 2

Detection results of the exclusivity test with different bacterial strains by the multiplex real-time PCR assay

    

Target gene

Genus

Species

Pathotype

Strain name/Serotype

Z3276

stx1

stx2

Escherichia

coli

EHEC

EDL933/O157:H7

+

+

+

Escherichia

coli

ETEC

EC1775/O26:H11

_

+

_

Escherichia

coli

STEC

EC1803/O103:H11

_

+

+

Escherichia

coli

STEC

EC1807/O121:H19

_

_

+

Escherichia

coli

ETEC

EC1801

_

+

_

Escherichia

coli

EPEC

EC1501

_

_

_

Escherichia

coli

EIEC

EC1513

_

_

_

Escherichia

coli

EDC

DEC5A

_

_

_

Escherichia

coli

 

K12/MG1655

_

_

_

    

_

_

_

Salmonella

enterica

 

SL192/Typhi

_

_

_

Salmonella

enterica

 

SL317/Newport

_

_

_

Salmonella

enterica

 

SL535/Typhimurim

_

_

_

    

_

_

_

Shigella

sonnei

 

SH20145

_

_

_

Shigella

dysenteriae

 

SH20152

_

_

_

Shigella

flexneri

 

SH20155

_

_

_

Shigella

boydii

 

SH20140

_

_

_

    

_

_

_

Staphylococcus

aureus

 

ATCC25923

_

_

_

Staphylococcus

epidermidis

 

ATCC12228

_

_

_

Staphylococcus

pyogenes

 

ATCC19615

_

_

_

    

_

_

_

Vibrio

alginolytica

 

ATCC17749

_

_

_

Vibrio

parahemolyticus

 

ATCC17802

_

_

_

Vibrio

vulasfians

 

ATCC27562

_

_

_

    

_

_

_

Enterobacter

cloacae

 

ATTCC23355

_

_

_

Enterobacter

cloacae

 

ATCC13047

_

_

_

Enterobacter

cloacae

 

ATCC13048

_

_

_

    

_

_

_

Citrobacter

freundii

 

ATCC8090

_

_

_

    

_

_

_

Klebsiella

pneumoniae

 

ATCC13883

_

_

_

    

_

_

_

Pseudomonas

aeruginosa

 

ATCC27853

_

_

_

Bacterial DNA preparation

Bacteria were grown at 37 °C in Luria-Bertani (LB) broth with agitation at 180 rpm, or on LB agar placed in a gravity convection incubator. Bacterial growth was measured by monitoring the turbidity at 600 nm (OD600) using a DU530 spectrophotometer (Beckman, CA). To enumerate bacterial cells, cultures were diluted serially in 10-fold increments with medium and plated on LB agar plates at 37 °C overnight. DNA preparation from bacterial cultures was made with a Puregene cell and tissue kit (Gentra, Minneapolis, MN) as described previously [23]. Briefly, cell pellets from 1 ml of overnight culture were suspended in 3 ml of cell lysis solution and heated to 80 °C for 5 min, followed by addition of 15 μl of RNase A and incubation at 37 °C for 60 min. To remove protein and cell debris, the cell lysate was further mixed with 1 ml of protein precipitation solution, vortexed and centrifuged at 3000 × g. DNA in the supernatant was precipitated by the addition of 2-propanol, centrifuged as above, washed with 70% ethanol, and dissolved in 500 μl of rehydration solution. The concentration of DNA extraction was determined by measuring the optical density (OD260) using a NanoDrop spectrophotometer (NanoDrop Technology, Wilmington, DE)

Primers and probes for the multiplex real-time PCR assay

All the primers, probes, and sequence information are listed in Table 3. The primers and labeled TaqMan probes in this study were designed using Primer Express 3.0 software (Life Technology, Foster City, CA) and synthesized by Life Technology. The primers and probe for E. coli O157:H7 specific gene open reading frame (ORF) ORFZ3276 were described previously [23], the primers and probes for stx1, and stx2 were designed in this study, and the primers and probe for internal amplification control (IAC) were selected based on the DNA sequence of plasmid pUC19 as previously reported [42]. The IAC was incorporated into the multiplex real-time PCR assay to ensure the amplification is free of inhibitory factors from examined food samples.
Table 3

Primers and probes used in the multiplex real-time PCR assay

Target gene

Primer/Probe

Sequence (5' -- 3')

Amplicon

Reference

length (bp)

 

Z3276

Z3276 forward

TATTCCGCGATGCTTGTTTTT

130

Li and Chen. 2012

Z3276 reverse

ATTATCTCACCAGCAAACTGGCGG

Z3276 probe

FAM-CCCGCAAATCTTTCCMGBNFQ

stx1

stx1 forward

GGATTTCGTACAACACTGGATGAT

67

This study

stx1 reverse

ATCCACATCTTCAGCAGTCATTACA

stx1 probe

TAMRA-CAGTGGGCGTTCTTMGBNFQ

stx2

stx2 forward

GGGCAGTTATTTTGCTGTGGAT

59

This study

stx2 reverse

GGTCAAAACGCGCCTGAT

stx2 probe

JOE-ACGAGGGCTTGATGTCMGBNFQ

IAC

IAC forward

CAGGATTAGCAGAGCGAGGTATG

65

Fricker et al. 2007

IAC reverse

CGTAGTTAGGCCACCACTTCAAG

IAC probe

CY5-AGGCGGTGCTACAGAG-MGBNFQ

Development of the multiplex real-time PCR assay

The multiplex real-time PCR assay was developed using the Life Technology ABI 7500 System platform and the standard chemistry. The concentrations of primers and probes for each target gene were adjusted to achieve optimal amplification condition. The reaction mixture contains 12.5 μl of 2 × Universal Master Mix (Life Technology), 200 nM forward and reverse primers, appropriate concentrations of four probes [(Z3276 (80 nM), stx1 (80 nM), stx2 (20 nM), and IAC (40 nM)] and 2 μl of template DNA. Water was added to make a final reaction volume of 25 μl. The amplification conditions for the multiplex assay were set as follows: activation of TaqMan at 95 °C for 10 min, then 40 cycles of denaturation at 95 °C for 10 s and annealing/extension at 60 °C for 60 s.

To compare the efficiency of the multiplex assay with simplex assay, each of the target genes Z3276, stx1, and stx2 was amplified by three individual simplex assays. For the simplex assays, three individual reaction mixtures each contains 12.5 μl of 2 × Universal Master Mix (Life Technology), corresponding forward and reverse primers (200 nM) and probe (100 nM). An equal amount of template DNA (2 μl) was used for the simplex assays, and water was added to make a final reaction volume of 25 μl. The amplification conditions for simplex assays were the same as the multiplex assay.

Sensitivity test and the limit of detection (LOD) of the multiplex qPCR assay

To determine the sensitivity of the multiplex real-time PCR, standard curves of Z3276, stx1, and stx2 in the multiplex real-time PCR were generated. A serial 10-fold dilution from 10 ng to 10 fg/μl of genomic DNA of E. coli O157:H7 strain (EDL933) was prepared and 2.0 μl of each dilution was used as template for PCR amplification. The real-time PCR assay was performed using the conditions described as above. The amplification efficiency of the assay was determined using the formula E = (10-1/slope-1)*100 [43, 44].

Inclusivity and exclusivity tests

The inclusivity test for the multiplex real-time PCR was performed with the optimized concentrations for probes Z3276, stx1 and stx2 on the genomic DNA of E. coli O157:H7 strains (n = 135) and non-O157 STEC strains (n = 21) (Table 1). The exclusivity test was performed on various pathogenic strains including strains of EIEC, EPEC, Shigella, and Salmonella (n = 27) (Table 2). DNA samples were diluted with nuclease-free water to concentration of 50 pg/μl and 2 μl of DNA dilute was used for amplification of target genes. Furthermore, 2 μl of nuclease free water was used to substitute DNA in no template control in the triplex real-time PCR.

Application of the multiplex real-time PCR assay to detect E. coli O157:H7 from spiked spinach and beef

Fresh spinach and beef were purchased from a local retail source and used as food matrices to assess the multiplex real-time PCR assay. These samples were first confirmed to be free of E. coli O157:H7 and non-O157 STEC by standard FDA BAM method [45], and subsequently used for the spiking experiments. One for beef (set 1) spinach spiking (set 2). Each set contained six replicates (25 g of beef or spinach), and were inoculated with 80 and 800 CFU/g O157:H7 (EDL933) cells, respectively. Each sample was mixed with 225 ml of LB medium and homogenized for 2 min using a stomacher (Seward, England). The samples were incubated at 37 °C with shaking at 180 rpm for 24 h.

Two ml of the enriched culture was sampled at 0, 4, 8, 12 and 24 h. At these times, the samples were centrifuged at 600 × g for 1 min to remove fat tissues (for beef) or leaf (for spinach) from the samples. The supernatants were transferred to 2-ml microtubes and centrifuged again at 3000 × g for 5 min to collect bacterial cells. The cell pellets were used for DNA extraction with PreMan Ultra Sample Preparation Reagent (Life Technologies), following the instruction of the manufacturer. Two μl of the DNA extraction was used in the multiplex real-time PCR, and roughly 200 copies of plasmid pUC19 DNA (Promega, Madison, MI) was added as template for IAC.

Results

Designation and optimization of multiplex real-time PCR

Z3276 is a unique target gene that was used as the basis for a multiplex real-time PCR assay for the detection of E. coli O157:H7. In addition to the Z3276 marker, three additional targets stx1, stx2, and IAC, were optimized for amplification and detection (data not shown). In order to minimize the interference among probes during the amplification process, the concentration of each probe was titrated and tested with a fixed amount of DNA (1 ng/reaction). The optimal concentrations for probes Z3276, stx1, stx2, IAC were determined as 80 nM, 80 nM, 20 nM, and 40 nM, respectively.

We further assessed whether the sensitivity of the probes was affected in the multiplex real-time PCR by comparing with those from the corresponding simplex assays. The C T values for the target genes Z3276, stx1, and stx2 were determined to be 23.86, 22.23, and 21.22, respectively in the multiplex real-time PCR (Fig. 1a), whereas the C T values for Z3276, stx1, and stx2 were 21.62, 21.38, and 20.63, respectively in simplex real-time PCR (Fig. 1b). These results demonstrated that at a specified amount of target DNA, the sensitivity of the multiplex PCR assay is comparable with that of each respective simplex assay.
Fig. 1

Comparison of the sensitivity of simultaneously detecting the targeting genes Z3276, stx1, and stx2 in E. coli O157:H7 by the multiplex real-time PCR assay. The standard curves of Z3276, stx1, and stx2 created by the multiplex real-time PCR assay (a); the standard curves of Z3276, stx1, and stx2 generated by three individual simplex real-time PCR assays (b). The C T values represent the average of six replicates from two independent tests ±SD

Comparison of sensitivity and specificity of the multiplex and simplex real-time PCR assays

Using a serial 10-fold dilution of genomic DNA from E. coli O157:H7 (EDL933) as template, the limit of detection (LOD) in the multiplex real-time PCR was determined to be 200 fg of DNA per reaction with average C T values of 38.63, 36.21, and 34.04 for Z3276, stx1, and stx2, respectively. The value of 200 fg of DNA per reaction is equivalent to 40 CFU of DNA. Three standard curves with slopes of -3.60, -3.49, and -3.36, for the target genes Z3276, for stx1, and stx2, respectively, were generated and the amplification efficiencies for the three target genes differed slightly ranging from 90% - 98% (Fig. 1). These data indicated the sensitivity of the multiplex real-time PCR was robust and reliable.

Inclusivity and exclusivity of the multiplex real-time PCR

The multiplex real-time PCR positively identified all the E. coli O157:H7 strains (n = 135) (Table 1). This collection of 135 positively identified E. coli O157:H7 strains included the 21 strains that were not amplified in a real-time PCR assay targeting the uidA gene [23]. The Shiga toxin profiles (stx1 and stx2) of these strains were also found to be perfectly matched with those previously determined by conventional PCR and uidA-based real-time PCR methods. No cross-reaction was observed from the E. coli O157:H7 specific probe Z3276 on all the non-O157 STEC strains, Salmonella strains, Shigella strains, and other pathogenic strains; while the stx probes positively identified the non-O157 STEC strains with presence of either stx1 or stx2, or both (Table 1).

Detection of E. coli O157:H7 from spiked food matrices by the multiplex real-time PCR assay

Beef and spinach samples were initially inoculated with 80 CFU/g E. coli O157:H7 cells. At 0 h, none of the three detection target genes (Z3276, stx1, and stx2) were detected by multiplex real-time PCR assay, but the IAC was positive. However, after 4-h enrichment, all the three detection target genes (Z3276, stx1, and stx2) from both food matrices were amplified in the multiplex real-time PCR assay (Table 4).
Table 4

Detection results of the multiplex real-time PCR on the spiked food samples that inoculated with different concentations of E. coli O157:H7 and enriched with different incubation time

Target gene

Food matrice

Incubation time (h)

 

CFU/gram

0

4

 

8

 

12

 

24

 
 

Beef

 

CT a

±SD

CT

±SD

CT

±SD

CT

±SD

Z3276

80

UDb

34.50

0.29

28.43

0.07

27.98

0.10

27.98

0.10

800

UD

30.51

0.38

24.54

0.10

24.00

0.04

24.00

0.04

stx1

80

UD

27.54

0.19

21.73

0.22

20.84

0.25

19.06

0.36

800

UD

24.45

0.22

18.51

0.14

17.46

0.03

18.48

0.02

stx2

80

UD

31.34

0.10

25.47

0.02

25.03

0.04

23.63

0.02

800

UD

27.93

0.34

21.68

0.03

21.33

0.06

22.52

0.05

IAC

200 copiesc

28.88

27.72

 

21.96

 

21.09

 

19.59

 

Spinach

 

CT

±SD

CT

±SD

CT

±SD

CT

±SD

Z3276

80

UD

33.92

0.04

24.32

0.26

22.86

0.15

24.26

0.09

800

UD

30.91

0.05

23.04

0.11

23.08

0.08

23.12

0.07

stx1

80

UD

27.63

0.16

17.32

0.15

15.74

0.13

16.87

0.11

800

UD

25.04

0.06

16.57

0.12

16.25

0.15

16.37

0.10

stx2

80

UD

30.88

0.06

21.21

0.07

20.10

0.06

21.64

0.07

800

UD

28.19

0.14

20.05

0.15

20.58

0.05

20.74

0.04

IAC

200 copies

24.94

23.82

 

24.77

 

23.83

 

23.69

 

aData were shown as average of two independent experiment

bUD refers to "Underdetermined", a negative detection result

cAbout 200 copies of pUC19 plasmid DNA was added as template for IAC to each multiplex real-time PCR reaction

Discussion

PCR technology is widely used for pathogen detection from clinical, food, and environment samples. Real-time PCR methods are used for their enhanced sensitivity and specificity. Several PCR-based methods are available for the detection of E. coli O157:H7 and non-O157 STEC (4, 7, 9, 10) by amplifying various target genes [23]. Target genes such as stx [9, 1220], eae [31, 32], fimA [33], rfbE [34] have been used in various assays for detection of for E. coli O157:H7, however, most of those genes are not unique genetic markers for this pathogen [23]. This inadequate discriminatory power of those target genes calls for selection of more genetic markers for E. coli O157:H7. Consequently, we identified Z3276 as a unique genetic marker for detection of E. coli O157:H7 [23, 36], and confirmed by other scientific groups [37, 46].

Selection of Z3276 as a unique genetic marker for detection of E. coli O157:H7 was the basis for the development of a multiplex PCR assay. Simultaneous detection of multiple genes in a single reaction may increase specificity and reliability for the detection of E. coli O157:H7, since the amplification of different target genes can corroborate the final conclusion. More importantly, the inclusion of the Shiga toxin genes enables the assay to detect not only E. coli O157:H7, but also screen for non-O157 STEC strains, the latter often underestimated [4753].

Multiplex real-time PCR can provide better detection efficiency. However, interference among probes and competition among primers for supplies during amplification may compromise the sensitivity and increase the background. Therefore, it is necessary to fine tune the parameters of the multiplex reaction to achieve the optimal conditions for each target gene. In this study, by optimizing the concentration of each probe in the assay (Z3276, stx1, and stx2), we were able to achieve robust sensitivity in the multiplex assay, and positively identified all the E. coli O157:H7 strains (n = 135), demonstrating the multiplex assay is compatible to the simplex assays.

Nowadays, WGS has been explored for a more efficient and more comprehensive approach for STEC detection. Although WGS potential with STEC characterization and surveillance is apparent, STEC detection will likely continue to rely on a combination of culture and non-culture methods, the latter including real-time PCR [49]. The multiplex real-time PCR developed in this study not only can detect E. coli O157:H7 and its profile of the Shiga toxin genes, but also detect non-O157 STEC strains. The capability for simultaneous detection of the Shiga toxin genes and the differentiation of E. coli O157:H7 from non-O157 STEC strains offers several advantages: i) determination of the presence or absence of Shiga toxin genes can be used to verify the detection results of E. coli O157:H7, because almost all E. coli O157:H7 strains possess stx1 and/or stx2 gene(s); ii) profile of the Shiga toxin genes of E. coli O157:H7 provides genetic markers for differentiating isolates from outbreaks; iii) differentiation of stx1 and stx2 harboring E. coli O157:H7 strains may help health care providers manage HUS patients caused by E. coli O157:H7 [49]; and iv) identification of stx gene harboring isolates can serve as a useful clue for detection of STEC, and then more comprehensive and sophistical analytical analyses, such as cultural biological tests, toxin detection, serotyping, genotyping, and WGS, can be performed to confirm the final detection result.

Multiplex real-time PCR targeting uidA, stx1, and stx2 genes for detection of E. coli O157:H7 and non-O157 STECs has become a routine test for preliminary screening in clinical laboratories as the Centers for Disease Control and Prevention recommended [54]. Although WGS is not yet a routine testing, future prediction would include this technology as a means to track the mobility of pathogenic microbes as the food market has become global. The multiplex real-time PCR developed in this study has been demonstrated to be a reliable, efficient, and sensitive assay, and may serve as a useful method for the detection of E. coli O157:H7 and non-O157 STEC in epidemiological surveillance programs as well as in food analytical laboratories. The multiplex real-time PCR assay was successfully tested in this study for the detection of E. coli O157:H7 from spiked food matrices, i.e., beef and spinach, and more than likely applicable to other food matrices.

It is worth noting that on the one hand, in the development of the multiplex real-time PCR assay, great efforts were made toward getting high sensitivity and specificity by optimizing the amplification conditions and by minimizing the interferences among probes, primers, and target genes to reduce the false negative rate in detection; on the other hand, in the use of the assay, precaution is needed in interpretation of the positive results from certain strains that free phages might harbor stx gene [5557] or even some Shigella strains acquired stx genes [5861].

Conclusions

A multiplex real-time PCR assay that can rapidly and simultaneously detect E. coli O157:H7 and screen for non-O157 STEC strains has been developed and assessed for efficacy. The inclusivity and exclusivity tests demonstrated high sensitivity and specificity of the multiplex real-time PCR assay. In addition, this multiplex assay was shown to be effective for the detection of E. coli O157:H7 from two common food matrices, beef and spinach, and may be applied for detection of E. coli O157:H7 and screening for non-O157 STEC strains from other food matrices as well.

Abbreviations

HUS: 

hemolytic-uremic syndrome

IAC: 

internal amplification control

ORF: 

open reading frame

STEC: 

Shiga toxin-producing Escherichia coli

Declarations

Acknowledgments

WW was supported by a fellowship appointment administered by Oak Ridge Institute for Science and Education.

Funding

This research project including the design of the study, collection, analysis, and interpretation of data, and writing the manuscript was all funded by the U.S. Food and Drug Administration.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors’ contributions

BL conceived the project. BL and HL designed the study. BL, HL, and WW performed the experiments and analyzed the results. BL and HL wrote the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent for participation

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Division of Molecular Biology, Center for Food Safety and Applied Nutrition, Food and Drug Administration
(2)
Branch of Microbiology, Office of Regulatory Affairs, Food and Drug Administration

References

  1. Parsons BD, Zelyas N, Berenger BM, Chui L. Detection, Characterization, and Typing of Shiga Toxin-Producing Escherichia coli. Frontiers in Microbiology. 2016;7(478)Google Scholar
  2. Scallan E, Griffin PM, Angulo FJ, Tauxe RV, Hoekstra RM. Foodborne illness acquired in the United States--unspecified agents. Emerg Infect Dis. 2011;17(1):16–22.View ArticlePubMedPubMed CentralGoogle Scholar
  3. Schimmer B, Nygard K, Eriksen HM, Lassen J, Lindstedt BA, Brandal LT, Kapperud G, Aavitsland P. Outbreak of haemolytic uraemic syndrome in Norway caused by stx2-positive Escherichia coli O103:H25 traced to cured mutton sausages. BMC Infect Dis. 2008;8:41.View ArticlePubMedPubMed CentralGoogle Scholar
  4. Lee JE, Reed J, Shields MS, Spiegel KM, Farrell LD, Sheridan PP. Phylogenetic analysis of Shiga toxin 1 and Shiga toxin 2 genes associated with disease outbreaks. BMC Microbiol. 2007;7:109.View ArticlePubMedPubMed CentralGoogle Scholar
  5. Paton JC, Paton AW. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clin Microbiol Rev. 1998;11(3):450–79.PubMedPubMed CentralGoogle Scholar
  6. Riley LW, Remis RS, Helgerson SD, McGee HB, Wells JG, Davis BR, Hebert RJ, Olcott ES, Johnson LM, Hargrett NT, et al. Hemorrhagic colitis associated with a rare Escherichia coli serotype. N Engl J Med. 1983;308(12):681–5.View ArticlePubMedGoogle Scholar
  7. Mead PS, Slutsker L, Dietz V, McCaig LF, Bresee JS, Shapiro C, Griffin PM, Tauxe RV. Food-related illness and death in the United States. Emerg Infect Dis. 1999;5(5):607–25.View ArticlePubMedPubMed CentralGoogle Scholar
  8. Heiman KE, Mody RK, Johnson SD, Griffin PM, Gould LH. Escherichia coli O157 Outbreaks in the United States, 2003-2012. Emerg Infect Dis. 2015;21(8):1293–301.View ArticlePubMedPubMed CentralGoogle Scholar
  9. Deisingh AK, Thompson M. Strategies for the detection of Escherichia coli O157:H7 in foods. J Appl Microbiol. 2004;96(3):419–29.View ArticlePubMedGoogle Scholar
  10. DeGrandis S, Law H, Brunton J, Gyles C, Lingwood CA. Globotetraosylceramide is recognized by the pig edema disease toxin. J Biol Chem. 1989;264(21):12520–5.PubMedGoogle Scholar
  11. Jinneman KC, Yoshitomi KJ, Weagant SD. Multiplex real-time PCR method to identify Shiga toxin genes stx1 and stx2 and Escherichia coli O157:H7/H- serotype. Appl Environ Microbiol. 2003;69(10):6327–33.View ArticlePubMedPubMed CentralGoogle Scholar
  12. Gannon VP, King RK, Kim JY, Thomas EJ. Rapid and sensitive method for detection of Shiga-like toxin-producing Escherichia coli in ground beef using the polymerase chain reaction. Appl Environ Microbiol. 1992;58(12):3809–15.PubMedPubMed CentralGoogle Scholar
  13. Lefterova MI, Slater KA, Budvytiene I, Dadone PA, Banaei N. A sensitive multiplex, real-time PCR assay for prospective detection of Shiga toxin-producing Escherichia coli from stool samples reveals similar incidences but variable severities of non-O157 and O157 infections in northern California. J Clin Microbiol. 2013;51(9):3000–5.View ArticlePubMedPubMed CentralGoogle Scholar
  14. Hara-Kudo Y, Konishi N, Ohtsuka K, Iwabuchi K, Kikuchi R, Isobe J, Yamazaki T, Suzuki F, Nagai Y, Yamada H, et al. An interlaboratory study on efficient detection of Shiga toxin-producing Escherichia coli O26, O103, O111, O121, O145, and O157 in food using real-time PCR assay and chromogenic agar. International Journal of Food Microbiology. 2016;230:81–8.View ArticlePubMedGoogle Scholar
  15. Verhaegen B, Van Damme I, Heyndrickx M, Botteldoorn N, Elhadidy M, Verstraete K, Dierick K, Denayer S, De Zutter L, De Reu K. Evaluation of detection methods for non-O157 Shiga toxin-producing Escherichia coli from food. International Journal of Food Microbiology. 2016;219:64–70.View ArticlePubMedGoogle Scholar
  16. Brusa V, Galli L, Linares LH, Ortega EE, Lirón JP, Leotta GA. Development and validation of two SYBR green PCR assays and a multiplex real-time PCR for the detection of Shiga toxin-producing Escherichia coli in meat. Journal of Microbiological Methods. 2015;119:10–7.View ArticlePubMedGoogle Scholar
  17. Harada T, Iguchi A, Iyoda S, Seto K, Taguchi M, Kumeda Y. Multiplex Real-Time PCR Assays for Screening of Shiga Toxin 1 and 2 Genes, Including All Known Subtypes, and Escherichia coli O26-, O111-, and O157-Specific Genes in Beef and Sprout Enrichment Cultures. J Food Prot. 2015;78(10):1800–11.View ArticlePubMedGoogle Scholar
  18. Tunsjø HS, Kvissel AK, Follin-Arbelet B, Brotnov BM, Ranheim TE, Leegaard TM. Suitability of stx-PCR directly from fecal samples in clinical diagnostics of STEC. APMIS. 2015;123(10):872–8.View ArticlePubMedGoogle Scholar
  19. de Boer RF, Ferdous M, Ott A, Scheper HR, Wisselink GJ, Heck ME, Rossen JW, Kooistra-Smid AM. Assessing the public health risk of Shiga toxin-producing Escherichia coli by use of a rapid diagnostic screening algorithm. J Clin Microbiol. 2015;53(5):1588–98.View ArticlePubMedPubMed CentralGoogle Scholar
  20. Baliere C, Rince A, Thevenot D, Gourmelon M. Successful detection of pathogenic Shiga-toxin-producing Escherichia coli in shellfish, environmental waters and sediment using the ISO/TS-13136 method. Lett Appl Microbiol. 2015;60(4):315–20.View ArticlePubMedGoogle Scholar
  21. Frank C, Werber D, Cramer JP, Askar M, Faber M, an der Heiden M, Bernard H, Fruth A, Prager R, Spode A et al: Epidemic Profile of Shiga-Toxin–Producing Escherichia coli O104:H4 Outbreak in Germany. New England Journal of Medicine 2011, 365(19):1771-1780.Google Scholar
  22. March SB, Ratnam S. Sorbitol-MacConkey medium for detection of Escherichia coli O157:H7 associated with hemorrhagic colitis. J Clin Microbiol. 1986;23(5):869–72.PubMedPubMed CentralGoogle Scholar
  23. Li B, Chen JQ. Real-time PCR methodology for selective detection of viable Escherichia coli O157:H7 cells by targeting Z3276 as a genetic marker. Appl Environ Microbiol. 2012;78(15):5297–304.View ArticlePubMedPubMed CentralGoogle Scholar
  24. Cebula TA, Payne WL, Feng P. Simultaneous identification of strains of Escherichia coli serotype O157:H7 and their Shiga-like toxin type by mismatch amplification mutation assay-multiplex PCR. J Clin Microbiol. 1995;33(1):248–50.PubMedPubMed CentralGoogle Scholar
  25. Fratamico PM, DebRoy C, Liu Y, Needleman DS, Baranzoni GM, Feng P. Advances in Molecular Serotyping and Subtyping of Escherichia coli †. Frontiers in Microbiology. 2016;7(644)Google Scholar
  26. Jackson SA, Kotewicz ML, Patel IR, Lacher DW, Gangiredla J, Elkins CA. Rapid genomic-scale analysis of Escherichia coli O104:H4 by using high-resolution alternative methods to next-generation sequencing. Appl Environ Microbiol. 2012;78(5):1601–5.View ArticlePubMedPubMed CentralGoogle Scholar
  27. Patel IR, Gangiredla J, Lacher DW, Mammel MK, Jackson SA, Lampel KA, Elkins CA. FDA Escherichia coli Identification (FDA-ECID) Microarray: a Pangenome Molecular Toolbox for Serotyping, Virulence Profiling, Molecular Epidemiology, and Phylogeny. Appl Environ Microbiol. 2016;82(11):3384–94.View ArticlePubMedPubMed CentralGoogle Scholar
  28. Lindsey RL, Pouseele H, Chen JC, Strockbine NA, Carleton HA. Implementation of Whole Genome Sequencing (WGS) for Identification and Characterization of Shiga Toxin-Producing Escherichia coli (STEC) in the United States. Frontiers in Microbiology. 2016;7(766)Google Scholar
  29. Leonard SR, Mammel MK, Lacher DW, Elkins CA. Strain-Level Discrimination of Shiga Toxin-Producing Escherichia coli in Spinach Using Metagenomic Sequencing. PLoS One. 2016;11(12):e0167870.View ArticlePubMedPubMed CentralGoogle Scholar
  30. Elizaquivel P, Aznar R. A multiplex RTi-PCR reaction for simultaneous detection of Escherichia coli O157:H7, Salmonella spp. and Staphylococcus aureus on fresh, minimally processed vegetables. Food Microbiol. 2008;25(5):705–13.View ArticlePubMedGoogle Scholar
  31. Barletta F, Ochoa TJ, Ecker L, Gil AI, Lanata CF, Cleary TG. Validation of five-colony pool analysis using multiplex real-time PCR for detection of diarrheagenic Escherichia coli. J Clin Microbiol. 2009;47(6):1915–7.View ArticlePubMedPubMed CentralGoogle Scholar
  32. Schmidt H, Plaschke B, Franke S, Russmann H, Schwarzkopf A, Heesemann J, Karch H. Differentiation in virulence patterns of Escherichia coli possessing eae genes. Med Microbiol Immunol. 1994;183(1):23–31.View ArticlePubMedGoogle Scholar
  33. Li B, Koch WH, Cebula TA. Detection and characterization of the fimA gene of Escherichia coli O157:H7. Mol Cell Probes. 1997;11(6):397–406.View ArticlePubMedGoogle Scholar
  34. Desmarchelier PM, Bilge SS, Fegan N, Mills L, Vary JC, Jr., Tarr PI: A PCR specific for Escherichia coli O157 based on the rfb locus encoding O157 lipopolysaccharide. J Clin Microbiol 1998, 36(6):1801-1804.Google Scholar
  35. Fields PI, Blom K, Hughes HJ, Helsel LO, Feng P, Swaminathan B. Molecular characterization of the gene encoding H antigen in Escherichia coli and development of a PCR-restriction fragment length polymorphism test for identification of E. coli O157:H7 and O157:NM. J Clin Microbiol. 1997;35(5):1066–70.PubMedPubMed CentralGoogle Scholar
  36. Li B, Hu Z, Elkins CA. Detection of live Escherichia coli O157:H7 cells by PMA-qPCR. J Vis Exp. 2014;84:e50967.Google Scholar
  37. Ravan H, Amandadi M, Sanadgol N. A highly specific and sensitive loop-mediated isothermal amplification method for the detection of Escherichia coli O157:H7. Microb Pathog. 2016;91:161–5.View ArticlePubMedGoogle Scholar
  38. Feng P, Lampel KA. Genetic analysis of uidA expression in enterohaemorrhagic Escherichia coli serotype O157:H7. Microbiology. 1994;140(Pt 8):2101–7.View ArticlePubMedGoogle Scholar
  39. Monday SR, Whittam TS, Feng PC. Genetic and evolutionary analysis of mutations in the gusA gene that cause the absence of beta-glucuronidase activity in Escherichia coli O157:H7. J Infect Dis. 2001;184(7):918–21.View ArticlePubMedGoogle Scholar
  40. Perna NT, Plunkett G, 3rd, Burland V, Mau B, Glasner JD, Rose DJ, Mayhew GF, Evans PS, Gregor J, Kirkpatrick HA et al: Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 2001, 409(6819):529-533.Google Scholar
  41. Fratamico PM, Wasilenko JL, Garman B, Demarco DR, Varkey S, Jensen M, Rhoden K, Tice G. Evaluation of a multiplex real-time PCR method for detecting shiga toxin-producing Escherichia coli in beef and comparison to the U.S. Department of Agriculture Food Safety and Inspection Service Microbiology laboratory guidebook method. J Food Prot. 2014;77(2):180–8.View ArticlePubMedGoogle Scholar
  42. Fricker M, Messelhausser U, Busch U, Scherer S, Ehling-Schulz M. Diagnostic real-time PCR assays for the detection of emetic Bacillus cereus strains in foods and recent food-borne outbreaks. Appl Environ Microbiol. 2007;73(6):1892–8.View ArticlePubMedPubMed CentralGoogle Scholar
  43. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29(9):e45.View ArticlePubMedPubMed CentralGoogle Scholar
  44. Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002;30(9):e36.View ArticlePubMedPubMed CentralGoogle Scholar
  45. Administration FD. Diarrheagenic Escherichia coli. Bacteriological Analytical Manual. Gaithersburg, MD USA; 2011.Google Scholar
  46. Ravan H, Amandadi M. Analysis of yeh Fimbrial Gene Cluster in Escherichia coli O157:H7 in Order to Find a Genetic Marker for this Serotype. Curr Microbiol. 2015;71(2):274–82.View ArticlePubMedGoogle Scholar
  47. Chui L, Lee M-C, Allen R, Bryks A, Haines L, Boras V. Comparison between ImmunoCard STAT!® and real-time PCR as screening tools for both O157:H7 and non-O157 Shiga toxin-producing Escherichia coli in Southern Alberta, Canada. Diagnostic Microbiology and Infectious Disease. 2013;77(1):8–13.View ArticlePubMedGoogle Scholar
  48. Gould LH, Walsh KA, Vieira AR, Herman K, Williams IT, Hall AJ, Cole D, Centers for Disease C, Prevention: Surveillance for foodborne disease outbreaks - United States, 1998-2008. MMWR Surveill Summ 2013, 62(2):1-34.Google Scholar
  49. Parsons BD, Zelyas N, Berenger BM, Chui L. Detection, Characterization, and Typing of Shiga Toxin-Producing Escherichia coli. Front Microbiol. 2016;7:478.View ArticlePubMedPubMed CentralGoogle Scholar
  50. Fratamico PM, Briggs CE, Needle D, Chen CY, DebRoy C. Sequence of the Escherichia coli O121 O-antigen gene cluster and detection of enterohemorrhagic E. coli O121 by PCR amplification of the wzx and wzy genes. J Clin Microbiol. 2003;41(7):3379–83.View ArticlePubMedPubMed CentralGoogle Scholar
  51. Wickham ME, Lupp C, Mascarenhas M, Vazquez A, Coombes BK, Brown NF, Coburn BA, Deng W, Puente JL, Karmali MA, et al. Bacterial genetic determinants of non-O157 STEC outbreaks and hemolytic-uremic syndrome after infection. J Infect Dis. 2006;194(6):819–27.View ArticlePubMedGoogle Scholar
  52. Kuehne A, Bouwknegt M, Havelaar A, Gilsdorf A, Hoyer P, Stark K, Werber D, and the HUSasnG: Estimating true incidence of O157 and non-O157 Shiga toxin-producing Escherichia coli illness in Germany based on notification data of haemolytic uraemic syndrome. Epidemiol Infect 2016, 144(15):3305-3315.Google Scholar
  53. Mora A, Blanco M, Blanco JE, Dahbi G, Lopez C, Justel P, Alonso MP, Echeita A, Bernardez MI, Gonzalez EA, et al. Serotypes, virulence genes and intimin types of Shiga toxin (verocytotoxin)-producing Escherichia coli isolates from minced beef in Lugo (Spain) from 1995 through 2003. BMC Microbiol. 2007;7:13.View ArticlePubMedPubMed CentralGoogle Scholar
  54. Gould MS, Marrocco FA, Hoagwood K, Kleinman M, Amakawa L, Altschuler E. Service use by at-risk youths after school-based suicide screening. J Am Acad Child Adolesc Psychiatry. 2009;48(12):1193–201.View ArticlePubMedGoogle Scholar
  55. Monday SR, Beisaw A, Feng PC. Identification of Shiga toxigenic Escherichia coli seropathotypes A and B by multiplex PCR. Mol Cell Probes. 2007;21(4):308–11.View ArticlePubMedGoogle Scholar
  56. Martinez-Castillo A, Muniesa M. Implications of free Shiga toxin-converting bacteriophages occurring outside bacteria for the evolution and the detection of Shiga toxin-producing Escherichia coli. Front Cell Infect Microbiol. 2014;4:46.PubMedPubMed CentralGoogle Scholar
  57. Grys TE, Sloan LM, Rosenblatt JE, Patel R. Rapid and sensitive detection of Shiga toxin-producing Escherichia coli from nonenriched stool specimens by real-time PCR in comparison to enzyme immunoassay and culture. J Clin Microbiol. 2009;47(7):2008–12.View ArticlePubMedPubMed CentralGoogle Scholar
  58. Strauch E, Lurz R, Beutin L. Characterization of a Shiga toxin-encoding temperate bacteriophage of Shigella sonnei. Infect Immun. 2001;69(12):7588–95.View ArticlePubMedPubMed CentralGoogle Scholar
  59. Gray MD, Lampel KA, Strockbine NA, Fernandez RE, Melton-Celsa AR, Maurelli AT. Clinical isolates of Shiga toxin 1a-producing Shigella flexneri with an epidemiological link to recent travel to Hispaniola. Emerg Infect Dis. 2014;20(10):1669–77.View ArticlePubMedPubMed CentralGoogle Scholar
  60. Carter CC, Fierer J, Chiu WW, Looney DJ, Strain M, Mehta SR: A Novel Shiga Toxin 1a-Converting Bacteriophage of Shigella sonnei With Close Relationship to Shiga Toxin 2-Converting Pages of Escherichia coli. Open Forum Infect Dis 2016, 3(2):ofw079.Google Scholar
  61. Kozyreva VK, Jospin G, Greninger AL, Watt JP, Eisen JA, Chaturvedi V. Recent Outbreaks of Shigellosis in California Caused by Two Distinct Populations of Shigella sonnei with either Increased Virulence or Fluoroquinolone Resistance. mSphere. 2016;1(6)Google Scholar

Copyright

© The Author(s). 2017

Advertisement