Skip to main content

Advertisement

Table 3 Primers and probes used in the multiplex real-time PCR assay

From: Multiplex real-time PCR assay for detection of Escherichia coli O157:H7 and screening for non-O157 Shiga toxin-producing E. coli

Target gene Primer/Probe Sequence (5' -- 3') Amplicon Reference
length (bp)  
Z3276 Z3276 forward TATTCCGCGATGCTTGTTTTT 130 Li and Chen. 2012
Z3276 reverse ATTATCTCACCAGCAAACTGGCGG
Z3276 probe FAM-CCCGCAAATCTTTCCMGBNFQ
stx1 stx1 forward GGATTTCGTACAACACTGGATGAT 67 This study
stx1 reverse ATCCACATCTTCAGCAGTCATTACA
stx1 probe TAMRA-CAGTGGGCGTTCTTMGBNFQ
stx2 stx2 forward GGGCAGTTATTTTGCTGTGGAT 59 This study
stx2 reverse GGTCAAAACGCGCCTGAT
stx2 probe JOE-ACGAGGGCTTGATGTCMGBNFQ
IAC IAC forward CAGGATTAGCAGAGCGAGGTATG 65 Fricker et al. 2007
IAC reverse CGTAGTTAGGCCACCACTTCAAG
IAC probe CY5-AGGCGGTGCTACAGAG-MGBNFQ