Skip to content

Advertisement

  • Research article
  • Open Access

Functional analysis of PrkA - a putative serine protein kinase from Mesorhizobium alhagi CCNWXJ12-2 - in stress resistance

BMC MicrobiologyBMC series – open, inclusive and trusted201616:227

https://doi.org/10.1186/s12866-016-0849-6

©  The Author(s). 2016

  • Received: 27 May 2016
  • Accepted: 24 September 2016
  • Published:

Abstract

Background

Serine/threonine protein kinases are highly conserved kinases with a wide distribution in microbes and with multiple functions. Mesorhizobium alhagi CCNWXJ12-2, a α-proteobacterium which could be able to form symbiosis with Alhagi sparsifolia in northwest of China, contains a putative PrkA-family serine protein kinase, PrkA. In our previous study, the expression of prkA was found to be downregulated in high-salt conditions. To elucidate the function of M. alhagi PrkA, a prkA deletion mutant was constructed and the phenotypes of the mutant were analyzed.

Results

The salt and alkaline tolerance and antioxidant capacity of the wild-type strain and the prkA deletion mutant was measured. Our results showed that the deletion mutant had higher salt and alkaline tolerance than the wild-type strain. The total cellular Na+ content was measured and showed no significant difference between the wild-type strain and the mutant. The prkA deletion mutant also showed a higher H2O2 tolerance than the wild-type strain. Therefore the activities of antioxidant enzymes were measured. Catalase activity was similar in the wild-type and the deletion mutant, while the superoxide dismutase activity in the mutant was higher than that in the wild-type.

Conclusions

We firstly analyze the function of a serine protein kinase, PrkA, in M. alhagi. Our data indicate that PrkA could reduce the survival of M. alhagi under environmental stress and deletion of prkA dramatically improved the salt and alkaline tolerance and antioxidant capacity of M. alhagi.

Keywords

  • Serine protein kinase
  • Salt resistance
  • Antioxygenation
  • Na+ concentration measurement

Background

Salinity and desiccation are major problems facing agriculture worldwide [1, 2]. Mesorhizobium alhagi CCNWXJ12-2 is a highly salt-tolerant and alkali-tolerant rhizobium which can form nodules with the desert plant Alhagi sparsifolia [3]. The nitrogen-fixing symbiosis formed between rhizobia and legumes can decrease the damage to plants caused by soil salinity; thus, there are an increasing number of studies on salt-tolerant rhizobia and their mechanism(s) of salt resistance [4, 5]. To determine the mechanism of salt resistance in M. alhagi, a global transcriptome comparison of M. alhagi was conducted in salt-free (no added salt) and high-salt conditions, and a downregulated putative serine kinase gene, prkA, was identified in high-salt [6].

PrkA is a highly conserved serine protein kinase with a wide distribution in bacteria and archaea [7]. The serine/threonine protein kinases play diverse roles in bacterial signal transduction and regulation by phosphorylating multiple substrates [8]. In the model bacterium Escherichia coli, the prkA homolog yeaG was regulated by leucine-responsive regulatory protein and may have a role in metabolic reprogramming to survive acidic and osmotic stress [9]. Recent reports showed that yeaG is also involved in adaptation to nutrient limitation [10, 11]. However, subsequent research showed that a yeaG deletion mutant showed no significant difference in salt tolerance and pH adaptation compared with the wild-type strain [12].

In Mycobacterium tuberculosis, the deletion mutant of pknE (a gene encoding a serine/threonine protein kinase) showed defective growth in conditions of neutral pH and on exposure to lysozyme, but a higher tolerance to acidic stress, sodium dodecyl sulfate (SDS), and kanamycin [13]. Proteomic and phosphoproteomic analysis of the pknE mutant of M. tuberculosis showed that PknE was involved in metabolism, dormancy, and suppression of some sigma factors and other kinases, and thus could play an important role in adaptive responses to hostile environments [14].

In Bacillus subtilis, PrkA was proved to be an inner spore coat protein and involved in spore formation, which is controlled by sigma factors [15, 16]. In Streptococcus mutans, the serine/threonine protein kinase annotated pknB was shown to play a significant role in biofilm formation, genetic competence, and acid resistance [17]. In Rhizobium etli, the expression of prkA was highly dependent on alarmones, guanosine, tetraphosphate, and guanosine pentaphosphate, but the ΔprkA mutant of R. etli showed no clear difference compared with the wild-type under osmotic, oxidative and heat stresses [7].

In this study, we constructed a ΔprkA (the prkA deletion mutant of M. alhagi) mutant and undertook a phenotypical analysis to understand the function of PrkA. Our results showed that the ΔprkA mutant grew better under high-salt (0.4 M NaCl) and alkaline (pH 9) conditions than the wild-type strain, and the survival rate of the mutant under oxidative stress was also higher than that of the wild-type. The total cellular Na+ content in the mutant was almost the same as that in the wild-type in high-salt conditions. Although the catalase (CAT) activity was similar in the wild-type and ΔprkA mutant, the superoxide dismutase (SOD) activity in ΔprkA mutant was higher than that in the wild-type. These results indicate that prkA could reduce the ability of M. alhagi in stress adaptation.

Results and discussions

Increased NaCl and alkali tolerance of mutant ΔprkA

There is only one annotated PrkA family serine protein kinase in the genome of M. alhagi, denoted PrkA [18]. We have previously found that the expression of prkA was downregulated in high-salt conditions through RNA-Seq validated by RT-qPCR [6]. To determine the function of M. alhagi CCNWXJ12-2 prkA, we constructed a deletion mutant and its tolerance to NaCl and alkali were tested.

The mutant ΔprkA had better salt and alkali resistance than the wild-type strain, while the complemented strain CΔprkA had similar salt and alkali resistance to the wild-type strain (Fig. 1). The expression of prkA in the complementation strain was confirmed using reverse transcription PCR (data not shown).
Fig. 1
Fig. 1

Sensitivity of the wild-type and mutant strains to NaCl and alkaline. Wild-type (WT), ΔprkA (prkA deletion mutant), and CΔprkA (complement of ΔprkA) bacterial cells were grown to OD600 ≈ 0.8 in TY broth medium, adjusted to OD600 ≈ 0.2, and then serially diluted and spotted onto TY agar plates containing no additional NaCl or 0.4 M NaCl at neutral pH, and TY agar plates at alkaline pH (pH 9). Ten-fold serial dilutions are shown. The plates with no additional NaCl were incubated at 28 °C for 3 days, while the plates with 0.4 M NaCl and the plates at pH 9 were incubated for 5 days at the same temperature

In Mycobacterium tuberculosis, the pknE deletion mutant showed higher tolerance to acidic stress, SDS, and kanamycin than the wild-type, which means pknE is involved in stress adaptation [13]. Although the protein sequence similarity of Mesorhizobium alhagi PrkA and Mycobacterium tuberculosis PknE is only 12.9 %, the function of pknE in M. tuberculosis was to some degree similar to that of prkA in M. alhagi in stress adaption. However, our results showed that wild-type M. alhagi had the same resistance to antibiotics (kanamycin, gentamicin, ampicillin, tetracycline, streptomycin, and rifampicin; 50 ug/ml for all), SDS (0.01 %), and acid (pH 6) as did the mutant ΔprkA (data not shown).

In E. coli, the deletion mutant of yeaG showed no difference in salt tolerance compared with the wild-type [12], although the similarity in protein sequence between E. coli YeaG and M. alhagi PrkA is relatively high (65.5 %). Despite the similar genomic background of prkA in R. etli and Mesorhizobium alhagi (data not shown) and the high similarity in protein sequences (71.49 %), the prkA deletion mutant of R. etli showed no phenotype changes compared with the wild-type strain [7], in contrast to M. alhagi in the present work.

The functions of these genes in the different bacteria are obviously different. These results show that serine protein kinases can have very different functions in different bacteria.

Measurement of total cellular Na+ content

Bacteria can efflux the extra Na+ from the cells by Na+/H+ antiporters using energy of proton motive force [19]. We have previously found that the expression of a Na+/H+ antiporter gene, nhaA, was upregulated in high-salt conditions [6]. Here we measured the total cellular Na+ content of the wild-type, ΔprkA, and CΔprkA strains in salt-free and high-salt (0.4 M NaCl) conditions to find out whether PrkA influences the total cellular Na+ content. However, our results showed no significant difference among these three strains (p ≥ 0.05) when grown in the same conditions (Fig. 2). The Na+ content of the three strains grown on 0.4 M NaCl TY agar plates was almost 20-fold higher than that in the controls grown on salt-free medium. The similar Na+ content of the three strains implied that prkA does not depress the strain growth in high-salt conditions by adjusting the cellular Na+ content. Therefore, we speculate that the mechanism of PrkA depressing the growth of Mesorhizobium alhagi under salt stress is complex, which involves many components of metabolism.
Fig. 2
Fig. 2

Measurement of total cellular Na+ concentration. Wild-type (WT), ΔprkA (prkA deletion mutant), and CΔprkA (complement of ΔprkA) bacterial cells were grown to OD600 ≈ 0.8 in TY broth medium and then adjusted to OD600 ≈ 0.2. The diluted inocula were plated on TY agar plates with and without 0.4 M NaCl and inoculated at 28 °C for 5 days. Total cellular Na+ concentrations were measured using an atomic absorption spectrophotometer. The results are shown as the means of three biological replicates and the error bars indicate standard deviations. The significance of differences is shown at the P < 0.05 level (t-test). Different lowercase letters mean significant difference between two columns

Increased antioxidative capacity of mutant ΔprkA

Stressful conditions such as heat, acid and high-salt concentrations, can lead to secondary oxidative stress in bacteria [20]. Previous study has shown the intracellular level of reactive oxygen species (ROS) was increased significantly when cells were stressed by high salinity [21, 22]. Because high salinity can trigger a high level of intracellular ROS, we tested the oxidative resistance of the M. alhagi prkA deletion mutant to identify any antioxidant function of PrkA. The survival rates of the wild-type, ΔprkA and CΔprkA strains treated with 10 mM H2O2 for 30 min showed a significant difference (Fig. 3); survival of ΔprkA treated with H2O2 was significantly (p ≤ 0.05) higher than that of the wild-type and complemented strains. These results suggest that PrkA depresses the antioxidative capacity of M. alhagi.
Fig. 3
Fig. 3

Survival rate of M. alhagi after H2O2 treatment. Wild-type (WT), ΔprkA (prkA deletion mutant), and CΔprkA (complement of ΔprkA) bacterial cells were grown to OD600 ≈ 0.8 in TY broth medium, adjusted to OD600 ≈ 0.1, and then treated with 10 mM H2O2 for 30 min or incubated without H2O2 in otherwise identical conditions as a control. The percentage survival rate of the three stains was calculated as follows: [(CFU per ml after treatment with H2O2)/(CFU per ml before treatment with H2O2)] × 100. Data shown are the means of three independent experiments and the error bars indicate standard deviations. The significance of differences is shown at the P < 0.05 level (t-test). Different lowercase letters mean significant difference between two columns

Although H2O2 can be damaging for rhizobium, it appears that H2O2 is required for successful infection. The overexpression of the housekeeping catalase in Sinorhizobium meliloti RmkatB++ results in a delay of symbiosis formation and has negative effects on the development of infection threads [23].

Unfortunately, the symbiosis formation of M. alhagi and Alhagi sparsifolia is very unstable. Great effort has been made to conduct the plant experiments, but the results are always unreliable and unauthentic (data not shown). Therefore, we can only hypothesize that PrkA has positive effects on symbiosis formation.

Antioxidant enzyme activity determination

Catalase (CAT), superoxide dismutase (SOD) and peroxidase (POD) are major antioxidases in bacteria, which can eliminate the intracellular ROS [24]. Therefore, we measured the CAT, SOD, and POD activities of M. alhagi in different conditions. Figure 4 shows the enzyme activity in the three strains (without treatment, H2O2 treated, or 0.4 M NaCl treated). The CAT and SOD activities could be detected in all strains in each condition, while the POD activity was not detectable. We checked the RNA-Seq data and found that the genes coding CATs and SODs are highly expressed in M. alhagi, while PODs are only expressed at a low level [6]; thus POD activity in cells may have been below the detection limit of the kit used in our experiments.
Fig. 4
Fig. 4

Measurement of antioxidant enzyme activities. Measurement of catalase (CAT, (a)) and superoxide (SOD, (b)) activities in wild-type M. alhagi (WT), ΔprkA (prkA deletion mutant), and CΔprkA (complement of ΔprkA). Three independent biological experiments were conducted to measure the CAT and SOD activities. The error bars indicate standard deviations. The significance of differences is shown at the P < 0.05 level (t-test). Different lowercase letters mean significant difference between two columns

In control cells (normal conditions), the CAT activities of the three strains were almost the same, while the SOD activity of ΔprkA was significantly higher (p ≤ 0.05) than that in the other two strains. Salt stress and H2O2 treatment triggered increased CAT and SOD activities in all three strains (Fig. 4). The CAT and SOD activities under high-salt stress were markedly higher than those in the H2O2 treatment group, which could also suggest that high-salt stresses trigger oxidative stress. The lower CAT and SOD activities in the H2O2 treatment group were possibly caused by the low H2O2 concentration or the short treatment time.

The CAT and SOD activities of ΔprkA under salt stress and H2O2 treatment were extremely significantly higher (p ≤ 0.001) than those of the wild-type and CΔprkA (Fig. 4). The increase in CAT activity units of ΔprkA compared to the other two strains was much smaller than that in SOD activity units. Therefore, we hypothesize that PrkA influences the antioxidative capacity of M. alhagi mainly by affecting SOD activity. However, in favorable conditions (e.g., as in the control group), the high expression of SOD genes in ΔprkA could waste energy. PrkA may play a role in control of SOD gene expression. The adjustment of SOD gene expression may need the high expression of prkA in salt-free conditions.

Conclusions

A prkA deletion mutant has been constructed to study the function of PrkA in M. alhagi. The data suggest that the ability to survive some abiotic stresses was increased by knocking out prkA. Moreover, we showed similarities and differences in the functions of PrkA and its homologs in R. etli and other bacteria. Our results suggest that it is possible to increase the salt and alkali tolerance of a bacterium by constructing specific mutants in genes highlighted by RNA-Seq data. To our knowledge, this is the first report to identify the function of PrkA in stress adaption of Mesorhizobium and to construct an increased salt-tolerant rhizobial mutant. Most curious and interesting was that the high expression of prkA made M. alhagi more vulnerable to high salinity. Because of the unstable symbiosis formation in plant tests, the role prkA plays in symbiosis formation is unclear and needs more efforts to be illuminated.

Methods

Bacterial strains and growth conditions

Table 1 lists bacterial strains and plasmids used in this study. The purified bacteria were typically grown in tryptone-yeast extract (TY) broth (5 g tryptone, 3 g yeast extract, and 0.7 g CaCl2 · 2H2O per liter) at 28 °C for M. alhagi and its mutants, or Luria-Bertani broth (10 g tryptone, 5 g yeast extract, and 10 g NaCl per liter) at 37 °C for Esherichia coli. SM agar plates (10 g mannitol, 0.5 g K2HPO4, 0.5 g KNO3, 0.2 g MgSO4 · 7H2O, 0.1 g CaCl2, 0.1 g NaCl, and 15 g agar per liter) was used to isolate the mutants. All bacteria were incubated in aerobic conditions. Where necessary, antibiotics were added as the following concentrations: kanamycin, 100 μg/ml; gentamicin 50 μg/ml.
Table 1

Bacterial strains and plasmids used in this study

Strain or plasmid

Descriptiona

Source or reference

Escherichia coli

 DH5α

endA hsdR17 supE44 thi-1 recA1 gyrA relA1 Δ(lacZYA-argF)U169 deoR [Φ80 dlacΔ(lacZ)M15]

[27]

 S17-1λpir

Tpr Strr recA thi pro hsdR hsdM + RP4::2-Tc::Mu::Km Tn7 λpir lysogen

[28]

 DH-PrkA

DH5α carrying pK18prkA

This study

 DH-CPrkA

DH5α carrying pBLprkA

This study

Mesorhizobium alhagi

 XJ12-2

Wild-type

[18]

  ΔprkA

XJ12-2 ΔprkA

This study

 CΔprkA

ΔprkA carrying pBLprkA

This study

Plasmids

 pK18mobsacB

Suicide vector derived from plasmid pK18; Mob+ sacB Kmr

[25]

 pBBR1MCS-5

Broad-host-range cloning vector; Gmr

[29]

 pK18prkA

pK18mobsacB::prkA

This study

 pBLprkA

pBL carrying prkA

This study

aKmr, kanamycin resistance; Gmr, gentamicin resistance

Plasmid construction

The primers used to construct the prkA deletion mutant and the complementation strain are listed in Table 2. Primers PrkA-US and PrkA-UA were used to amplify a 208-bp upstream fragment of prkA with an EcoRI restriction enzyme site at the 5′ end and a BamHI site at the 3′ end. Primers PrkA-DS and PrkA-DA were used to amplify a 444-bp downstream fragment of prkA containing a BamHI restriction enzyme site at the 5′ end and an XbaI site at the 3′ end. The two fragments were then digested with the relevant restriction enzymes using standard protocols. The two digested fragments were then cloned into plasmid pk18mobsacB digested with the same enzymes to generate plasmid pK18prkA, which was verified by sequencing [25].
Table 2

Primers used for mutant and complement strain construction

Primer

Sequencea (5′-3′)

PrkA-US

CGGAATTCTCCTTCGTTCGCGGA

PrkA-UA

CGGGATCCGACCTCGTTGCCGA

PrkA-DS

CGGGATCCGCCTTCCCATATCAG

PrkA-DA

GCTCTAGACACTTCCTCCGTGTCGT

CPA

ATGAAGTCGCTTAATCCCCCGGGCATCGGGTCCGGCGCCGGATCGGG

CPB

TAACAAAATATTAACGCCCCGGGTCAGCCCGCCTTGTTGACGCGCATG

aRestriction enzyme sites are underlined

To construct the plasmid for prkA-complementation, a DNA fragment containing full-length prkA and a putative promoter of prkA (500 bp upstream of prkA) was amplified from genome DNA of M. alhagi using primers CPA and CPB. The PCR product was then purified using a Universal DNA Purification Kit (Tiangen, China). The purified PCR product was cloned into plasmid pBBR1MCS-5 digested with SmaI, using the ClonExpress MultiS One Step Cloning Kit (Vazyme Biotech, China), to generate the complementation plasmid pBLprkA, which was verified by sequencing.

Mutant and complement construction

To construct the prkA deletion mutant, we first transformed pK18prkA into E. coli strain S17-1λpir. Then a biparental mating procedure was used, as described previously [26], to transform pK18prkA from E. coli S17-1λpir into M. alhagi CCNWXJ12-2. Briefly, cultures of E. coli S17-1λpir (OD600 [optical density at 600 nm] ≈ 0.6) and M. alhagi CCNWXJ12-2 (OD600 ≈ 0.8) were mixed together in the ratio 1:2 (v/v) and cultured on a TY agar plate for 3 days. Single exchange (plasmid pK18prkA integrated into genome DNA of M. alhagi) cells of M. alhagi were selected using SM agar plates containing kanamycin. Double exchange mutants (prkA deletion mutant) were then isolated using TY agar plates containing sucrose (5 g/100 ml). Both of single-exchange and double-exchange mutants were verified by colony PCR and sequencing.

For genetic complementation, pBLprkA was transformed from E. coli S17-1λpir into M. alhagi CCNWXJ12-2 by biparental mating. SM agar plates containing gentamicin were used to isolate the complementation mutant, and colony PCR and sequencing were used to verify the mutant strain.

Salt and alkali resistance assays

Wild-type M. alhagi, ΔprkA, and CΔprkA were first grown in 20 ml TY broth to OD600 ≈ 0.8. Then suspensions (20 μl) of the three cultures were added to 20 ml TY broth and grown to OD600 ≈ 0.8. The inocula were adjusted to OD600 ≈ 0.2 with sterile water and then serially diluted to 10-fold. Then 5 μl of each diluted inoculum were respectively spotted onto TY agar plates at pH 7 containing no NaCl (control) or 0.4 M NaCl (salt treatment), or TY agar plates at pH 9 containing no NaCl (alkaline treatment). The pH of TY agar medium was adjusted using NaOH solution (1 M) before sterilization.

Measurement of total cellular Na+ content

Inocula were prepared as described in the section on the salt and alkali resistance assay. Five hundred microliters of each inoculum (OD600 ≈ 0.2) were plated on TY agar plates with and without 0.4 M NaCl and inoculated at 28 °C for 7 days. The bacteria were collected in 1.5-ml sterile tubes and dried using an air dryer at 50 °C for 12 h. The total cellular Na+ content was measured using an atomic absorption spectrophotometer (Hitachi, Tokyo, Japan).

Sensitivity assay of H2O2

Inocula (OD600 ≈ 0.1) were treated with or without 10 mM H2O2 for 30 min, then serially diluted and plated on TY agar plates. The colonies were counted after 10 days of growth at 28 °C. The percentage survival rate of the three stains was calculated as follows: [(CFU per ml after treatment with H2O2)/(CFU per ml before treatment with H2O2)] × 100.

Antioxidant enzyme activity assays

Wild-type M. alhagi, ΔprkA and CΔprkA were grown in TY broth medium to OD600 ≈ 0.8. Each strain (20 μl suspension) was added to two bottles of 20 ml TY broth medium without additional NaCl and one bottle of 20 ml TY broth medium containing 0.4 M NaCl. Then the bacteria were grown to OD600 ≈ 0.8. One bottle of TY broth medium without NaCl was set as the control group and the other was treated with 0.1 mM H2O2 for 30 min (H2O2 treatment). Then all groups for the three strains were collected in 50-ml tubes by centrifugation at 8000 g for 5 min. The cells were lysed by ultrasonication. The enzyme activities of CAT, SOD and POD were determined using a CAT Assay Kit, a SOD Assay Kit, and a POD Assay Kit (Suzhou Comin Biotechnology, China), respectively, according to the manufacturer’s protocols. Total soluble protein concentration was measured using a BCA Protein Assay Kit (CWBIO, China).

Statistical analysis

Statistical differences between the control and treatment groups of different strains were assessed by t-test using SPSS software version 15 (SPSS Inc., Chicago, IL, USA). Differences were considered to be significant at a probability level of P <0.05.

Abbreviation

CAT: 

Catalase

CFU: 

Colony forming units

CΔprkA : 

The complemented strain of ΔprkA

POD: 

Peroxidase

SDS: 

Sodium dodecyl sulfate

SOD: 

Superoxide dismutase

ΔprkA : 

The prkA deletion mutant of Mesorhizobium alhagi CCNWXJ12-2

Declarations

Acknowledgements

The authors would like to thank the National Science Foundation of China and the Fundamental Research Funds for the Central Universities for financial support.

Funding

This work was supported by grants from the National Science Foundation of China (31270012) and the Fundamental Research Funds for the Central Universities (2014YQ004).

Availability of data and materials

The datasets supporting the conclusions of this article are included within the article. The DNA sequence of the M. alhagi CCNWXJ12-2 prkA sequence is available under the accession No AHAM01000144.1. The M. alhagi CCNWXJ12-2 and the mutant strains can be obtained from the lab of Gehong Wei upon request.

Authors’ contributions

XL, YL and GH make conception and design of this work. XL and YL conduct the laboratory work. XL and ZL carry out the data analysis and manuscript writing. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

Not applicable.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
State Key Laboratory of Soil Erosion and Dryland Farming on the Loess Plateau, College of Life Sciences, Northwest A & F University, Yangling, Shaanxi, 712100, China

References

  1. Vriezen JAC, de Bruijn FJ, Nusslein K. Responses of rhizobia to desiccation in relation to osmotic stress, oxygen, and temperature. Appl Environ Microb. 2007;73(11):3451–9.View ArticleGoogle Scholar
  2. Zahran HH. Rhizobium-legume symbiosis and nitrogen fixation under severe conditions and in an arid climate. Microbiol Mol Biol R. 1999;63(4):968–89.Google Scholar
  3. Chen WM, Zhu WF, Bontemps C, Young JPW, Wei GH. Mesorhizobium alhagi sp nov., isolated from wild Alhagi sparsifolia in north-western China. Int J Syst Evol Micr. 2010;60:958–62.View ArticleGoogle Scholar
  4. Oufdou K, Benidire L, Lyubenova L, Daoui K, Fatemi ZE, Schroder P. Enzymes of the glutathione-ascorbate cycle in leaves and roots of rhizobia-inoculated faba bean plants (Vicia faba L.) under salinity stress. Eur J Soil Biol. 2014;60:98–103.View ArticleGoogle Scholar
  5. Zaman-Allah M, Sifi B, Issoufou M, El Aouni MH. Salt tolerance of a common bean (Phaseolus vulgaris L.) cultivar as affected by rhizobia. Symbiosis. 2005;40(1):17–22.Google Scholar
  6. Liu XD, Luo YT, Mohamed OA, Liu DY, Wei GH. Global transcriptome analysis of Mesorhizobium alhagi CCNWXJ12-2 under salt stress. Bmc Microbiol. 2014;14:1.View ArticlePubMedGoogle Scholar
  7. Vercruysse M, Fauvart M, Jans A, Beullens S, Braeken K, Cloots L, Engelen K, Marchal K, Michiels J. Stress response regulators identified through genome-wide transcriptome analysis of the (p) ppGpp-dependent response in Rhizobium etli. Genome Biol. 2011;12(2):R17.View ArticlePubMedPubMed CentralGoogle Scholar
  8. Cousin C, Derouiche A, Shi L, Pagot Y, Poncet S, Mijakovic I. Protein-serine/threonine/tyrosine kinases in bacterial signaling and regulation. Fems Microbiol Lett. 2013;346(1):11–9.View ArticlePubMedGoogle Scholar
  9. Tani TH, Khodursky A, Blumenthal RM, Brown PO, Matthews RG. Adaptation to famine: a family of stationary-phase genes revealed by microarray analysis. Proc Natl Acad Sci U S A. 2002;99(21):13471–6.View ArticlePubMedPubMed CentralGoogle Scholar
  10. Figueira R, Brown DR, Ferreira D, Eldridge MJ, Burchell L, Pan Z, Helaine S, Wigneshweraraj S. Adaptation to sustained nitrogen starvation by Escherichia coli requires the eukaryote-like serine/threonine kinase YeaG. Sci Rep. 2015;5:17524.View ArticlePubMedPubMed CentralGoogle Scholar
  11. Brown DR, Barton G, Pan Z, Buck M, Wigneshweraraj S. Nitrogen stress response and stringent response are coupled in Escherichia coli. Nat Commun. 2014;5:4115.PubMedPubMed CentralGoogle Scholar
  12. Tagourti J, Gautier V, Beaujouan JC, Gauchy C, Landoulsi A, Richarme G. Phosphorylation of a 65 kDa cytoplasmic protein by the Escherichia coli YeaG kinase. Ann Microbiol. 2011;61(3):499–503.View ArticleGoogle Scholar
  13. Kumar D, Palaniyandi K, Challu VK, Kumar P, Narayanan S. PknE, a serine/threonine protein kinase from Mycobacterium tuberculosis has a role in adaptive responses. Arch Microbiol. 2013;195(1):75–80.View ArticlePubMedGoogle Scholar
  14. Parandhaman DK, Sharma P, Bisht D, Narayanan S. Proteome and phosphoproteome analysis of the serine/threonine protein kinase E mutant of Mycobacterium tuberculosis. Life Sci. 2014;109(2):116–26.View ArticlePubMedGoogle Scholar
  15. Eichenberger P, Jensen ST, Conlon EM, van Ooij C, Silvaggi J, Gonzalez-Pastor JE, Fujita M, Ben-Yehuda S, Stragier P, Liu JS, et al. The sigmaE regulon and the identification of additional sporulation genes in bacillus subtilis. J Mol Biol. 2003;327(5):945–72.View ArticlePubMedGoogle Scholar
  16. Yan JY, Zou W, Fang J, Huang XW, Gao F, He ZY, Zhang KQ, Zhao NH. Eukaryote-like Ser/Thr protein kinase PrkA modulates sporulation via regulating the transcriptional factor sigma (k) in bacillus subtilis. Front Microbiol. 2015;6:382.View ArticlePubMedPubMed CentralGoogle Scholar
  17. Hussain H, Branny P, Allan E. A eukaryotic-type serine/threonine protein kinase is required for biofilm formation, genetic competence, and acid resistance in Streptococcus mutans. J Bacteriol. 2006;188(4):1628–32.View ArticlePubMedPubMed CentralGoogle Scholar
  18. Zhou ML, Chen WM, Chen HY, Wei GH. Draft genome sequence of Mesorhizobium alhagi CCNWXJ12-2(Tau), a novel salt-resistant species isolated from the desert of Northwestern China. J Bacteriol. 2012;194(5):1261–2.View ArticlePubMedPubMed CentralGoogle Scholar
  19. Morino M, Suzuki T, Ito M, Krulwich TA. Purification and functional reconstitution of a seven-subunit mrp-type na+/h + antiporter. J Bacteriol. 2014;196(1):28–35.View ArticlePubMedPubMed CentralGoogle Scholar
  20. Mols M, Abee T. Primary and secondary oxidative stress in bacillus. Environ Microbiol. 2011;13(6):1387–94.View ArticlePubMedGoogle Scholar
  21. Koh MJ, Lee HS, Rhee JE, Choi SH. Evidence that vibrio vulnificus AhpC2 is essential for survival under high salinity by modulating intracellular level of ROS. J Microbiol. 2010;48(1):129–33.View ArticlePubMedGoogle Scholar
  22. Calderon-Torres M, Castro DE, Montero P, Pena A. DhARO4 induction and tyrosine nitration in response to reactive radicals generated by salt stress in Debaryomyces hansenii. Yeast. 2011;28(10):733–46.View ArticlePubMedGoogle Scholar
  23. Jamet A, Mandon K, Puppo A, Herouart D. H2O2 is required for optimal establishment of the Medicago sativa/Sinorhizobium meliloti symbiosis. J Bacteriol. 2007;189(23):8741–5.View ArticlePubMedPubMed CentralGoogle Scholar
  24. Harrison A, Bakaletz LO, Munson Jr RS. Haemophilus influenzae and oxidative stress. Front Cell Infect Microbiol. 2012;2:40.View ArticlePubMedPubMed CentralGoogle Scholar
  25. Schafer A, Tauch A, Jager W, Kalinowski J, Thierbach G, Puhler A. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene. 1994;145(1):69–73.View ArticlePubMedGoogle Scholar
  26. Dhooghe I, Michiels J, Vlassak K, Verreth C, Waelkens F, Vanderleyden J. Structural and Functional-Analysis of the Fixlj Genes of Rhizobium-Leguminosarum Biovar Phaseoli Cnpaf512. Mol Gen Genet. 1995;249(1):117–26.View ArticleGoogle Scholar
  27. Hanahan D. Studies on transformation of Escherichia coli with plasmids. J Mol Biol. 1983;166(4):557–80.View ArticlePubMedGoogle Scholar
  28. Miller VL, Falkow S. Evidence for two genetic loci in Yersinia enterocolitica that can promote invasion of epithelial cells. Infect Immun. 1988;56(5):1242–8.PubMedPubMed CentralGoogle Scholar
  29. Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RM, Peterson KM. 4 New derivatives of the broad-host-range cloning vector Pbbr1mcs, carrying different antibiotic-resistance cassettes. Gene. 1995;166(1):175–6.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s). 2016

Advertisement

BMC Microbiology

ISSN: 1471-2180

Contact us