Skip to main content

Table 2 Primers used for mutant and complement strain construction

From: Functional analysis of PrkA - a putative serine protein kinase from Mesorhizobium alhagi CCNWXJ12-2 - in stress resistance

Primer Sequencea (5′-3′)
PrkA-US CGGAATTCTCCTTCGTTCGCGGA
PrkA-UA CGGGATCCGACCTCGTTGCCGA
PrkA-DS CGGGATCCGCCTTCCCATATCAG
PrkA-DA GCTCTAGACACTTCCTCCGTGTCGT
CPA ATGAAGTCGCTTAATCCCCCGGGCATCGGGTCCGGCGCCGGATCGGG
CPB TAACAAAATATTAACGCCCCGGGTCAGCCCGCCTTGTTGACGCGCATG
  1. aRestriction enzyme sites are underlined