Skip to content

Advertisement

BMC Microbiology

Research article
Open Access

Identification of RNAIII-binding proteins in Staphylococcus aureus using tethered RNAs and streptavidin aptamers based pull-down assay

BMC Microbiology201515:102

https://doi.org/10.1186/s12866-015-0435-3

©  Zhang et al.; licensee BioMed Central. 2015

Received: 5 March 2015

Accepted: 5 May 2015

Published: 15 May 2015

Abstract

Background

It has been widely recognized that small RNAs (sRNAs) play important roles in physiology and virulence control in bacteria. In Staphylococcus aureus, many sRNAs have been identified and some of them have been functionally studied. Since it is difficult to identify RNA-binding proteins (RBPs), very little has been known about the RBPs in S. aureus, especially those associated with sRNAs.

Results

Here we adopted a tRNA scaffold streptavidin aptamer based pull-down assay to identify RBPs in S. aureus. The tethered RNA was successfully captured by the streptavidin magnetic beads, and proteins binding to RNAIII were isolated and analyzed by mass spectrometry. We have identified 81 proteins, and expressed heterologously 9 of them in Escherichia coli. The binding ability of the recombinant proteins with RNAIII was further analyzed by electrophoresis mobility shift assay, and the result indicates that proteins CshA, RNase J2, Era, Hu, WalR, Pyk, and FtsZ can bind to RNAIII.

Conclusions

This study suggests that some proteins can bind to RNA III in S. aureus, and may be involved in RNA III function. And tRSA based pull-down assay is an effective method to search for RBPs in bacteria, which should facilitate the identification and functional study of RBPs in diverse bacterial species.

Keywords

Staphylococcus aureus RNAIIItRSAPull-down assayRNA-binding proteins

Background

Staphylococcus aureus is a human and animal pathogen that can cause multiple infectious diseases. The high infection ability of the bacterium depends on the production of many virulence factors, which are under control of multiple regulatory pathways. These regulators include transcriptional regulator proteins, two-component systems, and small RNAs (sRNAs).

sRNAs in bacteria range from 50 to several hundred nucleotides, and function through RNA-RNA base pairing to activate or block the translation, or to induce the degradation of target mRNA. RNAIII is a 514 nucleotides sRNA, and can regulate the expression of many virulence genes as well as some regulators at the post-transcriptional level. Binding between RNAIII and its targets can lead to translation activation, translation blocking, or mRNA degradation mediated by RNase III [1].

Nowadays, hundreds of sRNAs have been identified in S. aureus, but very little has been known about RNA-binding proteins (RBPs) involved in sRNA regulation in this bacterium. It has been widely recognized that Hfq acts as an important chaperone in many Gram-negative bacteria [2]. In S. aureus, Hfq can bind to specific short RNA [3, 4], but deletion of hfq has no significant impact on sRNA stability or regulation, suggesting that Hfq is not an RNA chaperone in S. aureus [5]. RNase III is the only ribonuclease proved to be important for sRNA regulation in S. aureus, and it degrades double-stranded RNA formed by base-pairing of RNAIII with its mRNA targets such as spa, coa, and rot [6]. sRNA regulation may involve some other ribonucleases, which have not been studied yet. Besides, a transcriptional regulator SarA may act as an RBP and affect mRNA stability [7]. Thus, it is appealing to illustrate the interaction between sRNA and their RBPs in S. aureus [1, 8].

RBPs are difficult to identify due to the lack of effective tags. In previous studies, RNA affinity chromatography was used to purify a c-myc binding protein [9]; biotin labeling was used for affinity purification of many RBPs [10–12]; and in recent years, some RNA aptamers have been developed to bind to specific molecules and can be used as affinity tags, including aptamers binding to MS2 protein [13], tobramycin [14], sephadex [15], streptomycin [16], and streptavidin [17]. To make the aptamer and bait RNA more stable, tRNA scaffold was developed [18], and then tRNA scaffold to a streptavidin aptamer (tRSA) was successfully invented as an affinity matrix, which can efficiently capture some transcript-specific RBPs from cell lysates [19].

Aiming to identify proteins binding to RNAIII, we carried out pull-down assay using tRSA as a tag in this study. The tethered RNAs were successfully captured by Streptavidin MagneSphere Paramagnetic Particles (SA-PMPs), and those proteins binding to RNAIII were isolated and analyzed by mass spectrometry (MS). Using this method, 81 proteins were identified, and RNA-binding abilities of 9 proteins were further determined by electrophoresis mobility shift assay (EMSA). Our data indicate that some proteins can bind to RNAIII, and that tRSA based pull-down assay is an effective method to identify RBPs in S. aureus. Further research on these RBPs should shed light on the function and mechanisms of sRNA regulation in S. aureus.

Results

tRSA-RNAIII and the RBPs were captured by SA-PMPs in the pull-down system

Aiming to identify RNAIII-binding proteins, we performed the pull-down assay using tRSA as a tag. Streptavidin aptamer fusion in the anti-code site of tRNA was captured by streptavidin PMPs, while RNAIII attached to the 3′ site of tRNA can act as a bait for RBPs (Fig. 1A). About 0.3 μg RNA was captured by the SA-PMPs in the pull-down process (Fig. 1B). Although a lot of RNA was degraded, the RNA captured was intact (Fig. 1C), which can act as the bait RNA for protein binding. Proteins retained on the beads were analyzed by silver staining, with proteins binding to empty SA-PMPs as negative controls (Fig. 1D, lane NC), and the major bands were identified by LC/MS (Additional file 1: Table S1). From three biologically independent experiments, 81 proteins were identified and quantified from at least two replicates.
Figure 1
Fig. 1

Procedure of the pull-down assay. a Composition of the pull-down system. RNAIII was attached to the 3′-end of the tRSA, and the SA-PMPs was used to capture the aptamer. b The tethered RNA was used for pull-down assay and the captured RNA in each step was collected and qualified by real-time RT-PCR. The RNA abundance of input sample was indicated as 1,000. c The integrity of the RNA collected in each step was assayed by electrophoresis. The input sample was diluted 100 times and the pull-down sample was diluted 10 times. RNA sample (10 μl) was loaded to the electrophoresis. d Proteins retained on the beads were analyzed by silver staining. Protein sample (10 μl) was applied to 12 % PAGE and then silver staining

Classification of the proteins binding to RNAIII

The identified proteins were divided into different classifications based on the COG (Cluster of Orthologous Groups) data in NCBI. The percentage of most kinds of proteins in the pull-down sample was similar to that in the S. aureus NCTC8325 proteomics. In contrast, cell wall/membrane biogenesis proteins (15 and 2 in pull down sample and NCTC8325, respectively) and replication-, recombination- and repair-related proteins (5 and 2 in pull-down sample and NCTC8325, respectively) were enriched in the RNAIII pull-down system (Fig. 2A), suggesting that these two kinds of proteins may have higher affinity to RNAIII. These proteins were then classified by the conserved domain analysis. In these 81 proteins, only 18.5 % were predicted to have RNA-binding domains, while 12.5 % contain DNA-binding domains and the others were not known to have relationships with RNA or DNA (Fig. 2B). Those proteins with RNA/DNA-binding motifs were listed in Table 1.
Figure 2
Fig. 2

Classification of the proteins binding to RNAIII. a The proteins identified by LC-MS were classified based on the COG (Cluster of Orthologous Groups) data in NCBI. The proteins from S. aureus strain NCTC8325 was applied to LC-MS and the components of each class of proteins were analyzed the same way. b The conserved domains in the identified proteins were generalized based on the Uniprot database

Table 1

List of the proteins with RNA-binding and DNA-binding domains identified by MS

Proteins with RNA-binding domains

Gene

Protein

SAOUHSC_00769

Protein translocase subunit SecA

SAOUHSC_01035

Ribonuclease J 1

SAOUHSC_01252

Ribonuclease J 2

SAOUHSC_01659

Putative uncharacterized protein

SAOUHSC_01679

Putative uncharacterized protein

SAOUHSC_01207

Signal recognition particle protein

SAOUHSC_01184

Sun protein

SAOUHSC_02362

Transcription termination factor Rho

SAOUHSC_01492

GTP-binding protein EngA

SAOUHSC_01163

Pseudouridine synthase

SAOUHSC_01668

GTP-binding protein Era

SAOUHSC_00464

Ribosomal RNA small subunit methyltransferase A

SAOUHSC_01203

Ribonuclease III

SAOUHSC_00513

Putative uncharacterized protein

SAOUHSC_02303

mRNA interferase MazF

Proteins with DNA-binding domains

Gene

Protein

SAOUHSC_01099

Endonuclease MutS2

SAOUHSC_01351

DNA topoisomerase 4 subunit B

SAOUHSC_00001

Chromosomal replication initiator protein DnaA

SAOUHSC_01682

Chaperone protein DnaJ

SAOUHSC_01850

Catabolite control protein A

SAOUHSC_01576

Exonuclease family protein

SAOUHSC_01454

Putative uncharacterized protein

SAOUHSC_00467

Pur operon repressor

SAOUHSC_00020

Transcriptional regulatory protein WalR

SAOUHSC_01490

DNA-binding protein Hu

Confirmation of the binding ability of the protein candidates

Those protein candidates with RNA or DNA-binding domains have more possibility to interact with RNA because of the structural similarity between RNA and DNA, while the interactions between RNA and other proteins need to be further verified. To confirm that the protein candidates identified were RBPs, the binding ability of these proteins was validated by EMSA. Eleven recombinant proteins with different kind of motifs were expressed in E. coli, including four proteins with RNA-binding motifs, two proteins with DNA-binding motifs, and three proteins with no nucleic acid-binding motif. PNPase and Enolase were suggested to be the components of RNA degradosome, but they were not found in our pull-down assay (Fig. 3A).
Figure 3
Fig. 3

Expression and EMSA of the binding ability of the protein candidates. a Protein candidates expressed in E. coli. The clone and expression details are listed in Tables 2, 3 and 4. b, c, and d The binding ability of proteins to RNAIII was determined by EMSA. DIG-labeled RNAIII probes (0.24 μM) were used in all reactions. Increasing amounts of different proteins were incubated with labeled RNAIII probes. Figure (b) represents four proteins containing RNA-binding motifs (RNase III 0, 2, 4, 8 μM; CshA 0, 6.5, 32 μM; RNase J2 0, 3.2, 6.4 μM; Era 0, 2.9, 5.8 μM.), Figure (c) represents two proteins containing DNA-binding motifs, and three proteins unrelated to nucleic acid (Hu 0, 180, 360 μM; WalR 0, 75, 150 μM; Pyk 0, 6.3, 13 μM; FtsZ 0, 27, 140 nM; pfkA 0, 16, 140 μM). Figure (d) represents two negative control proteins (PNPase 0, 1.3, 12 μM; Enolase 0, 2.1, 19 μM)

RNase III has an RNA-binding motif, and exhibited RNA degradation activity (Fig. 3B), which is consistent with the previous report [20]. CshA, RNase J2, and Era also have RNA-binding motifs and showed binding ability with RNAIII (Fig. 3B). Hu and WalR have DNA-binding domain, and also showed RNAIII binding ability (Fig. 3C). Surprisingly, Pyk and FtsZ, without RNA/DNA-binding domains, also had binding activity with RNAIII. PfkA did not bind to RNAIII even at high concentration (Fig. 3C). As expected, PNPase and Enolase did not bind to RNAIII (Fig. 3D), which was consistent with the pull-down assay results. Among the nine proteins identified, eight can interact with RNAIII, suggesting that our pull-down and MS assays are effective and reliable.

Discussion

The significance of sRNA in gene regulation in bacteria is now widely recognized [1, 21], and more bacterial sRNAs have been identified in the last decade [22, 23]. In S. aureus, hundreds of sRNAs have been identified, and some of them have been proved to play roles in physiology and virulence control [24]. The sRNA-mRNA base-pairing mechanism has been found ubiquitously in sRNA regulation in S. aureus, whereas, there is currently very limited information about staphylococcal RBPs that might be involved in sRNA regulation [1]. RNase III [20], Hfq [8, 25], and the transcriptional regulator SarA [26] are those only RBPs known in S. arueus. RBPs involved in sRNA regulation may include RNA chaperones, RNA helicases, ribonucleases, and some regulators [8]. Also, the activity of some enzymes may be affected by RNA binding [27]. Identification of RBPs in S. arueus in this study may help us better understand the details about sRNA regulation in staphylococci and other bacterial pothogens.

tRSA is an efficient RNA aptamer tag for RNA pull-down assay [19, 28, 29]. After invented, tRSA has already been used in different kinds of researches, including microRNA-RNA interaction [28], co-expression of RNA/protein complex, and isolation of RBPs [30]. This RNA aptamer does not need recombinant proteins or affinity matrices compared to those MS2 aptamers; and the labeling is easier and cheaper than biotin. Because there are some standardized reagents for this tag, the effect and stability of the experiment system may be improved a lot. In this study, we used the streptavidin magnetic beads to capture the tRSA tag. Using this system, we have successfully identified proteins binding to RNAIII in S. aureus, and this technique may be well suitable for the identification of RBPs in other bacteria.

The proteins captured by RNAIII in our study include various kinds of proteins, some of which have been reported to participate in RNAIII function. RNase III can degrade double-stranded RNA formed by base-pairing of RNAIII with its mRNA targets [1], and it also can digest RNAIII [20]. Era was known to consist of a K homology domain and to recognize the sequence of 16S rRNA of S. aureus [31], and we show here it can also bind to RNAIII in vitro. It was reported that eight proteins (CshA, RNase J1, RNase J2, RNase Y, PNPase, Enolase, PfkA and RnpA) may interact with S. aureus RNA degradosome, which has been confirmed by bacterial two-hybrid analysis [32]. We here show that CshA and RNase J2 can bind to RNAIII, while PNPase and Enolase cannot. CshA was reported to be involved in mRNA half-life control in S. aureus [33], and it may also influence the stability of RNAIII. Besides, we have identified some DNA-binding proteins that can bind to RNAIII, including Hu, which has already been proved to bind to rRNA, tRNA segments, and a few small RNAs related to nucleoid morphology in E. coli [34]; WalR is a transcriptional factor involved in autolysis, biofilm formation, and cell wall metabolism. Our results show that WalR can bind to RNAIII as well, which may have the same property as the transcriptional factor SarA [26]. We further show that some metabolism-related proteins can bind to RNAIII, including pyruvate kinase and FtsZ, and this should provide us a new perspective about sRNA-mediated metabolism control.

Another concern in the interaction between RNA and RBPs is the binding specificity. RBPs may recognize specific sequences or structures in their RNA targets [35]. Some of the proteins we identified may bind not only to RNAIII, but also to other RNA or DNA. Further study may illustrate the RNA binding specificity of these RBPs and the relating molecular mechanisms.

Conclusions

Pull-down assay using tRNA scaffold streptavidin aptamer was performed to search for the proteins binding to RNAIII in S. aureus. By using this method, 81 proteins binding to RNAIII were identified by the pull-down and MS assay, and the binding ability of 9 proteins with RNAIII was verified by EMSA. Proteins CshA, RNase J2, Era, Hu, WalR, Pyk and FtsZ were confirmed to bind to RNAIII. The finding and investigation of proteins binding to RNAIII should facilitate sRNA study in staphylococci.

Methods

Strains and plasmids

Strains and plasmids used in this study are listed in Table 2. E. coli strains were grown at 37 °C in Luria-Bertani (LB) medium with suitable antibiotics: ampicillin (100 μg/mL) or kanamycin (50 μg/mL). S. aureus strains were grown at 37 °C in tryptic soy broth (TSB, Oxiod). The media were solidified with 1.5 % (wt/vol) agar as needed.
Table 2

Bacteria strains and plasmids used in this study

Strain or plasmid

Comments

Source or Reference

Strains

  

S. aureus NCTC8325

Wild type

NARSAa

E. coli DH5α

Clone host strain

Laboratory stock

E. coli BL21 (DE3)

Expression host strain

Laboratory stock

E. coli M15 (pREP4)

Expression host strain

Laboratory stock

Plasmids

  

pcDNA3-tRSA

Template for tRSA

[19]

pEASY TB

Clone vector, Kanr Apr

Transgen

pSXZ06

pEASY TB with RNAIII for in vitro transcription

[36]

pET28a (+)

Expression vector with hexahistidine tag, Kanr

Novagen

pET21b (+)

Expression vector with hexahistidine tag, Apr

Novagen

pQE30

Expression vector with hexahistidine tag, Apr

QIAGEN

pQE30-RNase III

Expression vector for protein RNase III

[36]

pET28a-Hu

Expression vector for protein Hu

This study

pET21b-FtsZ

Expression vector for protein FtsZ

This study

pET28a-Pyk

Expression vector for protein Pyk

This study

pET28a-Era

Expression vector for protein Era

This study

pET28a-WalR

Expression vector for protein WalR

[37]

pET22b-RNase J2

Expression vector for protein RNase J2

This study

pET22b-CshA

Expression vector for protein CshA

This study

pET22b-PNPase

Expression vector for protein PNPase

This study

pET22b-PfkA

Expression vector for protein PfkA

This study

pET24a-Enolase

Expression vector for protein Enolase

This study

a NARSA, Network on Antimicrobial Resistance in Staphylococcus aureus

In vitro RNA synthesis

The template for tRSA-RNAIII transcription was digested from plasmid pSXZ06. The RNAs were produced by in vitro transcription as described [36], using a RiboMAX Large Scale RNA Production Systems-T7 (Promega). RNAs were labeled with DIG using RNA labeling Mix (Roche).

RNA isolation and real-time RT-PCR

RNA was extracted using the Trizol method (Invitrogen), and residual DNA was digested with 10 U of DNaseI (Takara) at 37 °C for 1 h. Reverse transcription was carried out with the PrimeScript 1st Strand cDNA synthesis kit (Takara) and real-time PCR was performed with SYBR Premix Ex Taq (TaKaRa) using a StepOne real-time system (Applied Biosystems). The RNA abundance of input sample was indicated as 1,000 and the relevant quantification of captured RNA was analyzed by calculating the difference of CT in the real-time PCR.

RBPs pull-down assay

RBPs pull-down assay was performed as previously described [19], with some modifications. Briefly, S. aureus cultures (2 ml) were collected and bacterial cells were resuspended with lysis buffer (10 mM HEPES, pH 7.0, 200 mM NaCl, 1 % Triton X-100, 10 mM MgCl2, 1 mM DTT) containing protease inhibitor cocktail (Sangon), and 40 U/ml lysostaphin (AMBI). The suspension was incubated at 37 °C for 10 min to lyse the cell. After centrifugation at 12,000 g for 30 min, the supernatants were collected and the concentration of total protein was quantified by BCA assay. Avidin (Calbiochem, 10 mg/mg protein), Yeast RNA (Sigma, 0.5 mg/mg protein), and RNase inhibitor (3 μl, Transgen) were added as the final pre-cleared lysates. About 2 mg protein was applied for each pull-down assay.

At the same time, 10 μg of bait RNA sample was dissolved in buffer containing 10 mM HEPES, pH 7.0, 10 mM MgCl2, and denatured at 65 °C for 5 min and then cooled to room temperature. SA-PMPs (0.6 mg, Promega) was rinsed twice with 0.5 × SSC, and then rinsed twice with lysis buffer. The RNA sample was incubated with the prepared SA-PMPs at 4 °C for 20 min on a rotating shaker, then pre-cleared lysates were added and incubated for another 1.5 h on a rotating shaker. The SA-PMPs was then washed 3 times with fresh lysis buffer. SDS-loading buffer (50 μl) was added and the proteins captured were incubated at 95 °C for 10 min. Samples from each step were collected for RNA assay.

The proteins were separated by SDS-PAGE and silver or Coomassie brilliant blue staining, and the gel bands were excised and in-gel digested with trypsin (0.6 mg), and the tryptic peptides were subjected to LC-MS/MS analysis with a LTQ mass spectrometer (ProteomeX-LTQ, ThermoFisher Scientific). Sequence and peptide fingerprint data were analyzed using the NCBI database.

Expression and purification of recombinant proteins

Open reading frames of different proteins were amplified from S. aureus NCTC8325 genomic DNA with primers listed in Table 3. After digested, the PCR product was ligated into plasmid, then transformed into E. coli DH5α, and then the expression strains. The plasmids, expression strains, and conditions for proteins were listed in Tables 2 and 4. The recombinant proteins were purified by Ni-NTA resin (Qiagen), eluted, passed through an ultrafiltration system to remove imidazole, and then stored in 10 % glycerol at -70 °C until use. Protein purity and concentration were determined by SDS-PAGE and the BCA assay.
Table 3

Primers used in this study

Primer name

Sequence

tRSA-f

GCCGCCAGTGTGCTGGAATT

tRSA-r-EcoRI-BamHI

GCGGGATCCGATATCTGCAGAATTC

Vitro-RNAIII-f-EcoRI

GCG GAATTC AGATCACAGAGATGTGAT

Vitro-RNAIII-r-BamHI

GCG GGATCC AAGGCCGCGAGCTTGGGA

RNase III-f-BamHI

TAAAGGATCTCTAAACAAAAGAAAAGTGAGATAGTTAATC

RNase III-r-SmaI

TACCCCCGGGTTTAATTTGTTTTAATTGCTTATAGGCACTTTTAG

Hu-r-XhoI

CCG CTCGAG TTTTACAGCATCTTTTA

Hu-f-NcoI

CATG CCATGG GC AACAAAACAGATTT

FtsZ-f-NdeI

CGCCATATGTTAGAATTTGAAC

FtsZ-r-XhoI

CCGCTCGAGACGTCTTGTTCTTC

Era-f-Nde I

CCCATATGACAGAACATAAATCAGG

Era-r-Xho I

CCGCTCGAGTTAATCTTGGTCTTCAAC

Pyk-f-BamHI

CGCGGATCCATGAGAAAAACTAAAATTGT

Pyk-r-xhoI

GTTCTCGAGTTATAGTACGTTTGCATATCCTTC

WalR-f-NcoI

CCACCATGGCTAGAAAAGTTGTTGTAGTTG

WalR-r-XhoI

CTCCTCGAGCTCATGTTGTTGGAGGAAATATCCA

RNase J2-f-BamHI

CGCGGATCCATGAATAGTGAGTTTATATATGGACGGGTAACAAATTTAGG

RNase J2-r-XhoI

CCGCTCGAGTTAAATTTCAGAAATTACTGGAATAATCATAGGACGACG

CshA-f-BamHI

GGATCCATGCAAAATTTTAAAGAACTAGGGATTTCG

CshA-r-XhoI

CTCGAGTTTTTGATGGTCAGCAAATGTGCG

PNPase-f-BamHI

GAAGGATCCATGTCTCAAGAAAAGAAAGTTTTTAAAAC

PNPase-r-XhoI

GAACTCGAGTTCTTCTAATGCTCTGTGTGATGC

PfkA-f-BamHI

GCCGGATCCATGAAGAAAATTGCAGTTTTAACTAGTGGT

PfkA-r-XhoI

CCCCTCGAGTATAGATAACTTGTTAGCAAGTTCATAT

Enolase-f-BamHI

GAAGGATCCATGCCAATTATTACAGATGTTTACGC

Enolase-r-XhoI

GAACTCGAGTTTATCTAAGTTATAGAATGATTTGATACCG

Table 4

Conditions used for protein expression

Name

OD600

IPTG

Temperature

Buffer

RNase III

0.2

1 mM

30 °C for 4 h

30 mM Tris–HCl, 500 mM KCl, 0.1 mM DTT, 0.1 mM EDTA, pH 8.0

Hu

0.8

1 mM

16 °C for 16 h

50 mM PBS, 150 mM NaCl, pH 7.8

FtsZ

0.6

0.5 mM

20 °C for 16 h

50 mM Tris–HCl, 300 mM NaCl, pH 8.0

Pyk

0.6

0.2 mM

30 °C for 5 h

30 mM Tris–HCl, 200 mM NaCl, pH 7.8

Era

0.6

0.5 mM

16 °C for 16 h

50 mM Tris–HCl, 500 mM NaCl, pH 8.0

WalR

0.6

0.5 mM

20 °C for 16 h

50 mM Tris–HCl, 200 mM NaCl, pH 8.0

RNase J2

0.6

0.4 mM

16 °C for 20 h

20 mM Tris–HCl, 200 mM NaCl, pH 7.5

CshA

0.6

0.4 mM

16 °C for 20 h

20 mM Tris–HCl, 1 M NaCl, pH 7.5

PNPase

0.6

0.4 mM

16 °C for 20 h

20 mM Tris–HCl, 200 mM NaCl, pH 7.5

PfkA

0.6

0.4 mM

16 °C for 20 h

20 mM Tris–HCl, 200 mM NaCl, pH 7.5

Enolase

0.6

0.4 mM

16 °C for 20 h

20 mM Tris–HCl, 200 mM NaCl, pH 7.5

EMSA

EMSA between RNA and RBPs was performed as previously described [34]. The labeled RNA was denatured at 65 °C for 10 min and cooled to room temperature. Increasing amounts of proteins were incubated with RNA on ice for 30 min in protein buffer. After electrophoresis in 4 % native polyacrylamide gel in a 1 × TBE buffer, RNA was electrotransferred to a charged nylon membrane (Millipore) in 0.5 × TBE. The DIG-labeled RNA was detected using a DIG gel-shift kit (Roche) according to the manufacturer’s instructions.

Abbreviations

sRNA: 

Small RNA

S. aureus : 

Staphylococcus aureus

RBPs: 

RNA-binding proteins

tRSA: 

tRNA scaffold to a streptavidin aptamer

SA-PMPs: 

Streptavidin MagneSphere Paramagnetic Particles

MS: 

Mass spectrometry

EMSA: 

Electrophoresis mobility shift assay

Declarations

Acknowledgments

We thank the Network on Antimicrobial Resistance in Staphylococcus aureus (NARSA) for providing the bacterial strains. We thank Professor Ian G. Macara (University of Virginia School of Medicine) and Professor Zhi Chen (Wuhan University) for providing the plasmid pcDNA3-tRSA. This work was supported by the National Natural Science Foundation of China (31371324).

Authors’ Affiliations

(1)
School of Life Sciences, University of Science and Technology of China, Hefei, China
(2)
CAS Key Laboratory of Innate Immunity and Chronic Disease, University of Science and Technology of China, Hefei, China
(3)
School of Life Sciences, Anhui Agricultural University, Hefei, Anhui, China

References

  1. Tomasini A, Francois P, Howden BP, Fechter P, Romby P, Caldelari I. The importance of regulatory RNAs in Staphylococcus aureus. Infect Genet Evolution. 2014;21:616–26.View ArticleGoogle Scholar
  2. Geissmann TA, Touati D. Hfq, a new chaperoning role: binding to messenger RNA determines access for small RNA regulator. EMBO J. 2004;23(2):396–405.View ArticlePubMed CentralPubMedGoogle Scholar
  3. Brennan RG, Link TM. Hfq structure, function and ligand binding. Curr Opin Microbiol. 2007;10(2):125–33.View ArticlePubMedGoogle Scholar
  4. Moller T, Franch T, Hojrup P, Keene DR, Bachinger HP, Brennan RG, et al. Hfq: a bacterial Sm-like protein that mediates RNA-RNA interaction. Mol Cell. 2002;9(1):23–30.View ArticlePubMedGoogle Scholar
  5. Bohn C, Rigoulay C, Bouloc P. No detectable effect of RNA-binding protein Hfq absence in Staphylococcus aureus. BMC Microbiol. 2007;7:10.View ArticlePubMed CentralPubMedGoogle Scholar
  6. Romilly C, Chevalier C, Marzi S, Masquida B, Geissmann T, Vandenesch F, et al. Loop-loop interactions involved in antisense regulation are processed by the endoribonuclease III in Staphylococcus aureus. RNA Biol. 2012;9(12):1461–72.View ArticlePubMedGoogle Scholar
  7. Morrison JM, Anderson KL, Beenken KE, Smeltzer MS, Dunman PM. The staphylococcal accessory regulator, SarA, is an RNA-binding protein that modulates the mRNA turnover properties of late-exponential and stationary phase Staphylococcus aureus cells. Front Cell Infect Microbiol. 2012;2:26.View ArticlePubMed CentralPubMedGoogle Scholar
  8. Romilly C, Caldelari I, Parmentier D, Lioliou E, Romby P, Fechter P. Current knowledge on regulatory RNAs and their machineries in Staphylococcus aureus. RNA Biol. 2012;9(4):402–13.View ArticlePubMedGoogle Scholar
  9. Trotonda MP, Tamber S, Memmi G, Cheung AL. MgrA represses biofilm formation in Staphylococcus aureus. Infect Immun. 2008;76(12):5645–54.View ArticlePubMed CentralPubMedGoogle Scholar
  10. Leid JG, Shirtliff ME, Costerton JW, Stoodley P. Human leukocytes adhere to, penetrate, and respond to Staphylococcus aureus biofilms. Infect Immun. 2002;70(11):6339–45.View ArticlePubMed CentralPubMedGoogle Scholar
  11. Huarte M, Guttman M, Feldser D, Garber M, Koziol MJ, Kenzelmann-Broz D, et al. A Large Intergenic Noncoding RNA Induced by p53 Mediates Global Gene Repression in the p53 Response. Cell. 2010;142(3):409–19.View ArticlePubMed CentralPubMedGoogle Scholar
  12. Rodgers JT, Patel P, Hennes JL, Bolognia SL, Mascotti DP. Use of biotin-labeled nucleic acids for protein purification and agarose-based chemiluminescent electromobility shift assays. Anal Biochem. 2000;277(2):254–9.View ArticlePubMedGoogle Scholar
  13. Said N, Rieder R, Hurwitz R, Deckert J, Urlaub H, Vogel J. In vivo expression and purification of aptamer-tagged small RNA regulators. Nucleic Acids Res. 2009;37(20):e133.View ArticlePubMed CentralPubMedGoogle Scholar
  14. Darnell JC, Jensen KB, Jin P, Brown V, Warren ST, Darnell RB. Fragile X mental retardation protein targets G quartet mRNAs important for neuronal function. Cell. 2001;107(4):489–99.View ArticlePubMedGoogle Scholar
  15. Srisawat C, Goldstein IJ, Engelke DR. Sephadex-binding RNA ligands: rapid affinity purification of RNA from complex RNA mixtures. Nucleic Acids Res. 2001;29(2):E4.View ArticlePubMed CentralPubMedGoogle Scholar
  16. Bachler M, Schroeder R, von Ahsen U. StreptoTag: A novel method for the isolation of RNA-binding proteins. RNA. 1999;5(11):1509–16.View ArticlePubMed CentralPubMedGoogle Scholar
  17. Srisawat C, Engelke DR. Streptavidin aptamers: Affinity tags for the study of RNAs and ribonucleoproteins. RNA. 2001;7(4):632–41.View ArticlePubMed CentralPubMedGoogle Scholar
  18. Ponchon L, Dardel F. Recombinant RNA technology: the tRNA scaffold. Nat Methods. 2007;4(7):571–6.View ArticlePubMedGoogle Scholar
  19. Iioka H, Loiselle D, Haystead TA, Macara IG. Efficient detection of RNA-protein interactions using tethered RNAs. Nucleic Acids Res. 2011;39(8):e53.View ArticlePubMed CentralPubMedGoogle Scholar
  20. Lioliou E, Sharma CM, Caldelari I, Helfer AC, Fechter P, Vandenesch F, et al. Global Regulatory Functions of the Staphylococcus aureus Endoribonuclease III in Gene Expression. PloS Genet. 2012;8(6):e1002782.View ArticlePubMed CentralPubMedGoogle Scholar
  21. Waters LS, Storz G. Regulatory RNAs in Bacteria. Cell. 2009;136(4):615–28.View ArticlePubMed CentralPubMedGoogle Scholar
  22. Bobrovskyy M, Vanderpool CK. Regulation of Bacterial Metabolism by Small RNAs Using Diverse Mechanisms. Annu Rev Genet. 2013;47:209–32.View ArticlePubMedGoogle Scholar
  23. Liu JM, Camilli A. A broadening world of bacterial small RNAs. Curr Opin Microbiol. 2010;13(1):18–23.View ArticlePubMed CentralPubMedGoogle Scholar
  24. Felden BF B, Vandenesch F, Bouloc P, Romby P. The Staphylococcus aureus RNome and Its Commitment to Virulence. PloS Pathog. 2011;7(3):e1002006.View ArticleGoogle Scholar
  25. Liu Y, Wu N, Dong J, Gao YP, Zhang X, Mu CH, et al. Hfq Is a Global Regulator That Controls the Pathogenicity of Staphylococcus aureus. PloS One. 2010;5(9):e13069.View ArticlePubMed CentralPubMedGoogle Scholar
  26. Roberts C, Anderson KL, Murphy E, Projan SJ, Mounts W, Hurlburt B, et al. Characterizing the effect of the Staphylococcus aureus virulence factor regulator, SarA, on log-phase mRNA half-lives. J Bacteriol. 2006;188(7):2593–603.View ArticlePubMed CentralPubMedGoogle Scholar
  27. Wassarman KM, Storz G. 6S RNA regulates E-coli RNA polymerase activity. Cell. 2000;101(6):613–23.View ArticlePubMedGoogle Scholar
  28. Huan Liu SZ, Heng L, Rong J, Zhi C. Identification of microRNA–RNAinteractions using tetheredRNAs and streptavidinaptamers. Biochem Biophys Res Commun. 2012;422:405–10.View ArticlePubMedGoogle Scholar
  29. Clayton C. The Regulation of Trypanosome Gene Expression by RNA-Binding Proteins. PloS Pathog. 2013;9(11):e1003680.View ArticlePubMed CentralPubMedGoogle Scholar
  30. Ponchon L, Catala M, Seijo B, El Khouri M, Dardel F, Nonin-Lecomte S, et al. Co-expression of RNA-protein complexes in Escherichia coli and applications to RNA biology. Nucleic Acids Res. 2013;41(15):e150.View ArticlePubMed CentralPubMedGoogle Scholar
  31. Tu C, Zhou XM, Tarasov SG, Tropea JE, Austin BP, Waugh DS, et al. The Era GTPase recognizes the GAUCACCUCC sequence and binds helix 45 near the 3 ′ end of 16S rRNA. Proc Natl Acad Sci U S A. 2011;108(25):10156–61.View ArticlePubMed CentralPubMedGoogle Scholar
  32. Roux CM, DeMuth JP, Dunman PM. Characterization of Components of the Staphylococcus aureus mRNA Degradosome Holoenzyme-Like Complex. J Bacteriol. 2011;193(19):5520–6.View ArticlePubMed CentralPubMedGoogle Scholar
  33. Oun S, Redder P, Didier JP, Francois P, Corvaglia AR, Buttazzoni E, et al. The CshA DEAD-box RNA helicase is important for quorum sensing control in Staphylococcus aureus. RNA Biol. 2012;10(1):157–65.View ArticlePubMedGoogle Scholar
  34. Macvanin M, Edgar R, Cui F, Trostel A, Zhurkin V, Adhya S. Noncoding RNAs Binding to the Nucleoid Protein HU in Escherichia coli. J Bacteriol. 2012;194(22):6046–55.View ArticlePubMed CentralPubMedGoogle Scholar
  35. Cook KB, Kazan H, Zuberi K, Morris Q, Hughes TR. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 2011;39:D301–8.View ArticlePubMed CentralPubMedGoogle Scholar
  36. Xue T, Zhang X, Sun H, Sun B. ArtR, a novel sRNA of Staphylococcus aureus, regulates alpha-toxin expression by targeting the 5′ UTR of sarT mRNA. Med Microbiol Immunol. 2014;203(1):1–12.View ArticlePubMedGoogle Scholar
  37. Hu J, Zhang X, Liu X, Chen C, Sun B. Mechanism of Reduced Vancomycin Susceptibility Conferred by walK Mutation in Community-Acquired Methicillin-Resistant Staphylococcus aureus Strain MW2. Antimicrob Agents Chemother. 2015;59(2):1352–5.View ArticlePubMedGoogle Scholar

Copyright

© Zhang et al.; licensee BioMed Central. 2015

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement

BMC Microbiology

ISSN: 1471-2180

Contact us