Skip to main content

Advertisement

Table 3 Primers used in this study

From: Identification of RNAIII-binding proteins in Staphylococcus aureus using tethered RNAs and streptavidin aptamers based pull-down assay

Primer name Sequence
tRSA-f GCCGCCAGTGTGCTGGAATT
tRSA-r-EcoRI-BamHI GCGGGATCCGATATCTGCAGAATTC
Vitro-RNAIII-f-EcoRI GCG GAATTC AGATCACAGAGATGTGAT
Vitro-RNAIII-r-BamHI GCG GGATCC AAGGCCGCGAGCTTGGGA
RNase III-f-BamHI TAAAGGATCTCTAAACAAAAGAAAAGTGAGATAGTTAATC
RNase III-r-SmaI TACCCCCGGGTTTAATTTGTTTTAATTGCTTATAGGCACTTTTAG
Hu-r-XhoI CCG CTCGAG TTTTACAGCATCTTTTA
Hu-f-NcoI CATG CCATGG GC AACAAAACAGATTT
FtsZ-f-NdeI CGCCATATGTTAGAATTTGAAC
FtsZ-r-XhoI CCGCTCGAGACGTCTTGTTCTTC
Era-f-Nde I CCCATATGACAGAACATAAATCAGG
Era-r-Xho I CCGCTCGAGTTAATCTTGGTCTTCAAC
Pyk-f-BamHI CGCGGATCCATGAGAAAAACTAAAATTGT
Pyk-r-xhoI GTTCTCGAGTTATAGTACGTTTGCATATCCTTC
WalR-f-NcoI CCACCATGGCTAGAAAAGTTGTTGTAGTTG
WalR-r-XhoI CTCCTCGAGCTCATGTTGTTGGAGGAAATATCCA
RNase J2-f-BamHI CGCGGATCCATGAATAGTGAGTTTATATATGGACGGGTAACAAATTTAGG
RNase J2-r-XhoI CCGCTCGAGTTAAATTTCAGAAATTACTGGAATAATCATAGGACGACG
CshA-f-BamHI GGATCCATGCAAAATTTTAAAGAACTAGGGATTTCG
CshA-r-XhoI CTCGAGTTTTTGATGGTCAGCAAATGTGCG
PNPase-f-BamHI GAAGGATCCATGTCTCAAGAAAAGAAAGTTTTTAAAAC
PNPase-r-XhoI GAACTCGAGTTCTTCTAATGCTCTGTGTGATGC
PfkA-f-BamHI GCCGGATCCATGAAGAAAATTGCAGTTTTAACTAGTGGT
PfkA-r-XhoI CCCCTCGAGTATAGATAACTTGTTAGCAAGTTCATAT
Enolase-f-BamHI GAAGGATCCATGCCAATTATTACAGATGTTTACGC
Enolase-r-XhoI GAACTCGAGTTTATCTAAGTTATAGAATGATTTGATACCG