Open Access

Gene expression changes in Porphyromonas gingivalis W83 after inoculation in rat oral cavity

  • Jian Zhao1,
  • Qian Li1,
  • Chun-Ling Pan1,
  • Jun-Chao Liu1,
  • Hong-Yan Wang1,
  • Li-Si Tan1 and
  • Ya-Ping Pan1Email author
BMC Microbiology201515:111

https://doi.org/10.1186/s12866-015-0438-0

Received: 2 January 2015

Accepted: 5 May 2015

Published: 24 May 2015

Abstract

Background

The development of chronic periodontitis was due to not only periodontal pathogens, but also the interaction between periodontal pathogens and host. The aim of this study is to investigate the alterations in gene expression in Porphyromonas gingivalis (P.gingivalis) W83 after inoculation in rat oral cavity.

Results

P.gingivalis W83 inoculation in rat oral cavity caused inflammatory responses in gingival tissues and destroyed host alveolar bone. Microarray analysis revealed that 42 genes were upregulated, and 22 genes were downregulated in the detected 1786 genes in the inoculated P.gingivalis W83. Real-time quantitative PCR detection confirmed the expression alterations in some selected genes. Products of these upregulated and downregulated genes are mainly related to transposon functions, cell transmembrane transportation, protein and nucleic acid metabolism, energy metabolism, cell division and bacterial pathogenicity.

Conclusions

P.gingivalis W83 has a pathogenic effect on host oral cavity. Meanwhile, inflammatory oral environment alters P.gingivalis W83 gene expression profile. These changes in gene expression may limit the proliferation and weaken the pathogenicity of P.gingivalis W83, and favor themselves to adapt local environment for survival.

Keywords

Porphyromonas gingivalis Periodontitis Microarray Gene expression

Background

Periodontitis is a chronic inflammatory disorder mediated by host and bacteria interactions and manifested by damage to the periodontal tissues that may progress to tooth loss. The host inflammatory responses stimulated by periodontal pathogens intend to eliminate the invaded bacteria and attribute to the destruction of tooth supporting tissues and tooth loss [1]. Moreover, the local periodontal environment may change the gene expression profile of periodontal pathogens [24]. To a certain extent, the variation of bacterial gene expression may alter the pathogenic ability of bacteria.

Porphyromonas gingivalis (P.gingivalis) is an opportunistic pathogen of the oral mucosa and a prominent member of the oral biofilms. It is well known that P.gingivalis is implicated in the onset and progression of chronic periodontitis. P.gingivalis can induce immune cells to secrete cytokines when they invade into hosts. These cytokines are present in inflamed gingiva and aggravate the destruction of oral gingival tissues and alveolar bone [5]. In the meantime, the expression of P.gingivalis genes varies under different conditions, such as iron or hemin [6,7], polyphosphate [8], rhein [9]. P.gingivalis may up-regulate or downregulate gene expression to adapt environment and survive [10].

The development of chronic periodontitis was not only due to periodontal pathogens, but also the interaction between periodontal pathogens and host. Most researches focus on periodontal pathogens acting on hosts, but ignore the action of host on P.gingivalis. Actually, the changes in P.gingivalis gene expression may affect the progression of chronic periodontitis. In the present study, the differential gene expression in P.gingivalis W83 inoculated in rat oral cavity and wild strain was analyzed.

Methods

Ethical statement

All rats were manipulated in accordance with Animal Research Reporting In Vivo Experiments (ARRIVE) guidelines. The experimental protocols were approved by the ethical committee of China Medical University.

Bacteria and animals

This study was carried out with 6-week-old SPF rats (180 − 220 g) provided by Department of Experimental Animals, China Medical University, and maintained in a temperature-controlled room (23 ± 1 °C). P.gingivalis W83 was obtained from the American Type Culture Collection (ATCC) and grown anaerobically (10 % CO2, 10 % H2, 80 % N2) in enriched brain-heart infusion (BHI) broth containing 5 % fiber-free sheep blood, 1 % vitamin K and hemin, at 37 °C.

P.gingivalis W83 inoculation

12 Rats were given azithromycin (10 mg/500 ml) ad libitum for 4 days to reduce the original oral flora. This was followed by a 7-day antibiotic-free period. 6 Rats were then orally challenged with P. gingivalis W83 (1 × 109 CFU) by gavage into the esophagus and oral cavity five times every other day [11]. The other 6 rats (control group) were only challenged with BHI broth. All 12 rats received steel wire ligature in cervical part in two sides of first molars and an 8-week high sugar feeding.

Alveolar bone loss analysis

Horizontal bone loss was assessed morphometrically by measuring the distance between the cement − enamel junction and the alveolar bone crest of the first, the second and the third molar. The alveolar bone destruction was detected by morphological and macroscopic observation, radiographic (PLANMECA, Finland) and stereomicroscope (SZX12, Olympus, Japan) fitted with a DIGIMED Viewer imaging measurement system evaluation at 6 sites per molars. Alveolar bone loss of every molar was presented in the figures as mean ± SD. Independent samples t-test was used to calculate the significance among the groups (SPSS Inc., Chicago, IL, USA). P-value < 0.05 was considered statistically significant.

Isolating culture and acquiring plaque

After P.gingivalis W83 inoculation in rat oral cavity for 8 weeks, plaques were acquired from periodontal pockets of first molar using toothpicks and put into 0.5 ml transfer tube. The plaques were dispersed by oscillator. 100 μl ten-fold serial dilutions were inoculated on BHI culture medium anaerobically at 37 °C for 5–7 days. The morphology of colonies was observed in primary cultures. P.gingivalisW83 colonies were identified by their black pigmentation, gram staining and PCR. The single clone was purified in BHI medium for subcultures in order to detect the differences in the gene of P.gingivalisW83.

Microarray hybridization

3 samples were picked up from wild strain P.gingivalis W83 and inoculated P.gingivalis W83, respectively. The total RNA was extracted and labeled with Klenow, and then hybridism with P.gingivalis W83 chip. The commercial GeneChip P.gingivalis W83 Genome Array used here was provided by CapitalBio Corporation (http://www.capitalbio.com/, Beijing, China), a service provider authorized by Roche NimbleGen (Wisconsin, USA). Array hybridization, washing, scanning and data analysis were performed at the CapitalBio Corporation, Beijing, China and carried out according to the NimbleGen’s Expression user’s guide.

Real-time quantitative PCR

To independently confirm the expression data generated by the microarray experiments, we performed real-time quantitative PCR analyses for 14 genes differentially regulated. Total RNA was extracted. Quality and concentration of the RNA were determined by measuring its absorbance at 260 and 280 nm using a microplate reader (M-200, Tecan, Switzerland). Total bacterial RNA was subsequently reverse-transcribed using the M-MLV RTase cDNA Synthesis Kit (Takara, China) following the manufacturer’s protocol. Real-time quantitative PCR analysis was conducted in an ABI Prism 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) in combination with the SYBR® Premix Ex TaqTM II PCR Master Mix Reagents Kit (Takara), as recommended by the manufacturer of the Wall Clear PCR Strip Tubes (Axygen, USA). The primers for the real-time quantitative PCR analysis were designed using Primer3 (http://bioinfo.ut.ee/primer3/) (Table 1). P.gingivalis W83 16 s DNA was used as the internal reference. Real-time quantitative PCR was performed three times for each sample. The data were analyzed according to relative gene expression by the 2-ΔΔCt method.
Table 1

Sequences for real-time PCR

Gene

Sequence(5’-3’)

PCR product (bp)

PG1005

F: CGGTGAGGTTTACAGAAGAA

79

 

R: AGGGAGGTGTAAGTCACG

 

PG1006

F: GGAATGGAGCGAAAGACC

169

 

R: CCAACAAGCAGAACCGAC

 

PG1007

F: TCTGTTTGTTTGTCCCATTC

62

 

R: TATGGCTCCTCAAAGTAGAG

 

PG1008

F: TTACAACAGCGGCTACCA

103

 

R: TATCCACTGCCACAGCCT

 

PG1009

F: AAGCGTGCTACCATTGCG

78

 

R: TCAGGCTATACCCGTTCT

 

PG1010

F: TCTGTCCCTGCGATACCT

99

 

R: CACTCATCCTCCCTATCTTTC

 

PG0874

F: AGGGTGTCTGAGCAAGTA

73

 

R: TGGAGGAATCGAAGATAGAA

 

PG1513

F: GAAACGGCTCAAGTCATA

114

 

R: TCCCTCCTCCATTTCCAC

 

PG0684

F: GAATACGGAGGTCAATCGC

90

 

R: GAACGCTGAGAAGGAGGC

 

PG0682

F: CGGTGAGTTCTATTATTGCG

123

 

R: CAGCACCAGGCATGACCA

 

PG1975

F: CGTGACGGGCATAAGACA

134

 

R: AGTGAGTCGTGGGTTTAC

 

PG1982

F: GTAATACCGAGGAAACTGAA

60

 

R: GTGTTTCAGGGATAAGTCG

 

PG2008

F: CTGCGGTTTCAACCAAGT

115

 

R: ATACCGAACCTCGTCTAC

 

PG0001

F: AGGTGGTCATGTTCCTCTCC

78

 

R: TGACTACCCTCCTGCATTGG

 

Statistics

Significantly differentially expressed genes between the inoculated periodontitis and wild strains were identified using two class unpaired method in the Significant Analysis of Microarray software (SAM, version 3.02). Genes were determined to be significantly differentially expressed with a selection threshold of false discovery rate, FDR < 5 % and fold change > 2.0 in the SAM output result.

Results

Pathogenic effects of P.gingivalis W83 on rat oral cavity

After P.gingivalis W83 inoculation in rat oral cavity for 8 weeks, the gingival tissues were inflammatory and bleeding (Fig. 1A). Severe alveolar bone losses were found in rats with P.gingivalis W83 inoculation (Fig. 1B). The distance between cementoenamel junction and alveolar bone crest (CEJ: ABC) was measured at proximal, middle and distal sites of buccal and palatal per molar, respectively. In first molars, second molars, third molars, the distances were significantly increased, which were 1216.00 ± 305.98 μm, 987.28 ± 238.14 μm, 725.11 ± 202.71 μm, compared with normal rats, which were 414.89 ± 209.67 μm, 300.44 ± 127.92 μm, 357.56 ± 281.06 μm.
Fig. 1

Pathogenic effects of P.gingivalis W83 on rat oral cavity. (A) The gingival tissues were inflammatory and bleeding after P.gingivalis W83 inoculation in rat oral cavity for 8 weeks. (B) Severe alveolar bone losses were found in rats with P.gingivalis W83 inoculation. Left: control groups. Right: rats inoculated with P.gingivalis W83 intraorally for 8 weeks

Identification of the inoculated P.gingivalis W83 in rat with periodontitis

Suspicious gram-negative bacilli were taken from plaque culture. After pure subculture, gram staining and polymerase chain reaction (PCR) proved that the bacteria were P.gingivalis W83. PCR fragment length of the product was 857 bp, as shown in Fig. 2.
Fig. 2

Isolation and identification of inoculated P.gingivalis W83. (A) Some suspicious black colonies were found from plaque mixture. (B) Suspious black colonies were pure cultured. (C) Gram staining proved the pure culture as gram-negative brevibacterium (×400). (D) Agarose gel electrophoresis proved that PCR fragment length was 857 bp. 1 and 2: Wild type P.gingivalis W83; 3–8: three inoculated P.gingivalis W83 samples for microarray analysis (two columns for each sample)

Genes upregulated in the inoculated P.gingivalis W83

We determined the expression of 1786 genes by microarray analysis in P.gingivalis wild strain and P.gingivalis inoculated in oral cavity. The complete list of gene expression values has been deposited in NCBI’s Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE67608). The detection showed that 42 genes were up-regulated in the inoculated P.gingivalis W83 compared with wild strain (Table 2) (Fig. 3). In these upregulated genes, 30 expressed hypothetical proteins. Among other 12 genes, PG0874, PG0009, PG0427, PG0942 and PG0590 function as transposons. PG0009, PG0427, PG0942 and PG0590 encode ISPg5 transposases; and PG0874 encodes an int protein as a mobilizable transposon.
Table 2

Genes upregulated in the inoculated P.gingivalis W83

Locus no.

Putative identificationα

Cellular roleα

Fold

PG0102

hypothetical protein

 

3.7076

PG2116

hypothetical protein

 

3.6850

PG1007

GntR family transcriptional regulator

Regulatory functions: DNA interactions

3.6786

PG0265

hypothetical protein

 

3.3714

PG1008

hypothetical protein

 

3.3338

PG1510

hypothetical protein

 

3.0890

PG1009

hypothetical protein

 

3.0258

PG1655

hypothetical protein

 

2.8935

PG0132

hypothetical protein

 

2.7298

PG2114

hypothetical protein

 

2.6986

PG2064

hypothetical protein

 

2.5952

PG1010

ABC transporter, ATP-binding protein

Transport and binding proteins: Unknown substrate

2.4885

PG0542

hypothetical protein

 

2.4794

PG1005

putative lipoprotein

Cell envelope

2.4686

PG1514

glycerol dehydrogenase-related protein

Unknown function: General

2.4537

PG0844

hypothetical protein

 

2.4324

PG0874

mobilizable transposon, int protein

Mobile and extrachromosomal element functions: Transposon functions

2.4307

PG0507

hypothetical protein

 

2.4290

PG1357

hypothetical protein

 

2.3151

PG1410

hypothetical protein

 

2.3094

PG0617

hypothetical protein

 

2.2814

PG0855

hypothetical protein

 

2.2153

PG0009

ISPg5, transposase Orf1

Mobile and extrachromosomal element functions: Transposon functions

2.1609

PG0427

ISPg5, transposase Orf1

Mobile and extrachromosomal element functions: Transposon functions

2.1431

PG0942

ISPg5, transposase Orf1

Mobile and extrachromosomal element functions: Transposon functions

2.1424

PG0541

hypothetical protein

 

2.1291

PG1398

hypothetical protein

 

2.1216

PG1027

hypothetical protein

 

2.1204

PG0590

ISPg5, transposase Orf1

Mobile and extrachromosomal element functions: Transposon functions

2.1151

PG1006

hypothetical protein

 

2.1122

PG0340

hypothetical protein

 

2.1119

PG0256

CvpA family protein

Unknown function: General

2.1090

PG0749

hypothetical protein

 

2.0834

PG1662

hypothetical protein

 

2.0788

PG2220

hypothetical protein

 

2.0771

PG1871

hypothetical protein

 

2.0589

PG2187

1,4-dihydroxy-2-naphthoate octaprenyltransferase

Biosynthesis of cofactors, prosthetic groups, and carriers: Menaquinone and ubiquinone

2.0471

PG0410

hypothetical protein

 

2.0409

PG1233

hypothetical protein

 

2.0367

PG0325

hypothetical protein

 

2.0349

PG0409

hypothetical protein

 

2.0259

PG1513

phosphoribosyltransferase, putative/phosphoglycerate mutase family protein

Energy metabolism: Other

2.0032

αLocus number, identification and functional classification according to JCVI P.gingivalis genome database

Fig. 3

Genes analyzed by microarray in the inoculated P.gingivalis W83. Fluorescence signal strength values in X axes and Y axes represent control groups and experimental groups, respectively. Each data point was behalf of a gene chip hybridization signal. Red marking data points were T/C value ≥2, representing upregulated genes, and green marking data points were T/C value ≤0.5, representing downregulated genes

Genes downregulated in the inoculated P.gingivalis W83

Compared with wild strain, 22 genes were down-regulated in the inoculated strain (Table 3) (Fig. 3). Among these genes, PG0682, PG0683, PG0684, PG0282 and PG0946 encode ABC transporters. Products of PG0682, PG0683 and PG0684 are putative permease proteins; and products of PG0282 and PG0946 are ATP-binding proteins. In addition, PG2008 and PG0283 also encode transport and binding proteins. All these proteins are involved in cell transmembrane transportation. Some downregulated genes encode proteins related to protein and nucleic acid metabolism, including PG1129, PG1993, PG0001 and PG0522. Products of other genes are related to energy metabolism (PG1042), cell division (PG0141),bacterial pathogenicity (PG1975), and so on.
Table 3

Genes downregulated in the inoculated P.gingivalis W83

Locus no.

Putative identificationα

Cellular roleα

Fold

PG2008

TonB-dependent receptor, putative

Transport and binding proteins: Cations and iron carrying compounds

0.2234

PG0929

hypothetical protein

 

0.2806

PG1129

ribonucleotide reductase

Purines, pyrimidines, nucleosides, and nucleotides: 2'-Deoxyribonucleotide metabolism

0.2862

PG0684

ABC transporter, permease protein, putative

Transport and binding proteins: Unknown substrate

0.3594

PG0683

ABC transporter, permease protein, putative

Transport and binding proteins: Unknown substrate

0.3848

PG0682

ABC transporter, permease protein, putative

Transport and binding proteins: Unknown substrate

0.3938

PG0522

tRNA delta(2)-isopentenylpyrophosphate transferase

Protein synthesis: tRNA and rRNA base modification

0.4190

PG1648

RelA/SpoT family protein

Cellular processes: Adaptations to atypical conditions

0.4192

PG0282

ABC transporter, ATP-binding protein

Transport and binding proteins: Unknown substrate

0.4303

PG0946

ABC transporter, ATP-binding protein

Transport and binding proteins: Unknown substrate

0.4347

PG1042

glycogen synthase, putative

Energy metabolism: Biosynthesis and degradation of polysaccharides

0.4485

PG0890

alkaline phosphatase, putative

Central intermediary metabolism: Other

0.4552

PG1100

hypothetical protein

 

0.4813

PG1993

excinuclease ABC subunit C

DNA metabolism: DNA replication, recombination, and repair

0.4814

PG0226

transglutaminase-related protein

Unknown function: General

0.4823

PG0141

spoOJ protein

Cellular processes: Cell division

0.4865

PG0144

hypothetical protein

 

0.4888

PG1975

hemagglutinin protein HagC

Cellular processes: Pathogenesis

0.4941

PG1982

CRISPR-associated Cas1 family protein

Mobile and extrachromosomal element functions: Other

0.4950

PG1718

hypothetical protein

 

0.4955

PG0283

RND family efflux transporter MFP subunit

Transport and binding proteins: Unknown substrate

0.4965

PG0001

chromosomal replication initiation protein

DNA metabolism: DNA replication, recombination, and repair

0.4984

αLocus number, identification and functional classification according to JCVI P.gingivalis genome database

Microarray result confirmation by real-time quantitative PCR

Among the upregulated and downregulated genes, we picked up 14 genes to detect the expression by real-time quantitative PCR. Consistent with microarray hybridization, real-time quantitative PCR detection showed similar expression trends in these genes (Table 4).
Table 4

Microarray result confirmation by real-time PCR

Gene

Fold increase measured by

 

Microarray analysis

Real-time PCR

PG1005

2.47↑

12.24 ± 2.12↑

PG1006

2.11↑

11.57 ± 1.06↑

PG1007

3.68↑

24.67 ± 3.67↑

PG1008

3.33↑

28.99 ± 4.56↑

PG1009

3.03↑

27.56 ± 2.66↑

PG1010

2.49↑

19.88 ± 3.41↑

PG0874

2.43↑

18.58 ± 2.08↑

PG1513

2.00↑

15.86 ± 2.12↑

PG0684

0.36↓

0.036 ± 0.004↓

PG0682

0.39↓

0.047 ± 0.005↓

PG1975

0.49↓

0.067 ± 0.011↓

PG1982

0.49↓

0.058 ± 0.007↓

PG2008

0.22↓

0.011 ± 0.002↓

PG0001

0.50↓

0.068 ± 0.008↓

16sRNA

-

1

Discussion

Chronic periodontitis is initiated by periodontal pathogens, including P.gingivalis. Our study showed that P.gingivalis W83 induced rat gingival tissue inflammation, and alveolar bone loss, which is the key feature of periodontitis. Therefore, our study demonstrates that P.gingivalis W83 has pathogenic effects on rat oral cavity. After inoculation in rat oral cavity for 8 weeks, P.gingivalis W83 were isolated, and analyzed by microarray. In the detected 1786 genes, 42 genes were upregulated, whereas 22 genes were downregulated, indicating that the local periodontal environment can change the gene expression profile of P.gingivalis W83.

In the 42 upregulated genes, 30 expressed hypothetical proteins. Among other 12 genes, PG0874, PG0009, PG0427, PG0942 and PG0590 are in the same class in JCVI cell function classification. They all function as mobile extrachromosomal factor: transposon. Transposon is a removable genome DNA sequence, which can “jump” in genome from one location to another through the process of cutting and integration. Transposition is generally known to be triggered by cellular stress [1214], therefore upregulation of these transposons suggests that P.gingivalis W83 inoculated in rat oral cavity may adapt local environment for its own survival, which is consistent with some other studies [15,16].

In the 22 downregulated genes, 7 genes encode transport and binding proteins. All these proteins are involved in cell transmembrane transportation. They can transport many substrates, such as metabolites, ion, sugar, amino acids, lipids, cholesterol and drugs [17]. PG2008 encodes a TonB dependent receptor protein, responsible for iron transmembrane transportation [18]. As iron ion is necessary for the breeding and spreading of P.gingivalis W83, downregulation of PG2008 suggests the subdued iron transferring and proliferation of P.gingivalis W83. There are 4 downregulated genes encoding proteins related to nucleic acid and protein metabolism. PG1129 encodes a nucleotide reductase, which is related to purine, pyrimidine, nucleotide and DNA metabolism, and plays a regulating role in cell proliferation. Products of PG1993 and PG0001 are related to the metabolism of DNA, such as copy, restructuring and repair. Therefore, downregulation of these genes means that the proliferation of inoculated P.gingivalis W83 is in certain obstacles.

PG1042 encodes a putative glycogen synthase, involved in biosynthesis and degradation of polysaccharides. Downregulation of PG1042 suggests a disturbed energy metabolism. PG0141 encodes a spoOJ protein related to cell division, and PG1975 encodes hemagglutinin HagC related to pathogenicity of P.gingivalis W83. In addition, PG1982 encodes a CRISPR protein related to CAS1 family. CRISPR/CAS system can protect bacteria against the encroachment by phage, and resist other chromosome genetic material and prevent from the expression of their genes [1921]. Downregulation of PG1982 suggests a decrease in the defense capability of P.gingivalis W83.

It should be noted that gene expression observed in this study was in mRNA level. As we have known, alterations in mRNA expression are not always consistent with those in protein expression. Therefore, observations in protein level of gene expression will be more convincing. However, it is impracticable to analyze the protein expression of all 64 genes with RNA expression alteration. Moreover, some products of these genes are still hypothetical proteins. Because the inoculated P.gingivalis was cultured outside the rat oral cavity for some days before RNA extraction, the RNA samples cannot exactly reflect the changes in gene expression after inoculation, although the results can still indicate which genes are upregulated or downregulated.

Conclusions

Our study shows that P.gingivalis W83 has pathogenic effects on host, and local inflammatory oral environment alters the gene expression profile of P.gingivalis W83. Products of these upregulated and downregulated genes are mainly related to transposon functions, cell transmembrane transportation, protein and nucleic acid metabolism, energy metabolism, cell division and bacterial pathogenicity. These changes may lead to decreased proliferation and pathogenicity of P.gingivalis W83, and favor themselves to adapt local environment for survival.

Abbreviations

P.gingivalis: 

Porphyromonas gingivalis

PCR: 

Polymerase chain reaction

SPF: 

Specific pathogen free

ATCC: 

American Type Culture Collection

CFU: 

Colony forming unit

CEJ: 

Cementoenamel junction

ABC: 

Alveolar bone crest

CRISPR: 

Clustered Regularly Interspaced Short Palindromic Repeats

CAS: 

CRISPR associated genes

Declarations

Acknowledgments

This work was supported by National Natural Science Foundation of China (No. 81271153).

Authors’ Affiliations

(1)
Department of Periodontology, School of Stomatology, China Medical University

References

  1. Williams RC. Periodontal disease. N Engl J Med. 1990;322(6):373–82.View ArticlePubMedGoogle Scholar
  2. Aruni AW, Zhang K, Dou Y, Fletcher H. Proteome analysis of coinfection of epithelial cells with Filifactor alocis and Porphyromonas gingivalis shows modulation of pathogen and host regulatory pathways. Infect Immun. 2014;82(8):3261–74.View ArticlePubMed CentralPubMedGoogle Scholar
  3. Nissen L, Sgorbati B, Biavati B, Belibasakis GN. Lactobacillus salivarius and L. gasseri down-regulate Aggregatibacter actinomycetemcomitans exotoxins expression. Ann Microbiol. 2014;64:611–7.View ArticlePubMed CentralPubMedGoogle Scholar
  4. Kerr JE, Abramian JR, Dao DH, Rigney TW, Fritz J, Pham T, et al. Genetic exchange of fimbrial alleles exemplifies the adaptive virulence strategy of Porphyromonas gingivalis. PLoS One. 2014;9(3), e91696.View ArticlePubMed CentralPubMedGoogle Scholar
  5. Baker PJ. The role of immune responses in bone loss during periodontal disease. Microbes Infect. 2000;2(10):1181–92.View ArticlePubMedGoogle Scholar
  6. Anaya-Bergman C, Rosato A, Lewis JP. Iron- and hemin-dependent gene expression of Porphyromonas gingivalis. Mol Oral Microbiol. 2015;30(1):39–61.View ArticlePubMedGoogle Scholar
  7. Phillips P, Progulske-Fox A, Grieshaber S, Grieshaber N. Expression of Porphyromonas gingivalis small RNA in response to hemin availability identified using microarray and RNA-seq analysis. FEMS Microbiol Lett. 2014;351(2):202–8.View ArticlePubMed CentralPubMedGoogle Scholar
  8. Moon JH, Lee JH, Lee JY. Microarray analysis of the transcriptional responses of Porphyromonas gingivalis to polyphosphate. BMC Microbiol. 2014;14:218.View ArticlePubMed CentralPubMedGoogle Scholar
  9. Azelmat J, Larente JF, Grenier D. The anthraquinone rhein exhibits synergistic antibacterial activity in association with metronidazole or natural compounds and attenuates virulence gene expression in Porphyromonas gingivalis. Arch Oral Biol. 2015;60(2):342–6.View ArticlePubMedGoogle Scholar
  10. Yoshimura M, Ohara N, Kondo Y, Shoji M, Okano S, Nakano Y, et al. Proteome analysis of Porphyromonas gingivalis cells placed in a subcutaneous chamber of mice. Oral Microbiol Immunol. 2008;23(5):413–8.View ArticlePubMedGoogle Scholar
  11. Baker PJ, Dixon M, Roopenian DC. Genetic control of susceptibility to Porphyromonas gingivalis-induced alveolar bone loss in mice. Infect Immun. 2000;68(10):5864–8.View ArticlePubMed CentralPubMedGoogle Scholar
  12. Zhang Z, Saier Jr MH. Transposon-mediated adaptive and directed mutations and their potential evolutionary benefits. J Mol Microbiol Biotechnol. 2011;21(1–2):59–70.View ArticlePubMedGoogle Scholar
  13. Wheeler BS. Small RNAs, big impact: small RNA pathways in transposon control and their effect on the host stress response. Chromosome Res. 2013;21(6–7):587–600.View ArticlePubMedGoogle Scholar
  14. Arnault C, Dufournel I. Genome and stresses: reactions against aggressions, behavior of transposable elements. Genetica. 1994;93(1–3):149–60.View ArticlePubMedGoogle Scholar
  15. Hendrickson EL, Xia Q, Wang T, Lamont RJ, Hackett M. Pathway analysis for intracellular Porphyromonas gingivalis using a strain ATCC 33277 specific database. BMC Microbiol. 2009;9:185.View ArticlePubMed CentralPubMedGoogle Scholar
  16. Xia Q, Wang T, Taub F, Park Y, Capestany CA, Lamont RJ, et al. Quantitative proteomics of intracellular Porphyromonas gingivalis. Proteomics. 2007;7(23):4323–237.View ArticlePubMed CentralPubMedGoogle Scholar
  17. Park Y, Yilmaz O, Jung IY, Lamont RJ. Identification of Porphyromonas gingivalis genes specifically expressed in human gingival epithelial cells by using differential display reverse transcription-PCR. Infect Immun. 2004;72(7):3752–8.View ArticlePubMed CentralPubMedGoogle Scholar
  18. Létoffé S, Delepelaire P, Wandersman C. Free and hemophore-bound heme acquisitions through the outer membrane receptor HasR have different requirements for the TonB-ExbB-ExbD complex. J Bacteriol. 2004;186(13):4067–74.View ArticlePubMed CentralPubMedGoogle Scholar
  19. Pourcel C, Salvignol G, Vergnaud G. CRISPR elements in Yersinia pestis acquire new repeats by preferential uptake of bacteriophage DNA, and provide additional tools for evolutionary studies. Microbiology. 2005;151(Pt 3):653–63.View ArticlePubMedGoogle Scholar
  20. Haft DH, Selengut J, Mongodin EF, Nelson KE. A guild of 45 CRISPR-associated (Cas) protein families and multiple CRISPR/Cas subtypes exist in prokaryotic genomes. PLoS Comput Biol. 2005;1(6), e60.View ArticlePubMed CentralPubMedGoogle Scholar
  21. Grissa I, Vergnaud G, Pourcel C. The CRISPRdb database and tools to display CRISPRs and to generate dictionaries of spacers and repeats. BMC Bioinformatics. 2007;8:172.View ArticlePubMed CentralPubMedGoogle Scholar

Copyright

© Zhao et al.; licensee BioMed Central. 2015

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement