Skip to main content

Advertisement

Table 1 Sequences for real-time PCR

From: Gene expression changes in Porphyromonas gingivalis W83 after inoculation in rat oral cavity

Gene Sequence(5’-3’) PCR product (bp)
PG1005 F: CGGTGAGGTTTACAGAAGAA 79
  R: AGGGAGGTGTAAGTCACG  
PG1006 F: GGAATGGAGCGAAAGACC 169
  R: CCAACAAGCAGAACCGAC  
PG1007 F: TCTGTTTGTTTGTCCCATTC 62
  R: TATGGCTCCTCAAAGTAGAG  
PG1008 F: TTACAACAGCGGCTACCA 103
  R: TATCCACTGCCACAGCCT  
PG1009 F: AAGCGTGCTACCATTGCG 78
  R: TCAGGCTATACCCGTTCT  
PG1010 F: TCTGTCCCTGCGATACCT 99
  R: CACTCATCCTCCCTATCTTTC  
PG0874 F: AGGGTGTCTGAGCAAGTA 73
  R: TGGAGGAATCGAAGATAGAA  
PG1513 F: GAAACGGCTCAAGTCATA 114
  R: TCCCTCCTCCATTTCCAC  
PG0684 F: GAATACGGAGGTCAATCGC 90
  R: GAACGCTGAGAAGGAGGC  
PG0682 F: CGGTGAGTTCTATTATTGCG 123
  R: CAGCACCAGGCATGACCA  
PG1975 F: CGTGACGGGCATAAGACA 134
  R: AGTGAGTCGTGGGTTTAC  
PG1982 F: GTAATACCGAGGAAACTGAA 60
  R: GTGTTTCAGGGATAAGTCG  
PG2008 F: CTGCGGTTTCAACCAAGT 115
  R: ATACCGAACCTCGTCTAC  
PG0001 F: AGGTGGTCATGTTCCTCTCC 78
  R: TGACTACCCTCCTGCATTGG