Skip to content

Advertisement

You're viewing the new version of our site. Please leave us feedback.

Learn more

BMC Microbiology

Open Access

Mutational and transcriptional analyses of an avian pathogenic Escherichia coli ColV plasmid

Contributed equally
BMC Microbiology20088:24

https://doi.org/10.1186/1471-2180-8-24

Received: 16 July 2007

Accepted: 29 January 2008

Published: 29 January 2008

Abstract

Background

Previously we described a 184-kb ColV plasmid, pAPEC-O2-ColV, that contributed to the ability of an E. coli to kill avian embryos, grow in human urine, and colonize the murine kidney. Here, the roles of several genes encoded by this plasmid in virulence were assessed using mutational and transcriptional analyses.

Methods

Genes chosen for deletion were iss, tsh, iutA, iroN, sitA, and cvaB. In addition, a 35-kb region of the plasmid, containing iss, tsh, and the ColV and iro operons, along with a 15-kb region containing both the aerobactin and sit operons, were deleted. Mutants were compared to the wild-type (APEC O2) for lethality to chick embryos and growth in human urine. Expression of the targeted genes was also assessed under these same conditions using RT-PCR

Results

No significant differences between the mutants and the wild-type in these phenotypic traits were detected. However, genes encoding known or predicted iron transport systems were up-regulated during growth in human urine, as compared to growth in LB broth, while iss, hlyF, and iroN were strongly up-regulated in chick embryos.

Conclusion

While no difference was observed between the mutant strains and their wild-type parent in the phenotypic traits assayed, we reasoned that some compensatory virulence mechanism, insensitivity of the virulence assays, or other factor could have obscured changes in the virulence of the mutants. Indeed we found several of these genes to be up-regulated in human urine and/or in the chick embryo, suggesting that certain genes linked to ColV plasmids are involved in the establishment of avian extraintestinal infection.

Background

A 184-kb ColV plasmid, known as pAPEC-O2-ColV, was sequenced and analyzed [1]. In addition to regions devoted to plasmid transfer, maintenance, and replication, pAPEC-O2-ColV was found to contain a 94-kb putative pathogenicity island (PAI), containing hlyF, ompT, iss, tsh, the ColV operon, and several genes encoding known or predicted iron transport systems. The iron-related systems included those encoding aerobactin and salmochelin, and the sit ABC transport system. Additionally, pAPEC-O2-ColV contained a putative iron transport system novel to APEC called eit and another putative ABC transport system known as ets. This plasmid was transmissible by conjugation from the donor, avian pathogenic Escherichia coli (APEC) O2, to recipient strains, and it was found to co-transfer with a large R plasmid known as pAPEC-O2-R [2]. When the role of APEC O2's plasmids in virulence was investigated, it was found that acquisition of these plasmids resulted in an enhancement in the recipient's ability to kill avian embryos, grow in human urine, and colonize the murine kidney [3]. It was thought that the increase in virulence was likely due to acquisition of pAPEC-O2-ColV [3].

Also, a study of the distribution of genes of pAPEC-O2-ColV's putative PAI in APEC and avian fecal commensal E. coli (AFEC) isolates revealed that a portion of this PAI was highly conserved among APEC and that these conserved genes occurred much more often in APEC than in commensal strains [4, 5]. This conserved portion, which occurred in most of the APEC examined, included sit, an iron/manganese transport system [6, 7]; salmochelin and aerobactin, both siderophore iron acquisition systems [8, 9]; ets, a putative ABC transport system [1]; hlyF, an avian hemolysin [10]; iss, the increased serum survival gene [11]; ompT, an outer membrane protease [12]; the RepFIB replicon; and the 5' end of the ColV operon [1, 4]. The variable portion of this PAI contained the 5' end of the ColV operon; tsh, the temperature sensitive hemagglutinin gene [13, 14]; and the eit operon [1]. The split between conserved and variable portions occurred within the cvaB gene of the ColV operon, with the 5' end of cvaB and many of its upstream genes occurring significantly more often among APEC than the 3' end of cvaB and many of its downstream genes [1, 4]. Genes of these plasmid-linked PAIs occur widely among APEC isolated from different parts of the world [5, 1520] various avian host species [5, 15, 20] and different syndromes [5, 21]. These observations suggest that these plasmid-linked PAIs, especially their conserved portions, might be a defining characteristic of the APEC pathotype [5] that could be exploited in colibacillosis control. Indeed, protocols for rapid characterization of APEC based on detection of certain virulence genes, including some from this cluster, show promise [22, 23].

While the data from these epidemiological studies are useful at identifying genes of interest and have been widely used to characterize avian E. coli[5, 15, 22, 23], they are no substitute for an in-depth study of the contributions to virulence of individual genes. Such studies typically require comparisons of wild-type and mutant strains, differing in a single trait of interest, for their abilities to cause disease in animal models [24]. Here, we sought to determine the contributions of certain genes of pAPEC-O2-ColV's PAI to E. coli's ability to kill embryos and grow in human urine using mutational analysis. When differences in virulence between the mutants and the wild-type were not detected, follow-up studies to determine if these same genes are differentially expressed in APEC O2 during infection were undertaken.

Results and Discussion

Large conjugative ColV plasmids and the genes they carry are found in a much higher proportion of E. coli incriminated in cases of avian colibacillosis than in E. coli isolated from the feces of apparently healthy birds [5, 25]. In addition, it has been shown that ColV plasmids may mediate avian E. coli virulence and are often implicated in cases of human extraintestinal disease [3, 2628]. In a previous study we found that transfer of a large ColV plasmid, pAPEC-O2-ColV (along with a co-transferring R plasmid) conferred upon a recipient strain enhanced abilities to kill chick embryos, grow in human urine, and cause urinary tract infection (UTI) in mice [3]. In the present study, we sought to determine what regions of this ColV plasmid contributed to these traits.

To do this, we mutated several genes localized to pAPEC-O2-ColV. The genes chosen for mutagenesis, iss, tsh, cvaB, iutA, iroN, and sitA, have been found to be epidemiologically associated with APEC [1, 5]. In addition tsh and iroN, have been shown to contribute to the virulence of APEC [28, 29], while virulence of E. coli K-12 was shown to be enhanced after the acquisition of an iss encoding plasmid [11]. The expected mutations were verified by PCR protocols [30] targeting the deleted gene and the new kanamycin resistance (kanR) cassette junction fragment. To ensure that the mutants were truly isogenic, we examined the genotype of the mutant strains for over 40 other virulence associated genes and allelic variants using published protocols [5, 12, 23]. In no instance did we find a loss of a gene other than the one which was targeted. This observation suggests that the method of mutagenesis used in this study may have a higher fidelity than does suicide vector driven allelic exchange which has been found to produce secondary mutations at a high rate in extraintestinal pathogenic E. coli[31].

After confirming that our mutants were isogenic, their relative virulence, as compared to the wild type, was compared in two models, including those based on lethality to chick embryos and ability to grow in human urine. None of the mutants showed any attenuation in virulence as compared to the wild-type parent (Table 1), and none deviated from the wild-type pattern of growth in urine (Figure 1). Reasoning that the virulence of APEC is multifactorial [5, 32] and that the effects of single gene knock-outs might be obscured by some compensatory mechanism, we subsequently deleted two large regions of pAPEC-O2-ColV to create deletions of Vir1 and Vir2. Region Vir1 is about 33 kb in length and contains the iss and tsh genes along with ColV and iro operons, while region Vir2 is around 15 kb in length and contains the sit and aerobactin operons (Figure 2). Deletion of these two regions also caused no attenuation of APEC O2's virulence for chick embryos (Table 1).
Figure 1

Growth in urine of APEC O2 (the source of the pAPEC-O2-ColV) and its mutant derivatives. Growth curves were determined by measuring viable counts (CFU ml1) and reflect an average of two trials for each strain.

Figure 2

Genetic map of Vir1 and Vir2 regions of pAPEC-O2-ColV, drawn to scale with ruler in base pairs.

Table 1

Embryo Lethality of APEC O2 along with its Mutant Derivatives

Strain

Embryos Inoculated

Deaths

Embryo Lethality %

Z valueA

p-value

NC

41

1

2.4

6.60**

< 0.01A

APEC O2

41

30

73.2

-

-

APEC 02Δiss

41

29

70.7

0.25

0.81

APEC 02ΔiutA

41

28

68.3

0.49

0.63

APEC 02Δtsh

41

32

78.0

0.51

0.61

APEC 02ΔiroN

41

30

73.2

0.00

1.00

APEC 02ΔcvaB

41

29

70.7

0.25

0.81

APEC 02ΔsitA

41

29

70.7

0.25

0.81

APEC 02Δvir1

41

28

68.3

0.49

0.63

APEC 02Δvir2

41

29

70.7

0.25

0.81

A As compared to APEC O2.** p < 0.001, no other strains had a significantly different lethality rate than APEC O2

In view of these results, we considered the possibility that chromosomal genes found in APEC O2 may compensate for the function(s) of the lost plasmid genes. For example, many of the genes targeted for deletion in APEC O2 are associated with iron acquisition or complement resistance. Since APEC O2 is known to contain at least two other chromosomal operons (yersinabactin and enterobactin) involved in the acquisition of iron [1], overexpression of chromosomal iron acquisition loci might compensate for the loss of certain plasmid-linked iron acquisition operons. In addition, others have shown that transfer of a ColV plasmid into a K-12 recipient was accompanied by a concomitant increase in the K-12 strain's ability to resist the bactericidal effects of serum complement [33]. However, other studies have demonstrated that when a native host was cured of the ColV plasmid, its ability to survive in serum was not affected [28], suggesting that chromosomal loci may compensate for the lost plasmid genes which conferred complement resistance. Similarly, in our work we did not find any of the mutant derivatives of APEC O2 to be attenuated in their ability to resist complement or to grow under low iron conditions (data not shown).

To further investigate whether chromosomal genes found in APEC O2 were compensating for the deleted plasmid genes, we transferred the mutated pAPEC-O2-ColV derivatives generated above into the AFEC strain NC via conjugation. NC was previously used as a recipient for pAPEC-O2-ColV and was found to have enhanced abilities to kill chick embryos and grow in human urine upon receipt of the plasmids of APEC O2 [3]. The virulence of NC derivatives containing pAPEC-O2-ColV was then compared to that of NC with an intact version of pAPEC-O2-ColV (NC/pAPEC-O2). Again, no differences were found. Knowing that others have found that some of these same genes and regions, such as tsh[28] and the iro operon [29, 34], contribute to the virulence of other APEC, we then reasoned that our virulence assays might be too insensitive to detect subtle changes in virulence caused by the mutations. Indeed, bacterial virulence, as measured with the embryo lethality assay, has been shown to have only a moderate correlation to results of assays done in three-week old chickens [35]. In addition, we and others [36] have not observed a correlation between the infectious dose of a strain and its lethality to chick embryos which would permit comparisons of virulence based on LD50 determinations.

Therefore, in an effort to increase the sensitivity of our chick embryo model, we infected 16 day-old chick embryos (the age at which chick embryos are most resistant to E. coli infection [36]) via the chorioallantoic route with an equivalent mixture of wildtype and mutant strains (~500 CFUs of each). Three days after infection the surviving embryos (generally > 80% of those infected) were killed by chilling at -20 C for two hours, after which brains, hearts, and livers were collected sterilely. Organ homogenates were cultured quantitatively on agar with or without antibiotics to determine the relative proportions of the strains. The results of these mixed infection experiments partially mimicked our previous embryo lethality data [3]. Strain NC/pAPEC-O2 generally outcompeted strain NC, and no marked differences in organ colonization was seen with any of the mutant strains in relation to the APEC O2 (data not shown). However, we were able to recover E. coli from the internal of organs of only a very small (< 15%) proportion of the embryos. This is not entirely surprising as the systemic spread of E. coli is not thought to be required for embryo death [36], however it would indicate that mixed infections in 16 day-old chick embryos may have marginal utility in assessing E. coli virulence.

Subsequently, we opted to use qRT-PCR in an effort to better understand the nature of pAPEC-O2-ColV's role in APEC O2's growth in human urine and infection of the chick embryo. Here, the genes that had been targeted for mutation plus two additional genes, hlyF, encoding an avian hemolysin [10] and etsC, a putative ABC transport efflux gene [1], were studied. As compared to exponential growth in LB broth, several genes were up-regulated when grown in human urine or during infection of the chick embryo. In human urine, genes which were up-regulated included sitA, iutA, iroN, cvaC, and tsh, although sitA and tsh were not significantly up-regulated (Fig. 3). This was not surprising, as several of these genes have been shown to play a role in iron acquisition [6, 8, 9], and urine is considered to be an iron-depleted environment [24]. In the chick embryo, different patterns of up-regulation were observed. In general, pAPEC-O2-ColV's iron-related genes were not up-regulated in the embryo, suggesting that the embryo may be a relatively iron-rich environment. Indeed, it has been demonstrated that the percentage of iron in the chick embryo liver is much higher at twelve days of incubation than at hatching [37]. Interestingly, iss and hlyF were strongly up-regulated (both at approximately 29-fold). iss has been shown to play a role in serum resistance and increased lethality towards day-old chicks [38], while hlyF has been shown to exhibit hemolysin activity [10]. Such results suggest that serum resistance and hemolysin production might be important to APEC O2's infection of chick embryos. Also, iroN was up-regulated approximately 15-fold. iroN has previously been found to play a dual role in E. coli's virulence, serving both as a siderophore receptor and as a virulence factor during urinary tract infection [34]. So too, the results here suggest a possible dual role for iroN during avian systemic infection.
Figure 3

RT-PCR results comparing expression of pAPEC-O2-ColV genes during differential growth conditions. Each bar indicates standard deviation for conditions. Each trial included three replicates, and three biological replicates were performed for each condition. An asterisk above a bar indicates that the difference in expression between growth in LB and in urine or in chick embryos was significant (p-value < 0.05).

The results of this expression analysis are intriguing and suggest that genes localized to ColV plasmids, such as pAPEC-O2-ColV, are involved in the pathogenesis of colibacillosis. The lack of confirmatory results from the mutational analyses illustrates the complexities of such studies, especially where multiple alternative mechanisms may compensate for the deleted genes/operons.

Taken altogether, the results presented here suggest several plausible reasons for an inability to detect significant attenuation in the mutants examined in this study. One possibility is that the embryo lethality assay lacks the sensitivity to detect changes owed to the mutated genes. This is a distinct possibility, as acquisition of pAPEC-O2-ColV by an avirulent recipient confers the ability to kill chick embryos [3] while none of the isogenic mutants created in this study and involving genes and/or regions of pAPEC-O2-ColV were attenuated in the chick embryo model of infection. A second possibility is that none of the deleted genes in this study actually contribute to the abilities of APEC O2 to kill chick embryos or grow in human urine, although this seems unlikely based on the literature, which suggests that several of these genes including tsh and iroN[28, 29, 39], do contribute to the virulence of ExPEC. In addition an association of iss with the virulence of APEC in a respiratory model of infection has been postulated [40], however a direct role for iss in virulence was not demonstrated. In accordance with previous findings, we found that several of these genes were strongly up-regulated during growth of APEC O2 in these models, suggesting that these genes play at least some role in urine growth and infection. To better pinpoint the contributions of these targeted genes and ColV plasmids to APEC virulence, more sensitive virulence assays and use of functional genomics and proteomics approaches examining the total APEC genome will be needed.

Conclusion

The differences seen in the results of the mutational and transcriptional analyses in this study underscore the need to use multiple approaches in ascertaining genes' contributions to disease.

While the data presented here suggests roles for iss, hlyF, and iroN during E. coli-caused septicemia, a more comprehensive analysis of these plasmids is necessary to better understand their nature, and such analysis must also include genes of unknown function found on pAPEC-O2-ColV and other similar plasmids.

Methods

Media and bacterial strains

All bacterial strains were stored in Brain Heart Infusion Broth (Difco Laboratories, Detroit, MI) with 20% glycerol at -80 C prior to use [41]. Strains used in this study included NC, APEC O2, and its mutant derivatives. Their relevant characteristics are shown in Table 2.
Table 2

Phenotypic Characteristics of Strains/Plasmids Used

Strain or Plasmid

Relevant Characteristicsa

Reference and/or Source

APEC O2

Virulent to chick embryos; contains pAPEC-O2-ColV and pAPEC-O2-R

Diseased Chicken [1–3]

pAPEC-O2-ColV

ColV plasmid of APEC O2; contains iss, tsh, and traT genes, along with the aerobactin, ColV, sit and iro operons

[1,3]

pAPEC-O2-R

R plasmid of APEC O2; encodes resistance to multiple antimicrobial agents

[2,3]

NC

Relatively avirulent to chick embryos and lacks iss, tsh, and the aerobactin, ColV, and iro operons

Healthy Chicken [3]

NC/pAPEC-O2

Transconjugant derivative of NC containing pAPEC-O2-ColV and pAPEC-O2-R; has enhanced abilities to kill chick embryos and grow in human urine relative to strain NC

[3]

pKD46

ampR ; temperature sensitive plasmid which expresses the λ Red recombinase proteins when induced by arabinose

[30]

pSKY5000

camR derivative of pKD46

[42]

a Abbreviations: Amp, ampicillin, Cam, chloramphenicol; ColV, colicin V; r, resistant

Mutagenesis

Deletions of targeted genes were generated in strain APEC O2 essentially as described by Datsenko and Wanner [30], except that red-mediated recombination proteins were expressed by pSKY5000 rather than pKD46. pSKY5000 is a chloramphenicol resistant (camR) derivative of pKD46 [42]. This method relies on the overproduction of λ-derived recombination proteins encoded by the temperature-sensitive plasmid pSKY5000 and PCR amplification of a kanR cassette in pKD4 flanked by 5' and 3' sequences of the gene or region targeted for deletion. Cells were electrotransformed, and kanamycin (50 ug/ml) resistant derivatives were identified. After electroporation and kan selection, the expected deletions were verified by PCR protocols targeting the deleted gene and the new kanR junction fragment [30]. Primers used for mutagenesis are listed in Table 3, and were synthesized at Integrated DNA Technologies (IDT; Coralville, IA).
Table 3

Primers used in Mutagenesis*

Name

Primer Seq. (5'-3')

Target(s)*

for-mut-iutA

aataatgatgataagcaaaaagtatacgctttgggctctctgtgtaggctggagctgctt

iutA

rev-mut-iutA

atatcagcgtacctttgttgtaaaggaataccggtcagaacatatgaatatcctccttag

iutA, Vir2

for-mut-tsh

atactttatgtgcaggcataacggtgctctccctgaattttgtgtaggctggagctgctt

tsh, Vir1

rev-mut-tsh

ttcttctactgtaccgtaatcagataatcgcagcaaagggcatatgaatatcctccttag

tsh

for-mut-cvaB

cataagatatatcagccgggaggaaatgagccgatatttttgtgtaggctggagctgctt

cvaB

rev-mut-cvaB

tcatacgcttgtaattcctctatggtttaaatagaaataacatatgaatatcctccttag

cvaB

for-mut-sitA

gattgcatcattatttctccctttttccggctttaattcctgtgtaggctggagctgctt

sitA

rev-mut-sitA

tgctcactataggtactaaattatgcactcaataaaaaaacatatgaatatcctccttag

sitA

for-mut-iss

tattcatttcccatgattctgagtacctaccaagtctgagtgtgtaggctggagctgctt

iss

rev-mut-iss

aaaaacaactgtagggagcccagaagtatattaatgaacacatatgaatatcctccttag

iss

rev-mut-iroN

tattagggaataggtatgagaattaacaaaatcctctggtcatatgaatatcctccttag

iroN

for-mut-iroN

acgatcagaatgatgcggtaactccggcatagtaagcccgtgtgtaggctggagctgctt

iroN

for-mut-Vir2

tgctcactataggtactaaattatgcactcaataaaaaaatgtgtaggctggagctgctt

Vir2

rev-mut-Vir1

tattcatttcccatgattctgagtacctaccaagtctgagcatatgaatatcctccttag

Vir1

* Primers were created using information from GenBank Accession number NC007675.

Embryo lethality assay

APEC O2 and its mutant derivatives were assessed for lethality in chicken embryos by inoculation of overnight washed bacterial cultures (~500 colony forming units (CFU)) into the allantoic cavity of 12-day old embryonated, specific-pathogen-free eggs [35]. Phosphate buffered saline (PBS) inoculated and uninoculated embryos were used as controls. Embryo deaths were recorded for four days. Differences in embryo lethality between the strains were evaluated for statistical significance using a z-test for the equality of two binomial proportions. P-values of less than 0.05 were considered statistically significant [43].

Growth in human urine

APEC O2 and its mutant derivatives were compared by their ability to grow in human urine. The assay was performed as described elsewhere [3]. Only urine from healthy, antibiotic-free volunteers, who reported never having experienced a UTI, was used for study. Prior to the study, urine from five volunteers was collected, individually filter sterilized with 0.2 um filters, pooled, and stored at -20 C. On the day before the assay was run, the strains to be tested were grown overnight in 2 ml of Luria Bertani (LB) broth. The next day the cell density was estimated by spectrophotometry, and cultures were diluted in PBS prior to inoculation (100 μl of inoculum into 4.9 ml of urine) to achieve an approximate starting concentration of 102 to 103 CFUs per ml, which was confirmed by viable counts. This concentration of bacteria was chosen as a starting point since it represents the lower end of what is considered a significant indicator of UTI in symptomatic young women [44]. Mixtures were incubated at 37 C with shaking, and aliquots of these urine cultures were removed at set time intervals for use in determining viable counts.

RNA Isolation

Chick embryos were inoculated via the allantoic cavity with APEC O2. Two days later, 12 viable infected embryos were removed from their eggs, and the livers were excised and pooled together in 20 volumes of RNALater (Ambion/Applied Biosystems, Austin, TX). RNA was extracted from these pooled liver samples using Tri Reagent (Ambion), treated with Turbo DNAse (Ambion), followed by phenol/chloroform extraction, and resuspension in distilled water. For in vitro isolation, a single colony APEC O2 was inoculated into 3 ml LB Broth or urine and grown at 37° with shaking until the cells were in early- to mid-exponential growth phase (A600 of approximately 0.3). Cells were than pelleted by centrifugation, resuspended immediately in RNALater, and the RNA isolated and purified as described above.

RT-PCR

Primers for qRT-PCR were designed using software from IDT (Coralville, IA) and also synthesized by IDT. One-step real-time RT-PCR was carried out using an iCycler real-time thermal cycler (Bio-Rad Life Sciences, Hercules, CA) and the iScript One-Step RT-PCR Kit with SYBR Green (Bio-Rad Life Sciences) according to manufacturer's recommendations. Differential gene expression during infection for reference (Glyceraldehyde 3-phosphate dehydrogenase A gene, i.e.,gapA) and target genes (Table 4) was calculated using the comparative RT-PCR methods described by Pfaffl [45], where differences in cycle threshold ratios are assessed while accounting for reaction efficiencies. Efficiency and melting curves were generated for each gene assayed. A negative control containing all reagents except reverse transcriptase was included to rule out DNA contamination. Results for each target gene are presented as ratio of expression of that gene in treated cells versus the untreated cells, corrected using the reference gene gapA and reaction efficiencies for each gene. Reactions were performed in triplicate, and at least two independent trials were performed for each gene and condition assessed. Standard deviations were calculated for the averages of all of the trials for each gene and condition, and the results plotted. Double-sided p-values were calculated for the relative means using the t-test. P-values of less than 0.05 were considered statistically significant [43].
Table 4

Primers used in RT-PCR studies.

Name

Description

Sequence

Predicted amplicon size

gapA F

Glyceraldehyde 3-phosphate dehydrogenase A (reference)

CAT CGT TTC CAA CGC TTC CT

84

gapA R

 

ACC TTC GAT GAT GCC GAA GTT

 

sitA F

Iron/manganese transport gene

TAC GAT CCG GCA AAT GCA CAA ACC

130

sitA R

 

TGG TGA CCA TCC ATC GCT GAT TCT

 

iutA F

Aerobactin receptor gene

TCT GAT AAG AGC GTG GTG GCG AAT

139

iutA R

 

AGC ACG TTG AAG TTC ACT CCG GTA

 

hlyF F

Avian hemolysin gene

AAC TTT GGC GGT TTA GGC ATT CCG

164

hlyF R

 

TGA CAT ACT GGC AAT GAG CCG TCA

 

etsC F

Putative ABC transport gene

ATT ACG AAC AGC GAG TGC TGG AGT

183

etsC R

 

ATA CGT ACT GCA CCA TGC CGG TAA

 

iss F

Increased serum survival gene

GCC GCT CTG GCA ATG CTT ATT ACA

82

iss R

 

TCC TTT GGT GTT ACT GCT GTC GGT

 

iroN F

Salmochelin receptor gene

TTC ACC TGG GAA GAT TAC CAC GCA

109

iroN R

 

ATA TAT GCG CCT GAA GCG GTT TGC

 

cvaC F

ColV structural gene

CGG GCA ATT TGT TGC AGG AGG AAT

111

cvaC R

 

ACC GGA TGG AGA CAT TGC AGG ATT

 

tsh F

Temperature-sensitive hemagglutinin gene

TAC TGA ACC AGC AGG CGG ACA ATA

106

tsh R

 

TTT ACC TGC CGC TCA TCA GTC AGT

 

Notes

Declarations

Acknowledgements

This study was supported by a grant from the Healthy Livestock Initiative Competitive Grants Program. Salary support for JAS was provided though North Dakota State University's Presidential Doctoral Scholar Program. This work was done in partial fulfillment of the requirements for JAS' Ph.D. degree in Molecular Pathogenesis at the same institution.

Authors’ Affiliations

(1)
Department of Veterinary Microbiology and Preventive Medicine, College of Veterinary Medicine
(2)
Department of Veterinary Molecular Biology, Montana State University
(3)
Department of Veterinary and Biomedical Sciences, University of Minnesota, St

References

  1. Johnson TJ, Siek KE, Johnson SJ, Nolan LK: DNA sequence of a ColV plasmid and prevalence of selected plasmid-encoded virulence genes among avian Escherichia coli strains. J Bacteriol. 2006, 188: 745-758. 10.1128/JB.188.2.745-758.2006.PubMed CentralView ArticlePubMedGoogle Scholar
  2. Johnson TJ, Siek KE, Johnson SJ, Nolan LK: DNA sequence and comparative genomics of pAPEC-O2-R, an avian pathogenic Escherichia coli transmissible R plasmid. Antimicrob Agents Chemother. 2005, 49: 4681-4688. 10.1128/AAC.49.11.4681-4688.2005.PubMed CentralView ArticlePubMedGoogle Scholar
  3. Skyberg JA, Johnson TJ, Johnson JR, Clabots C, Logue CM, Nolan LK: Acquisition of avian pathogenic Escherichia coli plasmids by a commensal E. coli isolate enhances its abilities to kill chicken embryos, grow in human urine, and colonize the murine kidney. Infect Immun. 2006, 74: 6287-6292. 10.1128/IAI.00363-06.PubMed CentralView ArticlePubMedGoogle Scholar
  4. Johnson TJ, Johnson SJ, Nolan LK: Complete DNA sequence of a ColBM plasmid from avian pathogenic Escherichia coli suggests that it evolved from closely related ColV virulence plasmids. J Bacteriol. 2006, 188: 5975-5983. 10.1128/JB.00204-06.PubMed CentralView ArticlePubMedGoogle Scholar
  5. Rodriguez-Siek KE, Giddings CW, Doetkott C, Johnson TJ, Nolan LK: Characterizing the APEC pathotype. Vet Res. 2005, 36: 241-256. 10.1051/vetres:2004057.View ArticlePubMedGoogle Scholar
  6. Runyen-Janecky LJ, Reeves SA, Gonzales EG, Payne SM: Contribution of the Shigella flexneri Sit, Iuc, and Feo iron acquisition systems to iron acquisition in vitro and in cultured cells. Infect Immun. 2003, 71: 1919-1928. 10.1128/IAI.71.4.1919-1928.2003.PubMed CentralView ArticlePubMedGoogle Scholar
  7. Zhou D, Hardt WD, Galan JE: Salmonella typhimurium encodes a putative iron transport system within the centisome 63 pathogenicity island. Infect Immun. 1999, 67: 1974-1981.PubMed CentralPubMedGoogle Scholar
  8. de L, Neilands JB: Characterization of iucA and iucC genes of the aerobactin system of plasmid ColV-K30 in Escherichia coli. J Bacteriol. 1986, 167: 350-355.Google Scholar
  9. Hantke K, Nicholson G, Rabsch W, Winkelmann G: Salmochelins, siderophores of Salmonella enterica and uropathogenic Escherichia coli strains, are recognized by the outer membrane receptor IroN. Proc Natl Acad Sci U S A. 2003, 100: 3677-3682. 10.1073/pnas.0737682100.PubMed CentralView ArticlePubMedGoogle Scholar
  10. Morales C, Lee MD, Hofacre C, Maurer JJ: Detection of a novel virulence gene and a Salmonella virulence homologue among Escherichia coli isolated from broiler chickens. Foodborne Pathog Dis. 2004, 1: 160-165.View ArticlePubMedGoogle Scholar
  11. Binns MM, Davies DL, Hardy KG: Cloned fragments of the plasmid ColV,I-K94 specifying virulence and serum resistance. Nature. 1979, 279: 778-781. 10.1038/279778a0.View ArticlePubMedGoogle Scholar
  12. Rodriguez-Siek KE, Giddings CW, Doetkott C, Johnson TJ, Fakhr MK, Nolan LK: Comparison of Escherichia coli isolates implicated in human urinary tract infection and avian colibacillosis. Microbiology. 2005, 151: 2097-2110. 10.1099/mic.0.27499-0.View ArticlePubMedGoogle Scholar
  13. Delicato ER, de Brito BG, Konopatzki AP, Gaziri LC, Vidotto MC: Occurrence of the temperature-sensitive hemagglutinin among avian Escherichia coli. Avian Dis. 2002, 46: 713-716. 10.1637/0005-2086(2002)046[0713:OOTTSH]2.0.CO;2.View ArticlePubMedGoogle Scholar
  14. Provence DL, Curtiss R: Isolation and characterization of a gene involved in hemagglutination by an avian pathogenic Escherichia coli strain. Infect Immun. 1994, 62: 1369-1380.PubMed CentralPubMedGoogle Scholar
  15. Altekruse SF, Elvinger F, Debroy C, Pierson FW, Eifert JD, Sriranganathan N: Pathogenic and fecal Escherichia coil strains from turkeys in a commercial operation. Avian Dis. 2002, 46: 562-569. 10.1637/0005-2086(2002)046[0562:PAFECS]2.0.CO;2.View ArticlePubMedGoogle Scholar
  16. Delicato ER, de Brito BG, Gaziri LC, Vidotto MC: Virulence-associated genes in Escherichia coli isolates from poultry with colibacillosis. Vet Microbiol. 2003, 94: 97-103.View ArticlePubMedGoogle Scholar
  17. Ewers C, Janssen T, Kiessling S, Philipp HC, Wieler LH: Molecular epidemiology of avian pathogenic Escherichia coli (APEC) isolated from colisepticemia in poultry. Vet Microbiol. 2004, 104: 91-101. 10.1016/j.vetmic.2004.09.008.View ArticlePubMedGoogle Scholar
  18. Janben T, Schwarz C, Preikschat P, Voss M, Philipp HC, Wieler LH: Virulence-associated genes in avian pathogenic Escherichia coli (APEC) isolated from internal organs of poultry having died from colibacillosis. Int J Med Microbiol. 2001, 291: 371-378. 10.1078/1438-4221-00143.View ArticlePubMedGoogle Scholar
  19. Maurer JJ, Brown TP, Steffens WL, Thayer SG: The occurrence of ambient temperature-regulated adhesins, curli, and the temperature-sensitive hemagglutinin tsh among avian Escherichia coli. Avian Dis. 1998, 42: 106-118. 10.2307/1592582.View ArticlePubMedGoogle Scholar
  20. McPeake SJ, Smyth JA, Ball HJ: Characterisation of avian pathogenic Escherichia coli (APEC) associated with colisepticaemia compared to faecal isolates from healthy birds. Vet Microbiol. 2005, 110: 245-253. 10.1016/j.vetmic.2005.08.001.View ArticlePubMedGoogle Scholar
  21. de Brito BG, Gaziri LC, Vidotto MC: Virulence factors and clonal relationships among Escherichia coli strains isolated from broiler chickens with cellulitis. Infect Immun. 2003, 71: 4175-4177. 10.1128/IAI.71.7.4175-4177.2003.PubMed CentralView ArticlePubMedGoogle Scholar
  22. Ewers C, Janssen T, Kiessling S, Philipp HC, Wieler LH: Rapid detection of virulence-associated genes in avian pathogenic Escherichia coli by multiplex polymerase chain reaction. Avian Dis. 2005, 49: 269-273. 10.1637/7293-102604R.View ArticlePubMedGoogle Scholar
  23. Skyberg JA, Horne SM, Giddings CW, Wooley RE, Gibbs PS, Nolan LK: Characterizing avian Escherichia coli isolates with multiplex polymerase chain reaction. Avian Dis. 2003, 47: 1441-1447. 10.1637/7030.View ArticlePubMedGoogle Scholar
  24. Johnson JR: Virulence factors in Escherichia coli urinary tract infection. Clin Microbiol Rev. 1991, 4: 80-128.PubMed CentralPubMedGoogle Scholar
  25. Pfaff-McDonough SJ, Horne SM, Giddings CW, Ebert JO, Doetkott C, Smith MH, Nolan LK: Complement resistance-related traits among Escherichia coli isolates from apparently healthy birds and birds with colibacillosis. Avian Dis. 2000, 44: 23-33. 10.2307/1592504.View ArticlePubMedGoogle Scholar
  26. Aguero ME, de la FG, Vivaldi E, Cabello F: ColV increases the virulence of Escherichia coli K1 strains in animal models of neonatal meningitis and urinary infection. Med Microbiol Immunol. 1989, 178: 211-216. 10.1007/BF00202554.View ArticlePubMedGoogle Scholar
  27. Davies DL, Falkiner FR, Hardy KG: Colicin V production by clinical isolates of Escherichia coli. Infect Immun. 1981, 31: 574-579.PubMed CentralPubMedGoogle Scholar
  28. Dozois CM, Dho-Moulin M, Bree A, Fairbrother JM, Desautels C, Curtiss R: Relationship between the Tsh autotransporter and pathogenicity of avian Escherichia coli and localization and analysis of the Tsh genetic region. Infect Immun. 2000, 68: 4145-4154. 10.1128/IAI.68.7.4145-4154.2000.PubMed CentralView ArticlePubMedGoogle Scholar
  29. Dozois CM, Daigle F, Curtiss R: Identification of pathogen-specific and conserved genes expressed in vivo by an avian pathogenic Escherichia coli strain. Proc Natl Acad Sci U S A. 2003, 100: 247-252. 10.1073/pnas.232686799.PubMed CentralView ArticlePubMedGoogle Scholar
  30. Datsenko KA, Wanner BL: One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A. 2000, 97: 6640-6645. 10.1073/pnas.120163297.PubMed CentralView ArticlePubMedGoogle Scholar
  31. Johnson JR, Lockman HA, Owens K, Jelacic S, Tarr PI: High-frequency secondary mutations after suicide-driven allelic exchange mutagenesis in extraintestinal pathogenic Escherichia coli. J Bacteriol. 2003, 185: 5301-5305. 10.1128/JB.185.17.5301-5305.2003.PubMed CentralView ArticlePubMedGoogle Scholar
  32. da Rocha AC, da Silva AB, de Brito AB, Moraes HL, Pontes AP, Ce MC, do N, Salle CT: Virulence factors of avian pathogenic Escherichia coli isolated from broilers from the south of Brazil. Avian Dis. 2002, 46: 749-753. 10.1637/0005-2086(2002)046[0749:VFOAPE]2.0.CO;2.View ArticlePubMedGoogle Scholar
  33. Johnson TJ, Giddings CW, Horne SM, Gibbs PS, Wooley RE, Skyberg J, Olah P, Kercher R, Sherwood JS, Foley SL, Nolan LK: Location of increased serum survival gene and selected virulence traits on a conjugative R plasmid in an avian Escherichia coli isolate. Avian Dis. 2002, 46: 342-352. 10.1637/0005-2086(2002)046[0342:LOISSG]2.0.CO;2.View ArticlePubMedGoogle Scholar
  34. Feldmann F, Sorsa LJ, Hildinger K, Schubert S: The salmochelin siderophore receptor IroN contributes to invasion of urothelial cells by extraintestinal pathogenic Escherichia coli in vitro. Infect Immun. 2007, 75: 3183-3187. 10.1128/IAI.00656-06.PubMed CentralView ArticlePubMedGoogle Scholar
  35. Nolan LK, Wooley RE, Brown J, Spears KR, Dickerson HW, Dekich M: Comparison of a complement resistance test, a chicken embryo lethality test, and the chicken lethality test for determining virulence of avian Escherichia coli. Avian Dis. 1992, 36: 395-397. 10.2307/1591518.View ArticlePubMedGoogle Scholar
  36. Powell CJ, Finkelstein RA: Virulence of Escherichia coli strains for chick embryos. J Bacteriol. 1966, 91: 1410-1417.PubMed CentralPubMedGoogle Scholar
  37. McFarlane WD, Milne HI: Iron and copper metabolism in the developing chick embryo. J Biol Chem. 1934, 107: 309-319.Google Scholar
  38. Nolan LK, Horne SM, Giddings CW, Foley SL, Johnson TJ, Lynne AM, Skyberg J: Resistance to serum complement, iss, and virulence of avian Escherichia coli. Vet Res Commun. 2003, 27: 101-110. 10.1023/A:1022854902700. [http://www.springerlink.com/content/r314057k45qhh7q1/?p=547ace03baf44fe8a0dcda6caf8c72a1&pi=2]View ArticlePubMedGoogle Scholar
  39. Russo TA, McFadden CD, Carlino-MacDonald UB, Beanan JM, Barnard TJ, Johnson JR: IroN functions as a siderophore receptor and is a urovirulence factor in an extraintestinal pathogenic isolate of Escherichia coli. Infect Immun. 2002, 70: 7156-7160. 10.1128/IAI.70.12.7156-7160.2002.PubMed CentralView ArticlePubMedGoogle Scholar
  40. Tivendale KA, Allen JL, Ginns CA, Crabb BS, Browning GF: Association of iss and iucA, but not tsh, with plasmid-mediated virulence of avian pathogenic Escherichia coli. Infect Immun. 2004, 72: 6554-6560. 10.1128/IAI.72.11.6554-6560.2004.PubMed CentralView ArticlePubMedGoogle Scholar
  41. Sanderson KE, Zeigler DR: Storing, shipping, and maintaining records on bacterial strains. Methods Enzymol. 1991, 204: 248-264.View ArticlePubMedGoogle Scholar
  42. Lynne AM, Skyberg JA, Logue CM, Nolan LK: Detection of Iss and Bor on the surface of Escherichia coli. J Appl Microbiol. 2007, 102: 660-666. 10.1111/j.1365-2672.2006.03133.x.View ArticlePubMedGoogle Scholar
  43. Dowdy S, Weardon S, Chilko D: Statistics for Reseach. 2004, Hoboken, John Wiley and SonsView ArticleGoogle Scholar
  44. Stamm WE, Counts GW, Running KR, Fihn S, Turck M, Holmes KK: Diagnosis of coliform infection in acutely dysuric women. N Engl J Med. 1982, 307: 463-468.View ArticlePubMedGoogle Scholar
  45. Pfaffl MW: A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29: e45-10.1093/nar/29.9.e45. [http://nar.oxfordjournals.org/cgi/content/full/29/9/e45]PubMed CentralView ArticlePubMedGoogle Scholar

Copyright

© Skyberg et al; licensee BioMed Central Ltd. 2008

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement