Skip to main content

Functional significance of nuclear export and mRNA binding of meiotic regulator Spo5 in fission yeast



Meiotic cells undergo two rounds of nuclear division and generate gametes. Previous studies have indicated that a number of transcription factors modulate the transcriptome in successive waves during meiosis and spore formation in fission yeast. However, the mechanisms underlying the post-transcriptional regulation in meiosis are not fully understood. The fission yeast spo5 + gene encodes a meiosis-specific RNA-binding protein, which is required for the progression of meiosis II and spore formation. However, the target RNA molecules of Spo5 are yet to be identified. Characterization of meiosis-specific RNA-binding proteins will provide insight into how post-transcriptional regulation influence gene expression during sexual differentiation.


To assess the functional significance of RNA-recognition motifs (RRMs) of Spo5, we constructed a series of new spo5 truncated mutants and previously reported spo5 missense mutants. In addition, we isolated novel spo5 missense mutants. The phenotypic characteristics of these mutants indicated that the RRMs are essential for both the localization and function of the protein. Interestingly, Spo5 is exported from the nucleus to the cytoplasm via the Rae1-dependent mRNA export pathway, but is unlikely to be involved in global mRNA export. Furthermore, cytoplasmic localization of Spo5 is important for its function, which suggests the involvement of Spo5 in post-transcriptional regulation. We identified pcr1 + mRNA as one of the critical targets of Spo5. The pcr1 + gene encodes an activating transcription factor/cAMP response element binding (ATF/CREB) transcription factor family. Among the four family members, namely Pcr1, Atf1, Atf21, and Atf31, only the mRNA encoding Pcr1 binds to Spo5.


Spo5 is exported from the nucleus with mRNAs via the Rae1-dependent pathway. RRMs are necessary for this process and also for the function of Spo5 after the nuclear export. Spo5 appears to influence the activity of pcr1 + mRNA, and the mechanism of how Spo5 stimulates the mRNA to promote the progression of meiosis II and spore formation remains an intriguing question for future research.


Meiosis is a specialized cell division process, which includes premeiotic DNA synthesis, DNA recombination followed by two rounds of cell division, and gametogenesis [14]. It has been shown in the fission yeast Schizosaccharomyces pombe[58] and the budding yeast Saccharomyces cerevisiae[1, 912] that a number of transcription factors dramatically modulate the transcriptome to facilitate meiosis, thereby playing critical roles in meiotic progression and sporulation (gametogenesis). In addition to transcriptional regulation, post-transcriptional regulation plays a fundamental role in the progression of meiosis and gametogenesis in higher eukaryotes. For example, cessation of transcription followed by complex translational activation and repression of stored maternal mRNAs occurs in Xenopus oocytes during meiotic progression (oocyte maturation) [13]. In fission yeast, a specialized regulation of meiosis, called selective elimination of meiosis-specific mRNAs, facilitates the post-transcriptional degradation of meiotic mRNAs during the mitotic cell cycle [14]. We were interested in elucidating any additional post-transcriptional regulation that might contribute to the dynamic changes observed in gene expression during meiosis in the fission yeast.

The spo5 mutant was isolated as a sporulation-deficient mutant in the original genetic screen of defective mutants in meiotic progression and/or sporulation, performed nearly half a century ago [15]. Previous studies have indicated that the spo5 + gene encodes a meiosis-specific RNA-binding protein, carrying two RNA-recognition motifs (RRMs) in the C-terminal part (aas 192–567), and regulates the progression of meiosis II and spore formation [1620]. Although it seems apparent that Spo5 plays an essential role to coordinate meiosis and sporulation, controlling a number of targets, the RNA molecules that bind to Spo5 have not yet been identified, except for our recent finding that cdc13 + mRNA, encoding cyclin B, can do so [21]. Because Spo5 is likely to be involved in post-transcriptional events during meiosis, such as pre-mRNA processing, mRNA export, translation, and mRNA degradation, we analyzed this RNA-binding protein to evaluate its functions.

In this report, we demonstrate that the RRMs on Spo5 are essential for its cytoplasmic localization, where it exerts its function. Spo5 appears to be exported from the nucleus to the cytoplasm through the Rae1-dependent mRNA export pathway, but is unlikely to be involved in general mRNA export. We also show that one of the critical target RNA molecules for Spo5 is pcr1 + mRNA. Pcr1 belongs to the ATF/CREB family of transcription factors, which consists of four members in fission yeast: Pcr1, Atf1, Atf21, and Atf31. The functional relationship between Spo5 and Pcr1 is also analyzed.

Results and discussion

RNA recognition motifs are essential for the localization and function of Spo5

First, we evaluated the mechanism underlying the subcellular localization of Spo5. A previous study suggested that the C-terminal half of Spo5 is required for its cytoplasmic localization [19]. As this region contains the RRMs, we examined whether these might be responsible for the localization of Spo5. We constructed a series of truncation mutants that lacked the RRM region (Figure 1A). Each mutant carried the mutated spo5 gene in place of the wild-type gene on the chromosome, and expressed the mutant protein from the authentic spo5 promoter. All truncated mutant proteins that lacked at least one RRM showed abnormal nuclear accumulation, as indicated by the fluorescent signals of fused green fluorescent protein (GFP) (Figure 1A). We confirmed that mutant proteins were produced in a comparable amount to wild-type Spo5, by examining the shortest mutant Spo5(1–296) and the RRM2-deletion mutant, although the protein level might be slightly lower in the latter case (Additional 1: Figure S1). The RRM truncation mutants were defective in sporulation (Figure 1B), suggesting that the existence of intact RRMs is correlated with the cytoplasmic localization and proper function of Spo5. While we could not exclude the possibility that some of the effect of the mutations on sporulation might be due to lower levels of the mutant proteins, the effect on sporulation was apparently more dramatic than the effect on protein levels, supporting the importance of the RRMs/cytoplasmic localization in Spo5 function.There was one exception, namely Spo5(1–456)-GFP, which has two RRMs but lacks the C-terminal region. Although it localized mostly to the cytoplasm, it was not functional, whereas Spo5(1–525)-GFP, which has two RRMs and an additional C-terminal portion, was functional (Figure 1A,B). This indicates that, in addition to intact RRMs, the C-terminal region adjacent to the second RRM is essential for the Spo5 function.

Figure 1
figure 1

RNA recognition motifs are essential for the localization and function of Spo5. (A) Localization analyses using truncated mutants of Spo5. Localization of wild-type and mutant proteins of Spo5-GFP (green) during the period between meiosis I and meiosis II was detected using the nuclear envelope marker Cut11-4mRFP (red). Numbers on the right indicate the frequency of cells displaying nuclear GFP signals. Schematic images depict the domains of the mutant proteins. Black boxes depict two RNA-recognition motifs, RRM1 and RRM2, respectively. Scale bar, 5 μm. (B) Sporulation efficiency of specific mutants used in (A), measured at 30°C (n > 500). Error bars indicate standard deviation. (C) Localization analyses using point mutants of Spo5. Localization of Spo5-GFP harboring specific point mutations was observed as in (A). Positions of mutation sites (×) are shown in schematic images. Scale bar, 5 μm. (D) Sporulation efficiency of the strains used in (C), measured at 30°C (n > 500). Error bars indicate standard deviation.

To clarify whether RNA-binding is required for Spo5 localization and function, we introduced missense mutations to the conserved motifs in RRMs. We constructed mutant strains that were similar to the F341A and F427A mutations previously analyzed by Kasama and colleagues [19]. All of the mutant proteins, namely Spo5(F341A)–GFP, Spo5(F427A)–GFP, and Spo5(F341A, F427A)–GFP, accumulated in the nucleus, as did the RRM-truncated proteins (Figure 1C). These mutants were also deficient in sporulation (Figure 1D). Similar, or slightly lower production of Spo5(F341A, F427A) protein compared to the wild-type was confirmed (Additional file 1: Figure S1). The nuclear localization of these mutated Spo5-GFP proteins in our study was somewhat different from that observed in the previous study, which reported that Spo5(F341A, F427A)-GFP shows a punctate distribution in both the cytoplasm and nucleus [19]. Our precise analysis suggested that Spo5(F341A, F427A) protein might exhibit punctate cytoplasmic distribution during early meiotic stages such as the horsetail-movement and one-nucleus stages (Additional file 2: Figure S2). The apparent difference in localization may also reflect changes in the strain construction: In the previous study, the spo5 mutant allele was integrated into the chromosomal leu1 locus, whereas the mutant allele was integrated in the authentic spo5 locus in our case. However, the actual reasons remain unclear.

We also performed a genetic screen for novel missense mutants of spo5 that were defective in meiosis and sporulation, and isolated more than ten different mutants including spo5(F341L) and spo5(S365P), both of which contained a mutation in the RRM domain. When assayed at 30°C, Spo5(F341L)–GFP accumulated in the nucleus as did Spo5(F341A)–GFP, but Spo5(S365P)–GFP did not, showing a unique phenotype (Figure 1C). Because aromatic residues in the RRM, such as F341, have been shown to interact directly with RNA [22], we speculated that the RNA-binding of Spo5 might be important for its cytoplasmic localization.

Spo5 localizes to the cytoplasm via the mRNA export pathway

RRMs appear to be essential for the translocation of Spo5 from the nucleus to the cytoplasm. Therefore, we investigated whether Spo5 might be exported to the cytoplasm via the mRNA export machinery using a mutant of the mRNA export factor, Rae1. The Rae1-dependent pathway is conserved from the budding yeast [23] to humans [24]. The fission yeast rae1-167 mutant exhibited defective mRNA export at restrictive temperatures [25]. We induced meiosis in wild-type (WT) and rae1-167 cells at 25°C, the latter of which produced Spo5 protein in a comparable or slightly lower amount (Additional file 1: Figure S1), and transferred the cells to 36°C to inactivate Rae1-167. In WT cells, Spo5–GFP was mainly localized to the cytoplasm both at 25°C and 36°C (Figure 2A). By contrast, Spo5–GFP accumulated in the nucleus in rae1-167 cells at the restrictive temperature (Figure 2A). This suggests that Spo5 is likely to be exported to the cytoplasm via the mRNA export machinery. Consistent with this idea, Spo5 accumulated in the nucleus when mRNA synthesis was inhibited by the addition of 1,10-phenanthroline (Figure 2B,C). We also noticed that sporulation was markedly inefficient in rae1-167 cells (spo5-GFP rae1 +, 83% vs. spo5-GFP rae1-167, 19%), indicating that Rae1 plays an important role in meiotic progression and sporulation.

Figure 2
figure 2

Spo5 localization to the cytoplasm facilitated by the mRNA export pathway does not involve global mRNA export. (A) Spo5–GFP accumulated in the nucleus in temperature-sensitive rae1-167 cells. Cells were incubated at 25°C for 6 h and then transferred to 36°C for 3 h. Cut11-4mRFP was used as a nuclear envelope marker. The Spo5–GFP signal was evident in cells undergoing meiotic prophase I through meiosis II. Scale bar, 5 μm. (B) To block RNA-polymerase II-dependent transcription of mRNAs, we used 1, 10-phenanthroline [49]. Wild-type diploid cells were transferred to MM-N to induce meiosis, and after 3.5 hours (Time 0), 1,10-phenanthroline was added to half of the culture at a final concentration of 500 ng/μL. Microscopic observation of Spo5-GFP was carried out after 2 hours. Scale bar, 5 μm. (C) Quantitative analysis of Spo5-GFP localization in cells treated with 1,10-phenanthroline. The number of cells examined is as follows: 0 h, n = 152; 2 h(-), n = 239; and 2 h(+), n = 207. (D) Cells expressing Spo5–GFP (-LMB) were treated with 100 ng/mL LMB and observed after 1 h (+LMB). Mei2-mCherry served as a positive control since it accumulates in the nucleus upon LMB addition. Scale bar, 5 μm. (E) Pabp–GFP accumulated in the nucleus in rae1-167 cells, whereas it did not do so in spo5∆ cells. Scale bar, 5 μm.

Next, we investigated the possible involvement of the exportin-mediated mRNA export pathway [26] in the localization of Spo5. Ran GTPase is known as the major organizer of importin/exportin-mediated nucleocytoplasmic transport [27]. When the Ran–exportin nuclear export pathway was blocked with leptomycin B (LMB), a potent inhibitor of exportin/Crm1 [28], Spo5–GFP remained in the cytoplasm (Figure 2D), demonstrating that exportin/Crm1 is dispensable for the export of Spo5.

To examine whether Spo5 itself is a component of the mRNA transport machinery, we monitored the localization of the poly (A)-binding protein (Pabp), which has been shown to accumulate in the nucleus in the rae1-167 mutant [29]. Pabp–GFP was found to localize in the cytoplasm in spo5∆ cells (Figure 2E), suggesting that Spo5 is not an mRNA export factor.

Taken together, we conclude that Spo5 is exported to the cytoplasm via the mRNA export machinery, but is unlikely to be involved in global mRNA export. It was recently shown that Drosophila RAE1 plays an essential role in male meiosis and spermatogenesis [30]. Fission yeast Rae1 may also promote meiosis by transporting mRNPs from the nucleus to the cytoplasm. Some RNA-binding proteins are also known to be exported to the cytoplasm through binding to mRNAs [3133]. The mRNA-dependent nuclear export of RNA-binding proteins may emerge as a more universal phenomenon among eukaryotes than previously anticipated.

Nuclear export is important for the function of Spo5

The findings of this study indicated that mutations in RRMs caused abnormal nuclear accumulation and loss of function of Spo5. This suggests that the mRNA-dependent nuclear export of Spo5 is required for its function, although it is also possible that the loss of RNA-binding in Spo5 resulted in its abnormal localization as a secondary effect. Hence, we employed two approaches to investigate whether the nuclear export of Spo5 is a fundamental requirement for its function.

First, we used an external nuclear localization signal (NLS) to alter the localization of Spo5 artificially from the cytoplasm to the nucleus. Although the addition of NLS appeared to make the protein less stable (Additional file 1: Figure S1), cells expressing Spo5–NLS–GFP accumulated the fusion proteins detectably in the nucleus, indicating that the NLS sequence was functional (Figure 3A). The sporulation efficiency of these cells was significantly reduced, and they produced abnormally shaped spores or asci with less than four spores (Figure 3B,C). While the destabilization of Spo5–NLS was likely to contribute largely to the sporulation defect, enforced nuclear migration of Spo5 also appeared to abolish its function to promote meiosis and sporulation, suggesting that the nuclear export of Spo5 is important for its optimal function. The viability of the spores generated in spo5-NLS-GFP cells was comparable to that of the control (spo5-GFP, 50% vs. spo5-NLS-GFP 40%), implying that the loss of Spo5 function did not affect the germination potential.

Figure 3
figure 3

Nuclear export is important for the function of Spo5. (A) Spo5 fused with an NLS sequence derived from SV40 large T antigen and GFP (Spo5–NLS–GFP) accumulated in the nucleus during meiosis. Scale bar, 5 μm. (B) Addition of the NLS caused deficient sporulation. Differential interference contrast (DIC) images are shown. Scale bar, 5 μm. (C) Quantitative representation of the reduction in sporulation efficiency (light blue) and the frequency of four-spore asci (magenta) (n > 500). Error bars indicate standard deviation. (D) Nuclear accumulation of Spo5(RRM1∆ )–GFP was suppressed by the fusion of the NES sequence. Scale bar, 5 μm. (E) Addition of NES did not suppress the sporulation defects of Spo5(RRM1∆ ) (n > 500). Error bars indicate standard deviation.

Second, we investigated whether artificial nuclear export of Spo5 could suppress sporulation defects in some spo5 mutants. Removal of RRM1 caused nuclear accumulation of Spo5 and sporulation defects, although a small portion of spo5 RRM1∆ cells could sporulate (Figure 1A,B). The fusion of a nuclear export signal (NES) to Spo5RRM1∆ (Spo5RRM1∆ –NES–GFP) enhanced its localization to the cytoplasm (Figure 3D). However, the sporulation efficiency was much lower than that observed for Spo5–GFP carrying intact RRM1, and was only comparable to that observed for Spo5RRM1∆ -GFP (Figure 3E). Hence, we conclude that the RNA-binding activity of Spo5 is necessary not only for nuclear export of the Spo5–mRNA complex via the mRNA export machinery, but also for the function of Spo5 in the cytoplasm.

pcr1 + mRNA is one of the critical targets of Spo5

The spo5(S365P) mutant isolated in this study was unique in that it did not accumulate Spo5(S365P) protein efficiently in the nucleus in rae1-167 mutant cells at the restrictive temperature (Additional file 3: Figure S3A), although it was produced in a comparable or slightly lower amount to the wild-type (Additional file 1: Figure S1), implying that this mutant protein might be defective in nuclear import. In addition, the spo5(S365P) mutant was less leaky compared to the spo5(F341L) mutant, which sporulated almost normally at 25°C, as indicated by iodine staining [15] and microscopic measurement (Additional file 3: Figure S3B, C). Therefore, we screened for multi-copy suppressors of spo5(S365P), expecting to identify novel candidates. We introduced the cDNA library to the spo5(S365P) mutant and picked up iodine-positive colonies. In this screening we obtained clones encoding transcription factors. Among them was the pcr1 + gene, which encodes an ATF/CREB family transcription factor. The pcr1 + gene was not a novel candidate, because we have previously reported the isolation of this gene as a multicopy suppressor of the spo5 mutant [34]. We and others have characterized Pcr1, which is now known to form a heterodimer with Atf1 and binds to the ade6-M26 meiotic recombination hotspot [35, 36].

The relationship between Pcr1 and Spo5, however, has not been delineated. Transcription of pcr1 + was not lowered in the spo5 null mutant, spo5∆ (Additional file 4: Figure S4A). The levels of pcr1 + transcripts gradually increase toward late meiosis [5] (after 4 h in Additional file 4: Figure S4A), suggesting that Pcr1 may also function in a meiotic process other than meiotic recombination. Overexpression of pcr1 + could suppress the sporulation deficiency of spo5(S365P) and other spo5 mutants including spo5∆ (Figure 4A,B). These data suggest that Pcr1 may act downstream of Spo5, and that meiotic progression can be promoted substantially without Spo5 if Pcr1 is expressed at sufficiently high levels.

Figure 4
figure 4

pcr1 + mRNA is one of the critical targets of Spo5. (A) The sporulation of the spo5(S365P) strain was detected by dark brown staining with iodine vapor when pcr1 + was overexpressed. Stained patches and DIC images of the cells are shown. Scale bar, 5 μm. (B) Sporulation defects of other spo5 mutants were also suppressed by the overexpression of pcr1 +. Meiosis and sporulation were induced in cells harboring pPEP1 (vector) or pPEP3-pcr1 +, and the sporulation efficiency was calculated (n > 500). Error bars indicate standard deviation. (C) Meiosis was induced in spo5∆ cells harboring plasmids containing spo5 +, pcr1 +, atf1 +, atf21 +, and atf31 +, or the empty vector on SSA at 30°C for 3 days, and sporulation efficiency was calculated (n > 500). Error bars indicate standard deviation.

S. pombe has four ATF/CREB family proteins, namely Pcr1, Atf1, Atf21, and Atf31 [37]. Although we examined all of them, only Pcr1 could suppress sporulation defects of spo5∆ cells when overexpressed (Figure 4C). Curiously, overexpression of Atf1, a functional partner that forms a heterodimer with Pcr1 [35], failed to suppress spo5 mutants. This suggested that Spo5 might be specifically related to pcr1 + gene expression, and furthermore, that Pcr1 might promote transcription of some meiotic genes that are regulated by Spo5. It was also evident that Spo5 could regulate factors other than Pcr1 that are important for meiotic progression and sporulation, because Pcr1 could not suppress sporulation defects of spo5∆ as efficiently as Spo5 itself (Additional file 4: Figure S4B), although pcr1 + overexpression increased the amount of pcr1 + mRNA in spo5∆ cells to a higher level than spo5 + overexpression (Additional file 4: Figure S4C). Indeed, we have recently demonstrated that Spo5 is necessary to maintain proper expression of cyclin Cdc13 [21].

To test the possibility that Spo5 may bind to pcr1 + mRNA to modulate its expression/function during meiosis, we performed an electrophoresis mobility shift assay (EMSA) using recombinant Spo5 protein and pcr1 + RNA transcribed in vitro. As shown in Figure 5A, the C-terminal part of Spo5, including the two RRMs (Spo5C, aas 192–567), fused to glutathione S-transferase (GST) (GST-Spo5C), associated with the pcr1 + RNA (red arrowhead), but not with the control GFP RNA. To confirm direct interaction of Spo5 and pcr1 + RNA in vivo, we performed an RNA-immunoprecipitation assay using the spo5-GFP diploid strain. Immunoprecipitation by anti-GFP antibody indicated that pcr1 + mRNA formed a complex with Spo5-GFP in vivo, but that the mRNAs of other ATF/CREB factors did not (Figure 5B). To further confirm the specificity of binding, we compared binding of Spo5C to pcr1 + RNA and atf21 + RNA transcribed similarly in vitro. While Spo5C bound to atf21 + RNA to some extent (Figure 5C, lanes 7 and 8), probably because of its weak non-specific affinity for RNA, which we noticed previously [21], it was clear that Spo5C could bind to pcr1 + RNA more strongly than atf21 + RNA, as 50 ng of the protein was enough to shift pcr1 + RNA (Figure 5C, lane 2). We also confirmed that Spo5C carrying the F341A and F427A mutations, designated Spo5C(FAFA), lost the binding ability to pcr1 + RNA (Figure 5D, compare lanes 2 vs. 7, and lanes 3 vs. 8), demonstrating the importance of the RRMs for the binding. These observations indicate that pcr1 + mRNA is one of the critical targets of Spo5. We have shown that cdc13 + mRNA also binds to Spo5 [21]. A previous report suggested that a long 3′ UTR of cdc13 +, cdc25 + and ste9 + mRNA might determine its stability [38]. The pcr1 + mRNA also carries a relatively long 3′ untranslated region (UTR), but our observation does not support the idea that Spo5 stabilizes pcr1 + mRNA (Additional file 4: Figure S4A). Thus, it is an interesting hypothesis to be confirmed that Spo5 may control certain activity of pcr1 + mRNA through binding to its long 3′ UTR.

Figure 5
figure 5

Binding of Spo5 protein to pcr1 + mRNA. (A) Results of an EMSA assay indicating formation of the Spo5–pcr1 + RNA complex. Recombinant GST and GST–Spo5C (the C-terminal part of Spo5, aas 192–567) proteins were incubated with pcr1 + RNA including the coding region and both 5′- and 3′-UTRs (lanes 3 and 4) or control GFP RNA (lanes 1 and 2). ‘G’ indicates GST (50 ng), and ‘SpC’ indicates GST-Spo5C (20 ng). The red arrowhead indicates shifted RNA. (B) Spo5–GFP and pcr1 + mRNA form complexes in vivo. A cell extract was prepared from a diploid Spo5–GFP strain undergoing meiosis and treated with anti-GFP and the control anti-HA. Reverse transcription-polymerase chain reaction (RT-PCR) assay using the pull-downs was performed to detect pcr1 + and other ATF/CREB factors, atf1 +, atf21 +, and atf31 + mRNA. (C) pcr1 + RNA complexes with Spo5C more efficiently than atf21 + RNA does. atf21 + RNA carried the coding region and both 5′- and 3′-UTRs, similarly to pcr1 + RNA. The red arrowhead indicates shifted RNA. (D) Spo5C binds to pcr1 + RNA more efficiently than the mutant form Spo5C(FAFA), suggesting the involvement of the two phenylalanine residues in RNA binding. The red arrowhead indicates shifted RNA.


The findings of this study indicated that Spo5 is exported to the cytoplasm via the mRNA export machinery, but not via the Ran–exportin/Crm1 system. The binding of Spo5 to mRNAs through its two RRMs appears to enable its nuclear export, and this RNA-binding activity is essential not only for the nuclear export, but also for its function in the cytoplasm. Spo5 is unlikely to be involved in general mRNA export, suggesting that it may instead be involved in the post-transcriptional regulation occurring in the cytoplasm, such as control of mRNA stability and/or translational initiation. Furthermore, we identified a novel binding target of Spo5, pcr1 + mRNA. Overexpression of the pcr1 + gene suppressed the sporulation deficiency of spo5 mutants, demonstrating that pcr1 + mRNA is a critical target of Spo5. However, Pcr1 suppressed the defect in spo5∆ cells less efficiently than Spo5, suggesting that Spo5 may also regulate factors important for meiotic progression and sporulation other than Pcr1. Suppression of spo5 by overexpression of cdc13 + is also partial [21]. Future studies are required to identify other important targets of Spo5 and the possible role that Spo5 plays in the post-transcriptional regulation of pcr1 + mRNA and other mRNAs.


Yeast strains and genetic manipulations

The S. pombe strains used in this study are listed in Table 1. Conventional methods were used to construct gene-disrupted strains, fluorescent protein-tagged strains [39, 40], and a multiple fluorescent protein-tagged strain [41]. To enforce the localization of Spo5 to the nucleus and cytoplasm, the nuclear localization signal (NLS; PKKKRKV) of SV40 large T antigen and the leucine-rich nuclear export signal (NES; ILPPLERLTL) of HIV-1 Rev were used, respectively [4244]. Standard methods were employed to grow yeast strains [45]. To induce mating, meiosis, and sporulation of homothallic (h 90) strains, sporulation agar (SPA) or synthetic sporulation medium (SSA) was used. Haploid cells grown in liquid yeast extract containing 3% glucose (YE) supplemented with adenine (YEA) were harvested, spotted onto SPA plates, and then incubated at 30°C (Figures 1, 2D and 3, and Additional file 2: Figure S2) and 25°C (Additional file 3: Figure S3B, C). Figure 4A-C illustrates the cells that were streaked on SSA plates and incubated at 30°C. For experiments with temperature-sensitive mutants, cells were spotted onto SPA and incubated at 25°C, and then transferred to 36°C (Figure 2A,E, Additional file 3: Figure S3A). The sporulation efficiency was calculated by counting more than 500 cells under the microscope, and each experiment was repeated three times. We also used h + /h - diploid cells (Figures 2B,C and 5B and Additional file 4: Figure S4).

Table 1 Strains used in this study


To isolate novel spo5 missense mutants, the parental spo5–GFP–kan strain, in which the GFP–Tadh-kan fragment was inserted at the chromosomal spo5 + locus, was constructed. Genomic DNA was isolated from this strain, and a DNA fragment containing the entire coding region of spo5 + with GFP–Tadh1kan genes flanked by 500-bp up- and down-stream sequences, was amplified. The amplified fragment was then subjected to error-prone PCR amplification in order to introduce random mutations to the product, using Ex Taq DNA polymerase (Takara Bio; Japan) with 40 rounds of thermal cycling. The mutagenized fragment was introduced to the homothallic (h 90) wild-type strain JY878, and colonies that conferred G418 resistance were selected. Colonies were then replica-plated to SSA plates, and those that were deficient in sporulation were chosen using iodine staining. To exclude nonsense mutants, GFP fluorescence was monitored and GFP-positive colonies were selected. Standard sequencing methods (using a 3130 Genetic Analyzer; Applied Biosystems) were used to determine the mutation sites (F341L and S365P). The PrimeSTAR mutagenesis kit (Takara Bio) was used to introduce the F341A, F427A, and F341A mutations into the spo5 + gene cloned using the vector pCR2.1-TOPO (Life Technologies; CA, USA). The mutated fragments were then introduced into the spo5::ura4 + strain, in which the spo5 coding region was replaced with the ura4 + cassette. Colonies with correct inserts were selected on YEA plates containing 1 mg/mL 5-fluoro-orotic acid (5-FOA; Wako Pure Chemicals; Japan).


The plasmids containing the pcr1 + gene (pREP3–pcr1 +) and the spo5 + gene (pREP3–spo5 +) were isolated from a cDNA library. The pREP1 plasmids carrying the atf1 +, atf21 +, and atf31 + genes were a gift from Takatomi Yamada [37], and we subsequently replaced their nmt1 promoters with the nmt81 promoter.


An Axioplan2 fluorescence microscope (Zeiss; Germany) equipped with a CoolSNAP HQ2 CCD camera (Photometrics; AZ, USA) and SlideBook software (Leeds Precision; MN, USA) were used to acquire the images presented in Figures 2, 3A,B and 4A, Additional file 2: Figure S2 and Additional file 3: Figure S3A. Single-sectioned images along the Z-axis were captured and deconvolved. Single-cell imaging was performed using the DeltaVision-SoftWoRx system (GE Healthcare; UK) with a CoolSNAP HQ2 CCD camera, as described previously [41]. Briefly, the cells selected for observation were mounted on a glass-bottomed dish (Matsunami Glass; Japan) precoated with lectin and filled with MM–N liquid medium. Serial-sectioned images were acquired along the Z-axis and stacked using the ‘quick projection’ algorithm in SoftWoRx.

To block the Crm1/exportin-dependent nuclear export machinery, 100 ng/mL leptomycin B (LMB) [28] was added to a culture of Spo5-GFP Mei2-mCherry cells. After 60 min incubation at 30°C, cells were subjected to fluorescence microscopy. Mei2-mCherry, an LMB-sensitive meiotic protein, served as a positive control [46].

The rae1-167 strain was a gift from Ravi Dhar [25]. We employed this mutant to arrest mRNA export during meiosis. Cells were incubated on SPA at 25°C for 6 h, and then shifted to a restrictive temperature at 36°C for 3 h prior to microscopic observation.

Electrophoretic mobility shift assay (EMSA) of RNA

As reported previously [47], digoxigenin (DIG)-labeled RNA was prepared from PCR products using the DIG RNA Labeling kit (SP6/T7) (Roche). The RNA-binding reaction was performed using 2 ng of DIG-labeled RNA (control; derived from the GFP sequence, pcr1 and atf21) and 20–200 ng of either recombinant GST, GST-Spo5C (aas 192–567), or GST-Spo5C(FAFA), in 4 μL of a modified KNET buffer consisting of 20 mM KCl, 80 mM NaCl, 2 mM ethylene glycol bis-(2-aminoethylether) tetraacetic acid (EGTA), 50 mM Tris–HCl (pH7.5), 0.05% NP-40, 1 mM MgCl2, 2 mM dithiothreitol, 10% glycerol, and RNase Inhibitor (Roche). RNA with the GFP-coding sequence was used as a negative control. Samples were preincubated at room temperature with 10 μg of carrier Escherichia coli tRNA for 25 min. Labeled RNA was then added and incubated for another 25 min. Samples were analyzed using polyacrylamide gel electrophoresis and electroblotted to a GeneScreen Plus membrane (NEN) using 0.5× Tris-borate-EDTA (TBE) buffer. Signals were detected using a DIG Luminescent Detection Kit (Roche).


Diploid cells expressing Spo5-GFP were cultured in MM + N at 30°C for 15 h, shifted to MM-N (0 h, 30°C) and sampled for RNA extraction after 6 h. Detailed conditions for RNA-IP were described previously [48]. Immunoprecipitated RNA was isolated by phenol-chloroform extraction. For immunoprecipitation, anti-GFP (Roche; GFP monoclonal antibody) and anti-HA (Abcam; 16B12, HA monoclonal antibody) were used. Reverse transcription was performed using the TaKaRa RNA PCR kit (AMV, Ver 3.0; Takara bio).

Other methods

Western blotting, reverse transcription and quantitative PCR were performed according to the same protocols as we described previously [21]. Following oligonucleotides were used in RT-qPCR: pcr1(forward) CCGAATTCTGGAGCGCAAT, pcr1(reverse) CACTCTTTCTTTTTCTGGCGAAA, act1(forward) TGAGGAGCACCCTTGCTTGT, and act1(reverse) TCTTCTCACGGTTGGATTTGG. Inhibition of mRNA transcription by 1,10-phenanthroline was carried out as described precisely by Galipon et al. [49].

Availability of supporting data

The data sets supporting the results of this article are included within the article and its additional files.


  1. van Werven FJ, Amon A: Regulation of entry into gametogenesis. Philos Trans R Soc Lond B Biol Sci. 2011, 366 (1584): 3521-3531. 10.1098/rstb.2011.0081.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  2. Handel MA, Schimenti JC: Genetics of mammalian meiosis: regulation, dynamics and impact on fertility. Nat Rev Genet. 2010, 11 (2): 124-136.

    CAS  PubMed  Google Scholar 

  3. Yamamoto M, Imai Y, Watanabe Y: Mating and sporulation in Schizosaccharomyces pombe. The Molecular and Cellular Biology of the yeast Sacchromyces, Cold Spring Harbor Laboratory Press. 1997, 3: 1037-1106.

    Google Scholar 

  4. Yamamoto M: The selective elimination of messenger RNA underlies the mitosis-meiosis switch in fission yeast. Proc Jpn Acad Ser B Phys Biol Sci. 2010, 86 (8): 788-797. 10.2183/pjab.86.788.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  5. Mata J, Lyne R, Burns G, Bahler J: The transcriptional program of meiosis and sporulation in fission yeast. Nat Genet. 2002, 32 (1): 143-147. 10.1038/ng951.

    Article  CAS  PubMed  Google Scholar 

  6. Mata J, Wilbrey A, Bahler J: Transcriptional regulatory network for sexual differentiation in fission yeast. Genome Biol. 2007, 8 (10): R217-10.1186/gb-2007-8-10-r217.

    Article  PubMed Central  PubMed  Google Scholar 

  7. Amorim MJ, Cotobal C, Duncan C, Mata J: Global coordination of transcriptional control and mRNA decay during cellular differentiation. Mol Syst Biol. 2010, 6: 380-

    Article  PubMed Central  PubMed  Google Scholar 

  8. Horie S, Watanabe Y, Tanaka K, Nishiwaki S, Fujioka H, Abe H, Yamamoto M, Shimoda C: The Schizosaccharomyces pombe mei4+ gene encodes a meiosis-specific transcription factor containing a forkhead DNA-binding domain. Mol Cell Biol. 1998, 18 (4): 2118-2129.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  9. Chu S, Herskowitz I: Gametogenesis in yeast is regulated by a transcriptional cascade dependent on Ndt80. Mol Cell. 1998, 1 (5): 685-696. 10.1016/S1097-2765(00)80068-4.

    Article  CAS  PubMed  Google Scholar 

  10. Winter E: The Sum1/Ndt80 transcriptional switch and commitment to meiosis in Saccharomyces cerevisiae. Microbiol Mol Biol Rev. 2012, 76 (1): 1-15. 10.1128/MMBR.05010-11.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  11. Chu S, DeRisi J, Eisen M, Mulholland J, Botstein D, Brown PO, Herskowitz I: The transcriptional program of sporulation in budding yeast. Science. 1998, 282 (5389): 699-705.

    Article  CAS  PubMed  Google Scholar 

  12. Primig M, Williams RM, Winzeler EA, Tevzadze GG, Conway AR, Hwang SY, Davis RW, Esposito RE: The core meiotic transcriptome in budding yeasts. Nat Genet. 2000, 26 (4): 415-423. 10.1038/82539.

    Article  CAS  PubMed  Google Scholar 

  13. Mendez R, Richter JD: Translational control by CPEB: a means to the end. Nat Rev Mol Cell Biol. 2001, 2 (7): 521-529. 10.1038/35080081.

    Article  CAS  PubMed  Google Scholar 

  14. Harigaya Y, Tanaka H, Yamanaka S, Tanaka K, Watanabe Y, Tsutsumi C, Chikashige Y, Hiraoka Y, Yamashita A, Yamamoto M: Selective elimination of messenger RNA prevents an incidence of untimely meiosis. Nature. 2006, 442 (7098): 45-50. 10.1038/nature04881.

    Article  CAS  PubMed  Google Scholar 

  15. Bresch C, Muller G, Egel R: Genes involved in meiosis and sporulation of a yeast. Mol Gen Genet. 1968, 102 (4): 301-306. 10.1007/BF00433721.

    Article  CAS  PubMed  Google Scholar 

  16. Kishida M, Shimoda C: Genetic mapping of eleven spo genes essential for ascospore formation in the fission yeast Schizosaccharomyces pombe. Curr Genet. 1986, 10 (6): 443-447. 10.1007/BF00419871.

    Article  CAS  PubMed  Google Scholar 

  17. Hirata A, Shimoda C: Electron microscopic examination of sporulation-deficient mutants of the fission yeast Schizosaccharomyces pombe. Arch Microbiol. 1992, 158 (4): 249-255. 10.1007/BF00245240.

    Article  CAS  PubMed  Google Scholar 

  18. Hirata A, Shimoda C: Structural modification of spindle pole bodies during meiosis II is essential for the normal formation of ascospores in Schizosaccharomyces pombe: ultrastructural analysis of spo mutants. Yeast. 1994, 10 (2): 173-183. 10.1002/yea.320100205.

    Article  CAS  PubMed  Google Scholar 

  19. Kasama T, Shigehisa A, Hirata A, Saito TT, Tougan T, Okuzaki D, Nojima H: Spo5/Mug12, a putative meiosis-specific RNA-binding protein, is essential for meiotic progression and forms Mei2 dot-like nuclear foci. Eukaryot Cell. 2006, 5 (8): 1301-1313. 10.1128/EC.00099-06.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  20. Okuzaki D, Kasama T, Hirata A, Ohtaka A, Kakegawa R, Nojima H: Spo5 phosphorylation is essential for its own timely degradation and for successful meiosis in Schizosaccharomyces pombe. Cell Cycle. 2010, 9 (18): 3751-3760. 10.4161/cc.9.18.12937.

    Article  CAS  PubMed  Google Scholar 

  21. Arata M, Sato M, Yamashita A, Yamamoto M: The RNA-binding protein Spo5 promotes meiosis II by regulating cyclin Cdc13 in fission yeast. Genes Cells. 2014, 19 (3): 225-238. 10.1111/gtc.12133.

    Article  CAS  PubMed  Google Scholar 

  22. Maris C, Dominguez C, Allain FH: The RNA recognition motif, a plastic RNA-binding platform to regulate post-transcriptional gene expression. FEBS J. 2005, 272 (9): 2118-2131. 10.1111/j.1742-4658.2005.04653.x.

    Article  CAS  PubMed  Google Scholar 

  23. Murphy R, Watkins JL, Wente SR: GLE2, a saccharomyces cerevisiae homologue of the schizosaccharomyces pombe export factor RAE1, is required for nuclear pore complex structure and function. Mol Biol Cell. 1996, 7 (12): 1921-1937. 10.1091/mbc.7.12.1921.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  24. Kraemer D, Blobel G: mRNA binding protein mrnp 41 localizes to both nucleus and cytoplasm. Proc Natl Acad Sci U S A. 1997, 94 (17): 9119-9124. 10.1073/pnas.94.17.9119.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  25. Brown JA, Bharathi A, Ghosh A, Whalen W, Fitzgerald E, Dhar R: A mutation in the schizosaccharomyces pombe rae1 gene causes defects in poly (A) + RNA export and in the cytoskeleton. J Biol Chem. 1995, 270 (13): 7411-7419. 10.1074/jbc.270.13.7411.

    Article  CAS  PubMed  Google Scholar 

  26. Watanabe M, Fukuda M, Yoshida M, Yanagida M, Nishida E: Involvement of CRM1, a nuclear export receptor, in mRNA export in mammalian cells and fission yeast. Genes Cells. 1999, 4 (5): 291-297. 10.1046/j.1365-2443.1999.00259.x.

    Article  CAS  PubMed  Google Scholar 

  27. Moore MS, Blobel G: The GTP-binding protein Ran/TC4 is required for protein import into the nucleus. Nature. 1993, 365 (6447): 661-663. 10.1038/365661a0.

    Article  CAS  PubMed  Google Scholar 

  28. Kudo N, Wolff B, Sekimoto T, Schreiner EP, Yoneda Y, Yanagida M, Horinouchi S, Yoshida M: Leptomycin B inhibition of signal-mediated nuclear export by direct binding to CRM1. Exp Cell Res. 1998, 242 (2): 540-547. 10.1006/excr.1998.4136.

    Article  CAS  PubMed  Google Scholar 

  29. Thakurta AG, Ho Yoon J, Dhar R: Schizosaccharomyces pombe spPABP, a homologue of Saccharomyces cerevisiae Pab1p, is a non-essential, shuttling protein that facilitates mRNA export. Yeast. 2002, 19 (9): 803-810.

    Article  PubMed  Google Scholar 

  30. Volpi S, Bongiorni S, Fabbretti F, Wakimoto BT, Prantera G: Drosophila rae1 is required for male meiosis and spermatogenesis. J Cell Sci. 2013, 126 (Pt 16): 3541-3551.

    Article  CAS  PubMed  Google Scholar 

  31. Burgess HM, Richardson WA, Anderson RC, Salaun C, Graham SV, Gray NK: Nuclear relocalisation of cytoplasmic poly (A)-binding proteins PABP1 and PABP4 in response to UV irradiation reveals mRNA-dependent export of metazoan PABPs. J Cell Sci. 2011, 124 (Pt 19): 3344-3355.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  32. Zhang T, Delestienne N, Huez G, Kruys V, Gueydan C: Identification of the sequence determinants mediating the nucleo-cytoplasmic shuttling of TIAR and TIA-1 RNA-binding proteins. J Cell Sci. 2005, 118 (Pt 23): 5453-5463.

    Article  CAS  PubMed  Google Scholar 

  33. Cassola A, Frasch AC: An RNA recognition motif mediates the nucleocytoplasmic transport of a trypanosome RNA-binding protein. J Biol Chem. 2009, 284 (50): 35015-35028. 10.1074/jbc.M109.031633.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  34. Watanabe Y, Yamamoto M: Schizosaccharomyces pombe pcr1+ encodes a CREB/ATF protein involved in regulation of gene expression for sexual development. Mol Cell Biol. 1996, 16 (2): 704-711.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  35. Kanoh J, Watanabe Y, Ohsugi M, Iino Y, Yamamoto M: Schizosaccharomyces pombe gad7+ encodes a phosphoprotein with a bZIP domain, which is required for proper G1 arrest and gene expression under nitrogen starvation. Genes Cells. 1996, 1 (4): 391-408. 10.1046/j.1365-2443.1996.d01-247.x.

    Article  CAS  PubMed  Google Scholar 

  36. Wahls WP, Smith GR: A heteromeric protein that binds to a meiotic homologous recombination hot spot: correlation of binding and hot spot activity. Genes Dev. 1994, 8 (14): 1693-1702. 10.1101/gad.8.14.1693.

    Article  CAS  PubMed  Google Scholar 

  37. Morita T, Yamada T, Yamada S, Matsumoto K, Ohta K: Fission yeast ATF/CREB family protein Atf21 plays important roles in production of normal spores. Genes Cells. 2011, 16 (2): 217-230. 10.1111/j.1365-2443.2010.01480.x.

    Article  CAS  PubMed  Google Scholar 

  38. Daga RR, Bolanos P, Moreno S: Regulated mRNA stability of the Cdk inhibitor Rum1 links nutrient status to cell cycle progression. Curr Biol. 2003, 13 (23): 2015-2024. 10.1016/j.cub.2003.10.061.

    Article  CAS  PubMed  Google Scholar 

  39. Bahler J, Wu JQ, Longtine MS, Shah NG, McKenzie A, Steever AB, Wach A, Philippsen P, Pringle JR: Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast. 1998, 14 (10): 943-951. 10.1002/(SICI)1097-0061(199807)14:10<943::AID-YEA292>3.0.CO;2-Y.

    Article  CAS  PubMed  Google Scholar 

  40. Sato M, Dhut S, Toda T: New drug-resistant cassettes for gene disruption and epitope tagging in Schizosaccharomyces pombe. Yeast. 2005, 22 (7): 583-591. 10.1002/yea.1233.

    Article  CAS  PubMed  Google Scholar 

  41. Sato M, Toya M, Toda T: Visualization of fluorescence-tagged proteins in fission yeast: the analysis of mitotic spindle dynamics using GFP-tubulin under the native promoter. Methods Mol Biol. 2009, 545: 185-203. 10.1007/978-1-60327-993-2_11.

    Article  CAS  PubMed  Google Scholar 

  42. Goldfarb DS, Gariepy J, Schoolnik G, Kornberg RD: Synthetic peptides as nuclear localization signals. Nature. 1986, 322 (6080): 641-644. 10.1038/322641a0.

    Article  CAS  PubMed  Google Scholar 

  43. Wychowski C, Benichou D, Girard M: A domain of SV40 capsid polypeptide VP1 that specifies migration into the cell nucleus. EMBO J. 1986, 5 (10): 2569-2576.

    PubMed Central  CAS  PubMed  Google Scholar 

  44. Wolff B, Sanglier JJ, Wang Y: Leptomycin B is an inhibitor of nuclear export: inhibition of nucleo-cytoplasmic translocation of the human immunodeficiency virus type 1 (HIV-1) Rev protein and Rev-dependent mRNA. Chem Biol. 1997, 4 (2): 139-147. 10.1016/S1074-5521(97)90257-X.

    Article  CAS  PubMed  Google Scholar 

  45. Moreno S, Klar A, Nurse P: Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 1991, 194: 795-823.

    Article  CAS  PubMed  Google Scholar 

  46. Sato M, Shinozaki-Yabana S, Yamashita A, Watanabe Y, Yamamoto M: The fission yeast meiotic regulator Mei2p undergoes nucleocytoplasmic shuttling. FEBS Lett. 2001, 499 (3): 251-255. 10.1016/S0014-5793(01)02567-4.

    Article  CAS  PubMed  Google Scholar 

  47. Yamashita A, Shichino Y, Tanaka H, Hiriart E, Touat-Todeschini L, Vavasseur A, Ding DQ, Hiraoka Y, Verdel A, Yamamoto M: Hexanucleotide motifs mediate recruitment of the RNA elimination machinery to silent meiotic genes. Open Biol. 2012, 2 (3): 120014-10.1098/rsob.120014.

    Article  PubMed Central  PubMed  Google Scholar 

  48. Hiriart E, Vavasseur A, Touat-Todeschini L, Yamashita A, Gilquin B, Lambert E, Perot J, Shichino Y, Nazaret N, Boyault C, Lachuer J, Perazza D, Yamamoto M, Verdel A: Mmi1 RNA surveillance machinery directs RNAi complex RITS to specific meiotic genes in fission yeast. EMBO J. 2012, 31 (10): 2296-2308. 10.1038/emboj.2012.105.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  49. Galipon J, Miki A, Oda A, Inada T, Ohta K: Stress-induced lncRNAs evade nuclear degradation and enter the translational machinery. Genes Cells. 2013, 18 (5): 353-368. 10.1111/gtc.12042.

    Article  CAS  PubMed  Google Scholar 

Download references


We are grateful to Drs. Ravi Dhar and Takatomi Yamada for providing the materials. We highly appreciate assistance of Dr. Mayumi Arata and Mr. Yuichi Shichino in quantitative experiments. This work was supported by Grants-in-Aid for Specially Promoted Research and Scientific Research (S) (to M.Y.) and for Scientific Research (C) (to A.Y.) from Japan Society for the Promotion of Science (JSPS), and Grant-in-Aid for Scientific Research on Priority Areas “Cell Proliferation Control” from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) (to M.S.). This work was also supported in part by the Global COE Program (Integrative Life Science Based on the Study of Biosignaling Mechanisms), MEXT, Japan.

Author information

Authors and Affiliations


Corresponding author

Correspondence to Masayuki Yamamoto.

Additional information

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

NT performed the experiments and analyzed the results. AY and MS designed the outline of this study and analyzed the results. MY supervised the work. NT, AY, MS, and MY wrote the manuscript. All authors read and approved the final manuscript.

Electronic supplementary material


Additional file 1: Figure S1: Expression level of mutant Spo5 proteins under meiotic conditions. Cell extracts were prepared from representative spo5 mutant strains incubated on SPA at 25 ºC for 8 hours. They were separated by SDS-PAGE and subjected to western blotting. Each Spo5-GFP protein, which was expressed from the authentic spo5 promoter, was detected with an anti-GFP antibody. α-tubulin was also detected as a loading control. The wild-type strain shown here for comparison carried an additional gene encoding CFP-tagged Atb2, which reacted with both anti-GFP and anti-α-tubulin (lane 1). (TIFF 2 MB)


Additional file 2: Figure S2: Localization of Spo5(FAFA) protein during the progression of meiosis. Localization of WT Spo5 (left) and Spo5(FAFA) (right) was examined at four stages of meiosis, namely horsetail-movement, one-nucleus, two-nuclei, and four-nuclei stages. GFP-tagged Spo5 (green) and the nuclear envelope marker Cut11-4mRFP (red) were detected. Scale bar, 5 μm. (PDF 1 MB)


Additional file 3: Figure S3: Characterization of a novel spo5 missense mutant spo5(S365P). (A) Spo5(S365P)–GFP did not accumulate in the nucleus of the temperature-sensitive rae1-167 cells. Cells were incubated at 25°C for 6 h and then shifted to 36°C for 3 h. Cut11-4mRFP was used as a nuclear envelope marker. (B) At 25°C, WT and spo5(F341L) cells were stained dark brown with iodine vapor and sporulated efficiently, while spo5(S365P) cells were stained light brown and sporulated weakly. The spo5∆ cells showed a white colony and did not sporulate. At 30°C, the two mutants showed nearly white colonies and did not sporulate efficiently, as indicated quantitatively in Figure 1D. (C) Sporulation efficiency of WT and the two spo5 mutant strains at 25°C (n > 500). Error bars indicate standard deviation. (TIFF 2 MB)


Additional file 4: Figure S4: Expression of pcr1 + mRNA is not lowered in spo5∆ cells. (A) Meiosis was induced in spo5 + (WT) and spo5∆ diploid cells, as in Figure 5B, and total RNA was isolated from them every 2 hours. The relative amount of pcr1 + mRNA in spo5 + and spo5∆ cells was determined by RT-qPCR. The quantity of mRNA was normalized to the expression level of act1 mRNA. Error bars show standard deviation. Two independent samples were analyzed for each strain. n = 3, for each sample. (B) Sporulation efficiency was measured for spo5∆ cells harboring either the vector, the pcr1 + clone, or the spo5 + clone. (n > 500) (C) The relative amount of pcr1 + mRNA was determined by RT-qPCR in spo5∆ cells harboring either the vector, the pcr1 + clone, or the spo5 + clone. Total RNA was isolated every 4 hours after the induction of meiosis, and analyzed as in (A). Error bars show standard deviation. (PDF 335 KB)

Authors’ original submitted files for images

Rights and permissions

Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver ( ) applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Togashi, N., Yamashita, A., Sato, M. et al. Functional significance of nuclear export and mRNA binding of meiotic regulator Spo5 in fission yeast. BMC Microbiol 14, 188 (2014).

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI:


  • Fission yeast
  • Meiosis
  • RNA export
  • RNA-binding protein
  • ATF/CREB family