Open Access

Characterization of the hupSL promoter activity in Nostoc punctiformeATCC 29133

  • Marie Holmqvist1,
  • Karin Stensjö1,
  • Paulo Oliveira1,
  • Pia Lindberg2 and
  • Peter Lindblad1Email author
BMC Microbiology20099:54

https://doi.org/10.1186/1471-2180-9-54

Received: 08 October 2008

Accepted: 11 March 2009

Published: 11 March 2009

Abstract

Background

In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively.

Results

Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity.

Conclusion

Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence.

Background

In cyanobacteria there are three enzymes directly involved in hydrogen metabolism; nitrogenase, uptake hydrogenase and bidirectional hydrogenase [13]. During nitrogen fixation, nitrogenase evolves molecular hydrogen (H2) as a by-product. The uptake hydrogenase consumes the H2 to recapture energy, thereby preventing losses from the cells, while the bidirectional hydrogenase has the capacity to both evolve and consume H2 [13]. The exact function of the bidirectional hydrogenase is unknown, but it has been proposed both to play a role in fermentation and to act as an electron valve during photosynthesis [2]. The uptake hydrogenase has been found in all filamentous nitrogen fixing (N2 fixing) cyanobacterial strains examined so far. The enzyme is expressed in the heterocysts (cells specialized for nitrogen fixation) under conditions of combined nitrogen starvation and is functionally connected to nitrogen fixation [1]. Cyanobacterial uptake hydrogenase consists of at least a small subunit, HupS, and a large subunit, HupL and the genes encoding the small and the large subunit, hupS and hupL, have been identified in a number of cyanobacteria [2, 46]. Relatively little is known about the regulation and maturation of the uptake hydrogenases in cyanobacteria and the knowledge is mainly based on studies made in Escherichia coli. The active sites in the large subunits of hydrogenases are very complex and require a set of accessory proteins for their correct assembly and folding, which in E. coli are encoded by hypA-F [7, 8]. Homologues of these genes are present in cyanobacteria [2, 9]. In addition, recently a set of genes within the extended hyp-operon was suggested to be involved in the maturation of the small subunit of the cyanobacterial uptake hydrogenase [10].

Nostoc punctiforme ATCC 29133 (N. punctiforme) is a filamentous dinitrogen fixing cyanobacterium that was originally isolated from the coralloid roots of the cycad Macrozamia [11]. This strain contains a nitrogenase and an uptake hydrogenase, but lacks the bidirectional hydrogenase [12]. In 1998 hupS and hupL were identified and characterized in N. punctiforme [13]. Later on, transcriptional analyses showed that hupS and hupL are transcribed as one operon thereby sharing the same promoter [14]. Furthermore, a transcription start point (tsp) was identified 259 bp upstream the translation start of hupS, with a putative transcription terminator downstream of hupL and a hairpin formation in the intergenic region between hupS and hupL [14]. Upstream of this transcription start point some putative regulatory promoter elements were identified, among them a possible binding site for the transcription factor NtcA [14]. NtcA belongs to the CAP family of transcriptional regulators, and is a global nitrogen regulator in cyanobacteria [15, 16]. In N. punctiforme as well as in Nostoc sp. strain PCC 7120, NtcA is necessary for heterocyst differentiation [17, 18]. NtcA has also been identified as a regulator of several other genes whose expression is either induced or repressed during heterocyst differentiation or in the mature heterocysts [15, 16]. In other bacteria such as Rhodobacter capsulatus, Ralstonia eutropha, Bradyrhizobium japonicum, and Rhodopseudomonas palustris hupSL transcription is upregulated in the presence of H2 by the two component signal transduction system HupT/HoxJ and HupR/HoxA [1923]. This regulatory system is functionally connected to the activity of the H2 sensing hydrogenase HupUV/HoxBC [1923]. In the photosynthetic bacterium Thiocapsa roseopersicina however, the regulation of the uptake hydrogenase by HupR seems to be independent of the presence or absence of H2, and the genes encoding HupT and HupUV are not expressed [24]. The regulation of hupSL by the redox sensing two component signal transduction system consisting of RegA and RegB has been discovered in R. capsulatus [25]. Furthermore, regulation by the nitrogen fixation regulatory protein, NifA, has been reported for Rhizobium leguminosarum bv. Viciae [26, 27]. The function of NifA in activating transcription of hupSL in R.legminosarum is stimulated by the integration host factor (IHF) which facilitates contacts between NifA and the polymerase by binding to and bending the hupSL promoter [27, 28].

The uptake hydrogenase in filamentous dinitrogen fixing cyanobacteria is expressed in the heterocysts [29, 30]. The expression has been shown to be regulated at the transcriptional level in Nostoc muscorum [31], Anabaena variabilis ATCC 29413 [32], N. punctiforme [9] and Nostoc sp. strain PCC 7120 [33]. A transcript is detectable about 24 h after transition from non-N2 fixing to N2 fixing conditions in A. variabilis [32] and N. muscorum [31]. Even though no sensor hydrogenase has been found in cyanobacteria, an upregulated transcription level was detected in the presence of H2 in N. punctiforme [33, 34] and N.muscorum [34]. Interestingly, this upregulation of hupSL expression in response to H2 was not observed in A.variabilis [35]. Putative binding sites for NtcA have, in addition to N. punctiforme [36], also been identified in the hupSL promoter of Nostoc sp. PCC 7422 [37], Lyngbya majuscula CCP 1446/4 [38], Gloeothece sp. ATCC 27152 [39] and A.variabilis [35] and NtcA was also shown to bind to the predicted binding sites [35, 38, 39]. Furthermore, putative IHF binding sites have been identified in the promoter region of N. punctiforme [14] and L. majuscula CCAP 1446/4 [38]. Based on what is known about the regulation of hupSL transcription in cyanobacteria and other bacteria, a regulation of the hupSL operon in N. punctiforme by NtcA is not unlikely.

In this study the binding of purified NtcA to the putative recognition site, previously identified in the hupSL promoter, was examined. The result showed that NtcA does bind to the hupSL promoter in N. punctiforme, even though the hupSL transcription seems to be not strictly dependent on the NtcAcis element identified. Furthermore, regulatory regions in the hupSL promoter in N. punctiforme were mapped by fusing truncated sequences of the hupSL promoter to the either gfp or luxAB, encoding the reporter proteins GFP (Green Fluorescent Protein) and Luciferase respectively. All the longer promoter constructs showed heterocyst specific expression and unexpectedly the shortest promoter construct, a 316 bp DNA fragment stretching from 57 bp upstream the tsp to the translation start point, conferred not only the highest transcription levels but also retained the heterocyst specificity of the expression. This finding is of great interest since it indicates that the information required for a gene to be expressed in heterocysts only might be located in this short DNA sequence.

Methods

Strains and culture conditions

Nostoc punctiforme ATCC 29133 cultures were grown in BG110 medium [40] either in 100 ml Erlenmeyer flasks on a shaking table or on plates containing BG110 medium solidified by 1% noble agar (Difco). Larger volumes of N. punctiforme cultures were grown in 1 L Erlenmeyer flask containing BG110 medium under continuous stirring and sparging with air. All cultures were grown at 25°C at a continuous irradiance of 40 μmol of photons m-2 s-1 (29). For cultures treated by sonication or were electroporated, the BG110 medium was supplemented with 5 mM MOPS (pH 7.8) and 5 mM NH4Cl as a combined nitrogen source. 10 μg/ml ampicillin was used for selection of positive clones after electroporation with the vector constructs. All cloning was done using Escherichia coli strain DH5α grown at 37°C in Luria broth (LB) liquid medium [41], supplemented with 100 μg/ml ampicillin, and on plates containing LB medium solidified with 1% agar and supplemented with 100 μg/ml ampicillin.

PCR, DNA sequencing and sequence analysis

Genomic DNA was isolated from N. punctiforme cultures as previously described [12]. The concentration was determined by absorbance measurements using Cary Win UV (Varian). PCR amplifications were carried out using the high fidelity DNA polymerase Phusion (Finnzymes), according to manufacturer's protocol, in a GeneAmp PCR system 2400 (Applied Biosystem). The primers used in this work are listed in Table 1. All primers were designed using the Primer3 program http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi and blasted against the N. punctiforme genome [42] (JGI Microbial genomes, http://genome.jgi-psf.org/mic_home.html), or in the case of sequencing primers against their corresponding vector sequence (Table 1), to check their specificity. Secondary structure of the primers was analysed with the Primer design utility program http://www.cybergene.se/primerdesign/. Amplified DNA fragments were isolated from agarose gels using the GFX PCR DNA and Gel Band Purification Kit (GE Healthcare), following the manufacturer's instructions. Sequencing reactions were performed by Macrogen Inc. and computer-assisted sequence analyses were performed using BioEdit Sequence Alignment Editor Version 7.0.5.3.
Table 1

Plasmids and primers used in the present study

Plasmids

Reporter gene

Reference

pSUN202

gfp

(2)

pA-gfp

gfp

This study

pB-gfp

gfp

This study

pC-gfp

gfp

This study

pD-gfp

gfp

This study

pE-gfp

gfp

This study

pPprbcL-gfp

gfp

This study

pLR1

luxAB

P Lindberg, unpublished

pA-lux

luxAB

This study

pB-lux

luxAB

This study

pC-lux

luxAB

This study

pD-lux

luxAB

This study

pE-lux

luxAB

This study

pPprbc-Llux

luxAB

This study

Primers

Sequence 5'-3'

Restriction site

GFP

  

CLONING

  

A GFP forward

CGCGGTACCAGGCTTCGAGTCCTTTAGGC

KpnI

B GFP forward

CGCGGTACCTCAATCCCCTAAATTG

KpnI

C GFP forward

CGCGGTACCTTCTAAAATTCTAGGGGGAAATTG

KpnI

D GFP forward

CGCGGTACCGACCTGACACAACGCAGTTC

KpnI

E GFP forward

CGCGGTACCTCACCTTTAAAATCTTAGCCCATT

KpnI

PhupS GFP reverse 1

CGCGAATTCGGGCTAGGTGTTTTTGTATTGT

EcoRI

PhupS GFP reverse 2

CGCCAATTGGGGCTAGGTGTTTTTGTATTGT

MunI

PprbcL GFP forward

CGCGGTACCATCGGGCAAGGATTCT

KpnI

PprbcL GFP reverse

CGCGCAATTGATTTTATCCTTCCCTGAAAT

MunI

CONFIRMATION

  

pSUN202 seq primer forward

CAAGTAGCGAAGCGAGCAG

-

pSUN202 seq primer reverse

TGGGACAACTCCAGTGAAAA

-

LUCIFERASE

  

CLONING

  

A lux forward

CATCTCGTAGGCCCGGTAAT

-

B lux forward

GCGCGAATTCTCAATCCCCTAAATTG

EcoRI

C lux forward

GCGCGAATTCTAAAATTCTAGGGGGAAATTG

EcoRI

D lux forward

GCGCGAATTCGACCTGACACAACGCAGTTC

EcoRI

E lux forward

GCGCGAATTCACCTTTAAAATCTTAGCCCATT

EcoRI

PhupS lux reverse

GCGCGGTACCGGGCTAGGTGTTTTTGTATTGT

KpnI

Pprbc lux forward

GCGCCAATTGCATCGGGCAAGGATTCT

MunI

Pprbc lux reverse

GCGCGGTACCGGCTTGATACCCAGACTTGC

KpnI

CONFIRMATION

  

pLR1 seq forward

AATACCGCACAGATGCGTAA

-

pLR1 seq reverse

CCAATTAGCGAATAGAGCTT

-

EMSA

  

GS forward

GCGCGAATTCCCAATACCTAATACTTAATCCTC

-

GS reverse

GCGCTCTAGATAACAAAGTTAGGTCTTAA

-

Plasmids and primer oligonucleotides designed and used to amplify DNA fragments by PCR for vector construction, confirmation, and generation of cloned promoter fragments. Oligonucleotides designed and used for EMSAs are also shown. Restriction sites inserted in the cloning primers are listed.

Electrophoretic Mobility Shift Assays (EMSA)

The N. punctiforme hupSL promoter region, -370 to -151 bp, relative to the transcriptional start point, was amplified with the primers GS Forward and GS Reverse (see Table 1). The 335 bp and the 229 bp DNA fragments used as unspecific, negative controls were amplified by PCR using pQE-30 (Qiagen) and pBluescript SK+ (Stragene) as template, respectively [43, 44]. The E.coli BL21 (pCSAM70, pREP4) [45], kindly provided by Professor Enrique Flores (University of Seville, Spain) was used to overexpress the Nostoc sp. strain PCC 7120 NtcA fused to a histidine tag. NtcA from Nostoc PCC 7120 shares 100% amino acid identity with NtcA from N. punctiforme and was therefore used in the experiments. The His6-NtcA was purified by using Ni-nitrilotriacetic acid (Ni-NTA) Superflow resin column (Qiagen), according to the manufacturer's instructions. Binding assays were carried out as described [46] with 80 to 100 ng of DNA fragments and different amounts of purified NtcA (0–240 ng). After incubation at 30°C for 30 min, the reaction mixtures were separated by electrophoresis on a 6% (w/v) polyacrylamide non-denaturing gel and the relative positions of the DNA were visualized by staining the gel with ethidium bromide.

Construction of the hupSL promoter deletions fused to gfp

To ensure correct orientation of the PCR generated promoter fragments when cloned in the self replicative, gfp containing, vector pSUN202 [47] (Table 1) restriction sites were included in the primers. A KpnI site was added to the 5' end of the forward primers (A-E GFP forward, PprbcL GFP forward), while an EcoRI site or a MunI site were added to the 5' end of the reverse primers (PhupS GFP reverse 1 and PhupS GFP reverse 2, PprbcL GFP reverse respectively) (Table 1). After PCR amplification, the products were digested with KpnI/EcoRI (promoter fragments B-E) or KpnI/MunI (promoter fragments A and PprbcL) and subcloned upstream the gfp gene into a Shrimp Alkaline Phosphatase (SAP) treated, KpnI/EcoRI digested, pSUN202 to give plasmid pA-gfp to pE-gfp, pPprbcL-gfp. The vector pSUN202 was kindly provided by Professor Michael Summers, California State University, Northridge, US. All enzymes used were from Fermentas and the ligations were made using Quick ligase (NEB). Correct cloning of all promoter fragments to pSUN202 were confirmed by sequencing using pSUN202 seq forward and pSUN202 seq reverse primer (Table 1). Both primers anneal to sites present within the original vector, pSUN202.

Construction of the hupSL promoter deletions fused to luxAB

To ensure correct orientation of the PCR generated promoter fragments when cloned into the self replicable, luxAB containing vector pLR1 (Pia Lindberg, unpublished) (Table 1) restriction sites were included in the primers. An EcoRI or a MunI site was added to the 5' end of the forward primers (B-E lux forward and PprbcL lux forward respectively), and a KpnI site to the 5' end of the reverse primer (PhupS lux reverse, PprbcL lux reverse) (Table 1). Primer A lux forward did not contain any restrictions site. Instead an intrinsic MunI site in the resulting PCR product, (using A lux forward and PhupS lux reverse) was used for further cloning. After PCR amplification, the products were digested with EcoRI/KpnI (promoter fragments B-E) or MunI/KpnI (promoter fragments A, PprbcL lux) and subcloned upstream luxAB into a SAP treated KpnI/EcoRI digested pLR1 to give plasmids pA-lux to pE-lux and pPprbcL-lux. All enzymes used were from Fermentas and the ligations were made using Quick ligase (NEB). Correct cloning for all plasmids were confirmed by sequencing, using pLR1 seq forward and reverse primer (Table 1). Both primers anneal to sites present within the original vector, pLR1.

Transformation of N. punctiformecells and selection of positive clones

500 ml cell culture were harvested 3 days after inoculation and concentrated by centrifugation. The filaments were broken by sonication (Vibra cell VC 130, Sonics,) for 3 × 30 s (1 pulse/s, 20 kHz) to generate a culture with more single cells to allow for better segregation and selection of positive clones. The cell suspension was kept on ice for 30 s between the intervals. Chlorophyll a was extracted with 90% methanol and absorbance read against 665 nm using a Cary Win UV (Varian). The concentration of Chlorophyll a was determined using the extinction coefficient of 78.74 l g-1cm-1 [48].

The vector constructs (pA-E, p1–5, pPprbcL-gfp and pPprbcL-lux) were transferred to N. punctiforme by electroporation. Overnight cultures of sonicated N. punctiforme cells were harvested by centrifugation and washed four times in sterile distilled water. The cells were then concentrated by centrifugation and diluted to a concentration of 50–100 μg Chl a/ml. 10 μg plasmid DNA dissolved in sterile distilled water were added to ice-cooled microcentrifuge tubes followed by 40 μl of concentrated cell culture. The cooled cell suspensions were transferred to an ice-cooled electroporation cuvette (2-mm electrode gap, Eppendorf) and exposed to a single electrical pulse. The pulse was delivered by a Gene-Pulser Xcell Microbial System (Bio-Rad Laboratories) set at 25 μF, 300 Ω and 1.6 kV. Immediately following the discharge, the suspensions were cooled on ice for about 5 min and thereafter transferred to culture flasks, containing ammonium supplemented growth medium, and left over night to recover. The cells were harvested and plated on ammonium supplemented, ampicillin containing plates. The plates were kept at low illumination (2–3 μmol of photons m-2 s-1) and after 2 to 3 weeks of selection, positive colonies were picked and transferred to liquid medium supplemented with ammonium and ampicillin as detailed above. When the colonies had adjusted to the transition from growing on plates to liquid medium they were kept at standard illumination and transferred to plain growth medium to develop heterocysts. The constructs in the transformed cultures were confirmed by colony PCR. The primers used for the colony PCR (pSUN202 seq primer forward and reverse) anneal to the vector sequences flanking the inserted promoter region and hence the product spans the full length of the insert (Table 1).

Fluorescence and luminescence measurements

Fluorescence emission of GFP was measured from whole cells (100 μl N. punctiforme culture at a concentration of 30 μg Chl a/ml) with an excitation wavelength of 488 nm and an emission wavelength of 520 nm using a Molecular Imager PharosFX Plus (Bio-Rad Laboratories). Luminescence from luciferase activity was induced by the addition of the substrate Decanal (n-Decyl Aldehyde, Sigma) to the cyanobacterial suspension. To 100 μl N. punctiforme culture (at a concentration of 30 μg Chl a/ml) 5 μl of a Decanal mixture was added. The mixture consisted of 7.8 μl Decanal, 500 μl Methanol (Fluka) and 500 μl distilled water. Light emission was monitored with a Molecular Imager ChemiDoc XRS System (Bio-Rad Laboratories). Fluorescence and luminescence measurements were performed at room temperature. Measurement data was corrected to the background (cells containing empty vector) and normalized to the chlorophyll a concentration of the samples. All measurements within one experiment were made in triplicate and performed at least three times using two independent clones. The clones containing the constructs pPprbcL-gfp and pPprbcL-lux were used as positive controls. Localization of GFP fluorescence was viewed in a fluorescence microscope (Leica DMRXE, Leica microsystems) with an excitation wavelength of 460–500 nm and an emission wavelength of 512–542 nm. The clone containing the construct pPprbcL-gfp was used as a positive control for localization of GFP fluorescence in vegetative cells. The micrographs were constructed by merging the DIC image with the corresponding fluorescence image for all promoter constructs (A to E, see Fig. 1) and the control construct pPrbcL-gfp in Photoshop CS2. The green color in the micrographs has been enhanced digitally to make the pictures clearer. The degrees of enhancement of green color were different for different constructs and hence no quantitative measurements could be done.
Figure 1

hupSL and its promoter region in Nostoc punctiforme ATCC 29133. Detailed view of the nucleotides in the hupSL promoter region. Putative binding sites for regulatory proteins (IHF and NtcA), the transcription start point and the -35 and the – 10 boxes are marked [14]. Primers used for gel shift assay (see Fig. 2) are shown as arrows in the figure. Below the hupSL promoter sequence, the intergenic region between Npun_R0367 and hupS together with hupS are shown (WT). Furthermore, the five promoter deletion constructs, where truncated versions of the hupSL promoter have been coupled to gfp or luxAB, are also shown (A to E). Total length of the promoter fragments and starting position relative to transcription start point are indicated. The grey lines symbolise the hupSL promoter sequence, and the white lines symbolise the DNA sequence belonging to the vector used for the constructs, pSUN202.

Results

Binding of NtcA to the hupSLpromoter

To elucidate if NtcA binds to the identified NtcA binding site (TGT-N9-ACA), centred at 258.5 bp upstream the tsp (Fig. 1), in the hupSL promoter, Electrophoretic Mobility Shift Assays (EMSA), using the hupSL promoter from N.punctiforme and NtcA protein from Nostoc PCC 7120, were performed (Fig. 2). The result showed that NtcA does indeed interact with the hupSL promoter and retard it on the gel. Two unrelated DNA fragments (335 bp and 229 bp, respectively), with no known NtcA binding sites showed no interaction with NtcA (Fig. 3). This demonstrates the specificity of the binding of NtcA to the 241 bp hupSL promoter fragment.
Figure 2

Electrophoretic Mobility Shift Assays (EMSA). EMSA carried out with NtcA from Nostoc sp. strain PCC 7120 (overexpressed in Escherichia coli and purified before use) and the Nostoc punctiforme ATCC 29133 hupSL promoter region harbouring the putative NtcA binding site (located at -370 bp to -151 bp, relative to the tsp). The mobility shift assays were performed using: two unspecific DNA fragments (II and IV), obtained by PCR amplification of the multiple cloning sites of the plasmids pQE-30 (Qiagen) and pBluescript SK+ (Stratagene), respectively; part of the promoter region of hupSL (III), and different amounts of purified NtcA. The NtcA-hupSL promoter complexes are indicated as I.

Figure 3

Optimization of GFP fluorescence measurements. The curves demonstrate GFP intensity within a culture of transformed Nostoc punctiforme ATCC 29133. The cultures have been transformed with a self replicative vector, pSUN202, where truncated versions of the hupSL promoter have been fused to gfp (constructs A to E). Dilutions of the cultures, ranging from 3–30 μg Chl a/ml, have been plotted against the intensity (%). All dilutions have been measured in triplicates and the total fluorescence in the sample is 100%.

Generation of hupSLreporter gene constructs

To define and identify regulatory regions in the promoter controlling hupSL transcription a deletion analysis of the promoter was carried out. Five hupSL promoter sequences of various lengths (A-E; Fig. 1) were cloned by PCR and coupled to gfp, encoding the reporter protein GFP, or to luxAB encoding the reporter enzyme Luciferase (Fig. 1). The lengths of the truncated promoter fragments were designed according to the positions of the putative binding sites for Integration Host Factor (IHF) and NtcA, identified in the hupSL promoter using bioinformatics (Fig. 1) [14].

Confirmation of the insertion of correct promoter deletions constructs

Cells from N. punctiforme were transformed by electroporation with vector constructs containing various lengths of the hupSL promoter coupled to gfp (A-E) or luxAB (1–5) (Fig. 1). Positive clones were confirmed by colony PCR. The primers used for the colony PCR anneal to the vector sequences flanking the inserted promoter region and hence the product spans the full length of the insert (Table 1). Analysis of the obtained results indicates that all the cloned fragments were of a length expected for the correct construct (data not shown).

Optimization of GFP fluorescence measurements

To be able to compare the GFP expression from the different promoter deletions, dilution series were made to confirm that measurements were done in a range where the GFP signal are linear for all the constructs. The curves show high R2 values, ranging between 0.96 to 1.0, confirming that there is only very little or no saturation of the signal using the cell density chosen for the measurements (assessed by Chlorophyll a concentration) (Fig. 3). Experiments with dilution series of the bioluminescence measurements showed high R2 values ranging from 0.79 – 0.99

Expression from the hupSLpromoter deletions

The measurements of GFP intensity and hence promoter activity were performed on living cells grown under nitrogen fixing conditions. The shortest promoter fragment, E, (stretching from -57 to tsp), showed the highest expression level (Fig. 4) in all experiments. This was also confirmed in the measurements of bioluminescence, where construct E showed the highest expression levels (data not shown). This part of the hupSL promoter lacks the putative IHF and NtcA binding sites (Fig. 1). There were minor variations between the promoter activities of the four longer promoter fragments (construct A-D). The loss of the most upstream putative IHF seems to have a slight positive effect on transcription (construct C) and the loss of the NtcA binding site seems to have a slight negative effect on transcription (construct D). Furthermore, in some of the experiments the promoter activity was almost abolished for construct B, while other experiments showed only a low activity. The part of the promoter retained in construct A but lost in construct B contains no known putative binding sites for transcriptional regulators. It should be noted that the differences of expression between the longer promoter fragments (constructs A-D) were significant within experiments (three independent measurements) but not always between the experiments. However, all experiments showed the same general expression pattern for fragments A-D even though the actual levels differed. The difference between the longer promoter fragments (construct A-D) and the shortest fragment (construct E) were significant between all experiments. As expected, the positive control pPrbcL-gfp showed very high expression levels in all experiments (data not shown).
Figure 4

Expression from the hupSL promoter deletions. Measurements of GFP fluorescence intensity in living cells grown under nitrogen fixing conditions. Nostoc punctiforme ATCC 29133 cells were transformed with vector constructs containing truncated versions of the hupSL-promoter (A-E) fused to the reporter gene gfp (see Figs. 1 and 2). All values are normalised to the expression from the promoter less reporter vector, pSUN202 (negative control) and the GFP intensity is shown as relative intensity compared to the negative control. All measurements were performed in triplicates.

In situ localization of hupSLtranscript

To investigate if the truncated parts of the hupSL promoter, except from being important for the expression levels, also affected the cellular localization of hupSL transcription fluorescence microscopy was used to view the living cells. Furthermore, this study was carried out to analyze if the high transcription level of the shortest promoter fragment (construct E, promoter fragment stretching from -57 to tsp) was the result of a general low expression in all cells rather than high specific expression in the heterocyst. Images of the filaments were taken using bright field and fluorescence microscopy and then merging the images. The micrographs showed that promoter fragments A-D had heterocyst specific expression (Fig. 5). Surprisingly, even the shortest promoter construct E showed a heterocyst specific expression (Fig. 5). The promoter region of PrbcL fused to gfp, used as a positive control, gave, as expected, high expression primarily in vegetative cells [49, 50] (Fig. 5).
Figure 5

In situ localization of hupSL transcript. Micrographs showing localization of the GFP expression from the hupSL promoter in nitrogen fixing filaments of Nostoc punctiforme ATCC 29133. N. punctiforme cells were transformed with a self replicative vector, pSUN202, containing deletions of the hupSL promoter fused to gfp (see Fig. 1). The micrographs were constructed by merging the DIC image with the corresponding fluorescence image for all promoter constructs (A to E, see Fig. 1) and the control construct pPrbcL-gfp. The green color in the micrographs has been enhanced digitally to make pictures clearer and the degree of enhancement differ for different constructs.

Discussion

The transcriptional regulation of hupSL, encoding the cyanobacterial uptake hydrogenase, has here been examined in the heterocystous, nitrogen fixing cyanobacterium Nostoc punctiforme ATCC 29133. The promoter has been characterized by fusing truncated versions of the hupSL promoter to reporter genes. In this study we have chosen to use two different types of reporter genes, gfp and luxAB, encoding GFP and luciferase respectively. GFP, unlike luciferase, has the advantage that it does not require addition of a substrate, which eliminates toxicity and permeability problems [47]. On the other hand GFP, unlike luciferase, is a very stabile protein and tend to accumulate in the cells [51]. In addition, it has been reported that different reporter genes may give very different patterns of expression for a single promoter if these promoters are sensitive to DNA topology [52]. Similarly, it was shown that the CAT reporter system exerts unusual effects on various gene promoters, including silencer activities, which did not represent the true regulatory mechanisms [53]. To strengthen the results of the study, and to avoid drawing conclusions about anomalies occurring from studying the expression of an exogenous protein, both reporter systems were used in parallel in this study.

Putative binding sites of NtcA have been identified and confirmed in the hupSL promoter of several cyanobacteria. The NtcA binding site identified in N. punctiforme differs from the optimal consensus NtcA binding site (GTAN8TAC) usually found in NtcA activated promoters. These NtcA activated promoters contain an E. coli like σ70 -10 box and the NtcA site is centred approximately 41.5 bp upstream the tsp where an E. coli σ70 like -35 box is usually found [16]. These characteristics makes the NtcA activated promoters similar to class II, CAP-activated, promoters [16]. However the NtcA consensus sequence identified in N. punctiforme (TGT-N9-ACA) has also been reported for several other promoters, for example in promoters of rbcL, xisA and gor in Nostoc sp. PCC 7120 [54] and for hupSL in A. variabilis ATCC 29413 [35] and is believed to represent a weaker binding site [54]. The binding of NtcA to the TGT-N9-ACA consensus binding sequence in the hupSL promoter has been shown in A.variabilis [35] and was also demonstrated here for N. punctiforme (Fig. 2). NtcA bound specifically to a 241 bp DNA fragment of the N. punctiforme hupSL promoter containing the putative NtcA binding site. In a recent study, using an ntcA mutant, the hupSL expression in A. variabilis was shown to be directly, or indirectly, regulated by NtcA [35]. However, the importance of the NtcA binding site for hupSL transcription in N. punctiforme seems to be rather low (Fig. 5) since the presence or absence of the NtcA binding site in the hupSL promoter had no major effect on the transcription of GFP, or Luciferase, in the promoter deletion study presented here. In the hupSL promoter of N. punctiforme the putative NtcA binding site is located quite far upstream of the tsp (centered at -258.5 bp) (Fig. 1). NtcA binding sites at distances greater than given for NtcA activated promoters have been reported earlier [15]. However, it can not be excluded that this NtcA binding site is not regulating hupSL transcription, but instead the transcription of the gene of unknown function located upstream of hupS, Npun_R0367. This gene is located in the opposite DNA strand compared to hupSL and the putative NtcA binding site is centred at 234.5 bp upstream the translation start site of Npun_R0367 (Fig. 1). A recent study has suggested this ORF to encode a protein involved in the maturation of the small subunit, HupS, of cyanobacteria hydrogenases [10]. A regulation of this gene by NtcA would therefore not be unlikely. The regulation of hupSL expression differs between different strains of cyanobacteria. For example in A. variabilis ATCC 29413, a strain expressing an alternative vanadium containing nitrogenase during molybdenum limiting conditions [55], and a second Mo-depending nitrogenase both in heterocysts and vegetative cells during anaerobic conditions [56], a low expression of hupSL could be detected in vegetative cells. Furthermore, hupSL transcription has been shown to be upregulated by the presence of H2 in some Nostoc strains [33, 34] but not in A. variabilis [35]. Due to these differences between strains variations in the regulation of hupSL transcription between A. variabilis ATCC 29413 and N. punctiforme are expected.

The differences in promoter activity between promoter fragments A-D, (Fig. 4) were not always significant between the experiments. However, when comparing different experiments, the same overall expression patterns were seen. One explanation for the variation of expression between experiments for construct A-D could be e.g. slight variations in age of the heterocysts between the experiments. Due to this variation between experiments one should be careful in making conclusions about the importance of these differences in transcription levels between constructs A – D. Looking at individual experiments, presence of the NtcA binding site combined with the loss of the most upstream putative IHF binding, site seem to have a slight positive effect on transcription, as well as the loss of the most downstream IFH binding site. There is also room to speculate that there is some positive regulation located upstream the previously identified putative binding sites in the hupSL promoter (Figs. 1 and 5), however further experimental studies, with for example directed mutagenesis, are necessary. This is also true for promoter fragment B, which unique part contains no known putative binding sites for transcriptional regulators. Still, in some experiments the promoter activity was abolished while others showed only a low activity – a finding that deserves further attention.

In this paper we have shown that the part of the hupSL promoter region that gave the highest expression level is limited to a 316 bp DNA fragment stretching from -57 (in relation to tsp) to the translation start site (Fig. 4). Not only does this short promoter confer a high transcription level, it also retains heterocyst specificity. A loss of heterocyst specificity could have lead to a misleading conclusion of high promoter activity: the promoter would have shown high total expression, due to expression in all cells, even if the promoter activity was still low. However the fact that this promoter fragment kept heterocyst specificity (Fig. 5) enables us to draw the conclusion that the activity of the shortest promoter is truly higher than for the other promoter fragments. One assumption could be that heterocyst specificity of expression is due to a transcription factor binding to the hupSL promoter and stimulating transcription in heterocysts. However, another possibility could be that hupSL is constitutively transcribed and that vegetative cells contain a repressor lacking in heterocysts which restrain transcription in that cell type. If the heterocyst specificity is mediated by an activator binding the short promoter sequence upstream the tsp (or perhaps the untranslated leader region downstream the tsp) or by a repressor only present in vegetative cells needs to be subjected to further investigations. Further characterization of this short promoter region will not only give information about what promotes hupSL transcription but can also help answering the question what directs heterocyst specific expression of genes and pattern formation in N. punctiforme, and perhaps other heterocystous, filamentous cyanobacteria.

Conclusion

The result that the 57 bp promoter is a highly active promoter is most interesting and will be investigated further. This short DNA sequence, and its 258 bp untranslated leader region downstream the tsp, appears to harbour enough information to make the transcription to occur in heterocysts only. Taken one step further, if this information conferring heterocyst specific transcription can be elucidated it will give clues to what signals are involved in heterocyst specific gene expression and pattern formation in filamentous cyanobacteria.

Declarations

Acknowledgements

This work was supported by the Swedish Energy Agency, the Knut and Alice Wallenberg Foundation, the Nordic Energy Research Program (project BioH2), EU/NEST FP6 project BioModularH2 (contract # 043340) and the EU/Energy FP7 project SOLAR-H2 (contract # 212508).

Authors’ Affiliations

(1)
Department of Photochemistry and Molecular Science, The Ångström Laboratories, Uppsala University
(2)
Department of Plant and Microbial Biology, University of California

References

  1. Tamagnini P, Axelsson R, Lindberg P, Oxelfelt F, Wunschiers R, Lindblad P: Hydrogenases and hydrogen metabolism of cyanobacteria. Microbiol Mol Biol Rev. 2002, 66 (1): 1-20. 10.1128/MMBR.66.1.1-20.2002.PubMed CentralPubMedView ArticleGoogle Scholar
  2. Tamagnini P, Leitao E, Oliveira P, Ferreira D, Pinto F, Harris DJ, Heidorn T, Lindblad P: Cyanobacterial hydrogenases: diversity, regulation and applications. FEMS Microbiol Rev. 2007, 31 (6): 692-720. 10.1111/j.1574-6976.2007.00085.x.PubMedView ArticleGoogle Scholar
  3. Sakurai H, Masukawa H: Promoting R & D in photobiological hydrogen production utilizing mariculture-raised cyanobacteria. Mar Biotechnol. 2007, 9 (2): 128-145. 10.1007/s10126-006-6073-x.PubMedView ArticleGoogle Scholar
  4. Vignais PM, Colbeau A: Molecular biology of microbial hydrogenases. Curr Issues Mol Biol. 2004, 6 (2): 159-188.PubMedGoogle Scholar
  5. Vignais PM, Billoud B, Meyer J: Classification and phylogeny of hydrogenases. FEMS Microbiol Rev. 2001, 25 (4): 455-501.PubMedView ArticleGoogle Scholar
  6. Volbeda A, Charon MH, Piras C, Hatchikian EC, Frey M, Fontecilla-Camps JC: Crystal structure of the nickel-iron hydrogenase from Desulfovibrio gigas. Nature. 1995, 373 (6515): 580-587. 10.1038/373580a0.PubMedView ArticleGoogle Scholar
  7. Bock A, King PW, Blokesch M, Posewitz MC: Maturation of hydrogenases. Adv Microb Physiol. 2006, 51: 1-71. 10.1016/S0065-2911(06)51001-X.PubMedView ArticleGoogle Scholar
  8. Forzi L, Sawers RG: Maturation of [NiFe]-hydrogenases in Escherichia coli. Biometals. 2007, 20 (3–4): 565-578. 10.1007/s10534-006-9048-5.PubMedView ArticleGoogle Scholar
  9. Hansel A, Axelsson R, Lindberg P, Troshina OY, Wunschiers R, Lindblad P: Cloning and characterisation of a hyp gene cluster in the filamentous cyanobacterium Nostoc sp. strain PCC 73102. FEMS Microbiol Lett. 2001, 201 (1): 59-64. 10.1111/j.1574-6968.2001.tb10733.x.PubMedView ArticleGoogle Scholar
  10. Agervald A, Stensjo K, Holmqvist M, Lindblad P: Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120. BMC Microbiol. 2008, 8: 69-10.1186/1471-2180-8-69.PubMed CentralPubMedView ArticleGoogle Scholar
  11. Rippka R, Herdman M: Pasteur Culture Collection of Cyanobacterial Strains in Axenic Culture. Catalogue and Taxonomic Handbook. Catalogue of Strains. 1992, Institute Pasteur, Paris, France, 1:Google Scholar
  12. Tamagnini P, Troshina O, Oxelfelt F, Salema R, Lindblad P: Hydrogenases in Nostoc sp. Strain PCC 73102, a Strain Lacking a Bidirectional Enzyme. Appl Environ Microbiol. 1997, 63 (5): 1801-1807.PubMed CentralPubMedGoogle Scholar
  13. Oxelfelt F, Tamagnini P, Lindblad P: Hydrogen uptake in Nostoc sp. strain PCC 73102. Cloning and characterization of a hupSL homologue. Arch Microbiol. 1998, 169 (4): 267-274. 10.1007/s002030050571.PubMedView ArticleGoogle Scholar
  14. Lindberg P, Hansel A, Lindblad P: hupS and hupL constitute a transcription unit in the cyanobacterium Nostoc sp. PCC 73102. Arch Microbiol. 2000, 174 (1–2): 129-133. 10.1007/s002030000186.PubMedView ArticleGoogle Scholar
  15. Herrero A, Muro-Pastor AM, Valladares A, Flores E: Cellular differentiation and the NtcA transcription factor in filamentous cyanobacteria. FEMS Microbiol Rev. 2004, 28 (4): 469-487.PubMedView ArticleGoogle Scholar
  16. Herrero A, Muro-Pastor AM, Flores E: Nitrogen control in cyanobacteria. J Bacteriol. 2001, 183 (2): 411-425. 10.1128/JB.183.2.411-425.2001.PubMed CentralPubMedView ArticleGoogle Scholar
  17. Wong FC, Meeks JC: Establishment of a functional symbiosis between the cyanobacterium Nostoc punctiforme and the bryophyte Anthoceros punctatus requires genes involved in nitrogen control and initiation of heterocyst differentiation. Microbioogy. 2002, 148 (Pt 1): 315-523.View ArticleGoogle Scholar
  18. Wei TF, Ramasubramanian TS, Golden JW: Anabaena sp. strain PCC 7120 ntcA gene required for growth on nitrate and heterocyst development. J Bacteriol. 1994, 176 (15): 4473-4482.PubMed CentralPubMedGoogle Scholar
  19. Dischert W, Vignais PM, Colbeau A: The synthesis of Rhodobacter capsulatus HupSL hydrogenase is regulated by the two-component HupT/HupR system. Mol Microbiol. 1999, 34 (5): 995-1006. 10.1046/j.1365-2958.1999.01660.x.PubMedView ArticleGoogle Scholar
  20. Lenz O, Bernhard M, Buhrke T, Schwartz E, Friedrich B: The hydrogen-sensing apparatus in Ralstonia eutropha. J Mol Microbiol Biotechnol. 2002, 4 (3): 255-262.PubMedGoogle Scholar
  21. Van Soom C, de Wilde P, Vanderleyden J: HoxA is a transcriptional regulator for expression of the hup structural genes in free-living Bradyrhizobium japonicum. Mol Microbiol. 1997, 23 (5): 967-977. 10.1046/j.1365-2958.1997.2781648.x.PubMedView ArticleGoogle Scholar
  22. Rey FE, Oda Y, Harwood CS: Regulation of uptake hydrogenase and effects of hydrogen utilization on gene expression in Rhodopseudomonas palustris. J Bacteriol. 2006, 188 (17): 6143-6152. 10.1128/JB.00381-06.PubMed CentralPubMedView ArticleGoogle Scholar
  23. Schwartz E, Gerischer U, Friedrich B: Transcriptional regulation of Alcaligenes eutrophus hydrogenase genes. J Bacteriol. 1998, 180 (12): 3197-3204.PubMed CentralPubMedGoogle Scholar
  24. Kovacs AT, Rakhely G, Balogh J, Maroti G, Cournac L, Carrier P, Meszaros LS, Peltier G, Kovacs KL: Hydrogen independent expression of hupSL genes in Thiocapsa roseopersicina BBS. FEBS J. 2005, 272 (18): 4807-4816. 10.1111/j.1742-4658.2005.04896.x.PubMedView ArticleGoogle Scholar
  25. Elsen S, Dischert W, Colbeau A, Bauer CE: Expression of uptake hydrogenase and molybdenum nitrogenase in Rhodobacter capsulatus is coregulated by the RegB-RegA two-component regulatory system. J Bacteriol. 2000, 182 (10): 2831-2837. 10.1128/JB.182.10.2831-2837.2000.PubMed CentralPubMedView ArticleGoogle Scholar
  26. Martinez M, Colombo MV, Palacios JM, Imperial J, Ruiz-Argueso T: Novel arrangement of enhancer sequences for NifA-dependent activation of the hydrogenase gene promoter in Rhizobium leguminosarum bv. viciae. J Bacteriol. 2008, 190 (9): 3185-3191. 10.1128/JB.00107-08.PubMed CentralPubMedView ArticleGoogle Scholar
  27. Brito B, Martinez M, Fernandez D, Rey L, Cabrera E, Palacios JM, Imperial J, Ruiz-Argueso T: Hydrogenase genes from Rhizobium leguminosarum bv. viciae are controlled by the nitrogen fixation regulatory protein nifA. Proc Natl Acad Sci USA. 1997, 94 (12): 6019-6024. 10.1073/pnas.94.12.6019.PubMed CentralPubMedView ArticleGoogle Scholar
  28. Lee HS, Berger DK, Kustu S: Activity of purified NIFA, a transcriptional activator of nitrogen fixation genes. Proc Natl Acad Sci USA. 1993, 90 (6): 2266-2270. 10.1073/pnas.90.6.2266.PubMed CentralPubMedView ArticleGoogle Scholar
  29. Houchins JP, Burris RH: Occurrence and localization of two distinct hydrogenases in the heterocystous cyanobacterium Anabaena sp. strain 7120. J Bacteriol. 1981, 146 (1): 209-214.PubMed CentralPubMedGoogle Scholar
  30. Carrasco CD, Buettner JA, Golden JW: Programed DNA rearrangement of a cyanobacterial hupL gene in heterocysts. Proc Natl Acad Sci USA. 1995, 92 (3): 791-795. 10.1073/pnas.92.3.791.PubMed CentralPubMedView ArticleGoogle Scholar
  31. Axelsson R, Oxelfelt F, Lindblad P: Transcriptional regulation of Nostoc uptake hydrogenase. FEMS Microbiol Lett. 1999, 170 (1): 77-81. 10.1111/j.1574-6968.1999.tb13357.x.PubMedView ArticleGoogle Scholar
  32. Happe T, Schutz K, Bohme H: Transcriptional and mutational analysis of the uptake hydrogenase of the filamentous cyanobacterium Anabaena variabilis ATCC 29413. J Bacteriol. 2000, 182 (6): 1624-1631. 10.1128/JB.182.6.1624-1631.2000.PubMed CentralPubMedView ArticleGoogle Scholar
  33. Stensjö K, Ow SY, Barrios-Llerena ME, Lindblad P, Wright PC: An iTRAQ-based quantitative analysis to elaborate the proteomic response of Nostoc sp. PCC 7120 under N2 fixing conditions. J Proteome Res. 2007, 6 (2): 621-635. 10.1021/pr060517v.PubMedView ArticleGoogle Scholar
  34. Axelsson R, Lindblad P: Transcriptional regulation of Nostoc hydrogenases: effects of oxygen, hydrogen, and nickel. Appl Environ Microbiol. 2002, 68 (1): 444-447. 10.1128/AEM.68.1.444-447.2002.PubMed CentralPubMedView ArticleGoogle Scholar
  35. Weyman PD, Pratte B, Thiel T: Transcription of hupSL in Anabaena variabilis ATCC 29413 is regulated by NtcA and not by hydrogen. Appl Environ Microbiol. 2008, 74 (7): 2103-2110. 10.1128/AEM.02855-07.PubMed CentralPubMedView ArticleGoogle Scholar
  36. Lindberg P: Cyanobacterial Hydrogen Metabolism – Upptake Hydrogenase and Hydrogen Production by Nitrogenase in Filamentous Cyanobacteria. PhD thesis. 2003, Uppsala: Uppsala UniversityGoogle Scholar
  37. Yoshino F, Ikeda H, Masukawa H, Sakurai H: High photobiological hydrogen production activity of a Nostoc sp. PCC 7422 uptake hydrogenase-deficient mutant with high nitrogenase activity. Marine Biotechnol. 2007, 9 (1): 101-112. 10.1007/s10126-006-6035-3.View ArticleGoogle Scholar
  38. Leitao E, Oxelfelt F, Oliveira P, Moradas-Ferreira P, Tamagnini P: Analysis of the hupSL operon of the nonheterocystous cyanobacterium Lyngbya majuscula CCAP 1446/4: regulation of transcription and expression under a light-dark regimen. Appl Environ Microbiol. 2005, 71 (8): 4567-4576. 10.1128/AEM.71.8.4567-4576.2005.PubMed CentralPubMedView ArticleGoogle Scholar
  39. Oliveira P, Leitao E, Tamagnini P, Moradas-Ferreira P, Oxelfelt F: Characterization and transcriptional analysis of hupSLW in Gloeothece sp. ATCC 27152: an uptake hydrogenase from a unicellular cyanobacterium. Microbiol. 2004, 150 (11): 3647-3655. 10.1099/mic.0.27248-0.View ArticleGoogle Scholar
  40. Rippka R, Neilson A, Kunisawa R, Cohen-Bazire G: Nitrogen fixation by unicellular blue-green algae. Arch Mikrobiol. 1971, 76 (4): 341-348. 10.1007/BF00408530.PubMedView ArticleGoogle Scholar
  41. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory Manual. 1989, USA: Cold Spring Harbour Laboratory PressGoogle Scholar
  42. Meeks JC, Elhai J, Thiel T, Potts M, Larimer F, Lamerdin J, Predki P, Atlas R: An overview of the genome of Nostoc punctiforme, a multicellular, symbiotic cyanobacterium. Photosynth Res. 2001, 70 (1): 85-106. 10.1023/A:1013840025518.PubMedView ArticleGoogle Scholar
  43. Sjöholm J, Oliveira P, Lindblad P: Transcription and Regulation of the Bidirectional Hydrogenase in the Cyanobacterium Nostoc sp. Strain PCC 7120. Appl Environ Microbiol. 2007, 73 (17): 5435-5446. 10.1128/AEM.00756-07.PubMed CentralPubMedView ArticleGoogle Scholar
  44. Oliveira P, Lindblad P: An AbrB-Like Protein Regulates the Expression of the Bidirectional Hydrogenase in Synechocystis sp. Strain PCC 6803. J Bacteriol. 2008, 190 (3): 1011-1019. 10.1128/JB.01605-07.PubMed CentralPubMedView ArticleGoogle Scholar
  45. Muro-Pastor AM, Valladares A, Flores E, Herrero A: The hetC Gene Is a Direct Target of the NtcA Transcriptional Regulator in Cyanobacterial Heterocyst Development. J Bacteriol. 1999, 181 (21): 6664-6669.PubMed CentralPubMedGoogle Scholar
  46. Montesinos ML, Muro-Pastor AM, Herrero A, Flores E: Ammonium/Methylammonium Permeases of a Cyanobacterium. Identification and analysis of three nitrogen-regulated amt genes in Synechocystis sp. PCC 6803. J Biol Chem. 1998, 273 (47): 31463-31470. 10.1074/jbc.273.47.31463.PubMedView ArticleGoogle Scholar
  47. Argueta C, Yuksek K, Summers M: Construction and use of GFP reporter vectors for analysis of cell-type-specific gene expression in Nostoc punctiforme. J Microbiol Methods. 2004, 59 (2): 181-188. 10.1016/j.mimet.2004.06.009.PubMedView ArticleGoogle Scholar
  48. Meeks JC, Castenholz RW: Growth and photosynthesis in an extreme thermophile, Synechococcus lividus (Cyanophyta). Arch Mikrobiol. 1971, 78 (1): 25-41. 10.1007/BF00409086.PubMedView ArticleGoogle Scholar
  49. Elhai J, Wolk CP: Developmental regulation and spatial pattern of expression of the structural genes for nitrogenase in the cyanobacterium Anabaena. Embo J. 1990, 9 (10): 3379-3388.PubMed CentralPubMedGoogle Scholar
  50. Yoon HS, Golden JW: Heterocyst pattern formation controlled by a diffusible peptide. Science. 1998, 282 (5390): 935-938. 10.1126/science.282.5390.935.PubMedView ArticleGoogle Scholar
  51. Jansson JK: Marker and reporter genes: illuminating tools for environmental microbiologists. Curr Opin Microbiol. 2003, 6 (3): 310-316. 10.1016/S1369-5274(03)00057-2.PubMedView ArticleGoogle Scholar
  52. Forsberg AJ, Pavitt GD, Higgins CF: Use of transcriptional fusions to monitor gene expression: a cautionary tale. J Bacteriol. 1994, 176 (7): 2128-2132.PubMed CentralPubMedGoogle Scholar
  53. Zhang K, Kurachi S, Kurachi K: Limitation in use of heterologous reporter genes for gene promoter analysis. Silencer activity associated with the cloramphenicol acetyltransferase reporter gene. J Biol Chem. 2003, 278 (7): 4826-4830. 10.1074/jbc.M211361200.PubMedView ArticleGoogle Scholar
  54. Jiang F, Wisen S, Widersten M, Bergman B, Mannervik B: Examination of the transcription factor NtcA-binding motif by in vitro selection of DNA sequences from a random library. J Mol Biol. 2000, 301 (4): 783-793. 10.1006/jmbi.2000.4000.PubMedView ArticleGoogle Scholar
  55. Thiel T: Characterization of genes for an alternative nitrogenase in the cyanobacterium Anabaena variabilis. J Bacteriol. 1993, 175 (19): 6276-6286.PubMed CentralPubMedGoogle Scholar
  56. Thiel T, Lyons EM, Erker JC, Ernst A: A second nitrogenase in vegetative cells of a heterocyst-forming cyanobacterium. Proc Natl Acad Sci USA. 1995, 92 (20): 9358-9362. 10.1073/pnas.92.20.9358.PubMed CentralPubMedView ArticleGoogle Scholar

Copyright

© Holmqvist et al; licensee BioMed Central Ltd. 2009

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement