Skip to main content


We're creating a new version of this page. See preview

  • Research article
  • Open Access

Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression

  • 1, 6,
  • 2,
  • 1,
  • 1, 7,
  • 3,
  • 4,
  • 4,
  • 4,
  • 2,
  • 4,
  • 5,
  • 2,
  • 1 and
  • 1Email author
BMC Microbiology20088:211

  • Received: 02 July 2008
  • Accepted: 03 December 2008
  • Published:



In man, infection by the Gram-negative enteropathogen Yersinia pseudotuberculosis is usually limited to the terminal ileum. However, in immunocompromised patients, the microorganism may disseminate from the digestive tract and thus cause a systemic infection with septicemia.


To gain insight into the metabolic pathways and virulence factors expressed by the bacterium at the blood stage of pseudotuberculosis, we compared the overall gene transcription patterns (the transcriptome) of bacterial cells cultured in either human plasma or Luria-Bertani medium. The most marked plasma-triggered metabolic consequence in Y. pseudotuberculosis was the switch to high glucose consumption, which is reminiscent of the acetogenic pathway (known as "glucose overflow") in Escherichia coli. However, upregulation of the glyoxylate shunt enzymes suggests that (in contrast to E. coli) acetate may be further metabolized in Y. pseudotuberculosis. Our data also indicate that the bloodstream environment can regulate major virulence genes (positively or negatively); the yadA adhesin gene and most of the transcriptional units of the pYV-encoded type III secretion apparatus were found to be upregulated, whereas transcription of the pH6 antigen locus was strongly repressed.


Our results suggest that plasma growth of Y. pseudotuberculosis is responsible for major transcriptional regulatory events and prompts key metabolic reorientations within the bacterium, which may in turn have an impact on virulence.


The Gram-negative bacterium Y. pseudotuberculosis is a human enteropathogen which is able to cross the intestinal mucosa through the M cells in Peyer's patches and thus infect the underlying tissues (causing ileitis and mesenteric lymphadenitis). However, in elderly or debilitated individuals (those suffering from malignancies, immunodeficiencies, chronic liver diseases or diabetes mellitus, for example), the organism frequently gains access to the bloodstream and can cause an often fatal septicemia [1, 2]. Known Y. pseudotuberculosis virulence genes are transcriptionally regulated by temperature – most probably in order to adapt to the bacterium's life cycle outside and inside the host. Regulation by the omnipresent thermal stimulus can be modulated (via a wide range of mechanisms) by signals such as pH, other ion concentrations and nutrient availability (reviewed in [3]). This allows bacterial pathogens to (i) adapt their gene transcription profiles in response to environmental cues sensed during the course of infection and (ii) express the most appropriate virulence factors at the expense of useless (or even detrimental) ones.

To date, the transcriptional gene regulation occurring when Y. pseudotuberculosis enters the human bloodstream has only been inferred indirectly from in vivo results in rodent models of infection [4, 5] and in vitro gene transcription studies. The in vitro regulation of certain Yersinia virulence loci has mainly been analyzed with respect to single growth parameter changes mimicking the environmental signals known (or assumed) to be detected by bacteria in blood, such as iron scarcity, oxygen tension and pH [6, 7]. In the present work, we have adopted an intermediate approach by comparing the overall gene expression profiles of Y. pseudotuberculosis grown in human plasma and in Luria-Bertani broth. We then compared the observed variations with those recently published for Y. pestis [8], an almost genetically identical pathogen which, however, causes plague – one of the most severe systemic infections in humans and other mammals.

Results and discussion

The genome of Y. pseudotuberculosis strain IP32953 has been recently deciphered: it contains 3,951 coding sequences (CDSs), of which 99 are borne by the virulence-associated plasmid pYV and 43 are carried by a 27-kb cryptic plasmid. Only around 49% of CDSs encode a product with a putative or proven function [9]. To gain insight into the transcriptional regulation of virulence and metabolism genes that takes place when Y. pseudotuberculosis enters and multiplies in the bloodstream, we compared the transcriptome of IP32953 grown in human plasma to the one of the same strain grown in Luria-Bertani (LB). To this end, we prepared macroarrays composed of 3,674 PCR fragments of ≈ 400-base pairs (bp), covering 96% of IP32953's CDSs and used them as described elsewhere [8] and in the Methods section. Briefly, in three independent cultures, total RNA was extracted from IP32953 cells grown in LB broth or human plasma, in the exponential or stationary phase and at 28°C or 37°C. Macroarray probing was performed three times with independently retrotranscribed and 33P-radiolabeled RNA samples from each of the eight growth combinations. After macroarray imaging, hybridization intensity data were log-transformed and normalized using a simple median normalization method. Relative data have been deposited in the Genoscript database in accordance with standards of the Microarray Gene Expression Data Society (MGED). An analysis of variance (ANOVA) was carried out independently for each gene, with the three biological factors of variation (medium, temperature and growth phase) as fixed effects. This statistical approach allowed us to evaluate the transcriptional variations induced by each factor for the dataset as a whole. Thus, three ratios (corresponding to each parameter) and associated p-values were calculated for each gene. Inter-condition transcriptional differences were considered to be statistically significant if the p-value was below 0.05. Representative macroarray hybridization results were confirmed by qRT-PCR on stored RNA samples, using the constitutively expressed YPTB0775 gene (spot ID YPO3356 and coding for the outer membrane lipoprotein NplD) as a reference (Additional file 1). Since the physiological status of the bacterium during host infection is unknown, we focused our analysis on genes regulated by the temperature and/or the medium in both the exponential and stationary phases. All Y. pseudotuberculosis transcriptional variations discussed herein were compared with those of their respective Y. pestis orthologs and are summarized in Table 1. Y. pseudotuberculosis IP32953 genes regulated at the transcriptional level by growth temperature and/or medium are listed in Tables 2 and 3.
Table 1

Y. pseudotuberculosis transcriptional variations discussed in this article compared with those recently published for Y. pestis [8]

Locus tags


gene transcription fold ratio human plasma/Luria Bertani broth (p-value)

Y. pseudotuberculosis

Y. pestis

Gene Name

Putative product/function

Y. pseudotuberculosis

Y. pestis

Iron uptake and storage






(< 0.001)






ABC hemin transporter, ATP-binding subunit HmuV








ABC transporter, periplasmic hemin-binding protein HmuT








possible hemin degradation/transport protein HmuS




(< 0.001)




TonB-dependent outer membrane hemin receptor, HmuR


(< 0.001)


(< 0.001)




putative ABC type hydroxymate-dependent iron transport ATP binding protein








putative ABC type hydroxamate-dependent iron uptake ATP binding protein








putative ABC type periplasmic iron siderophore/cobalamin binding protein


(< 0.001)






putative siderophore/cobalamin ABC transporter, ATP-binding subunit


(< 0.001)






putative heme-binding protein


(< 0.001)






putative ABC transporter ATP-binding protein








putative membrane protein








putative ferric iron reductase


(< 0.001)


(< 0.001)




putative decarboxylase


(< 0.001)






putative siderophore biosynthetic enzyme








putative siderophore biosynthetic enzyme








putative OMR family iron-siderophore receptor


(< 0.001)






TonB protein


(< 0.001)






ABC transporter, periplasmic iron siderophore-binding protein YfeA


(< 0.001)


(< 0.001)




ABC chelated iron transporter, ATP-binding subunit YfeB


(< 0.001)






ABC chelated iron transporter, permease subunit YfeC


(< 0.001)






ABC chelated iron transporter, permease subunit YfeD


(< 0.001)






putative yfeABCD locus regulator








possible siderophore biosynthesis protein, IucA familly


(< 0.001)






putative siderophore biosynthesis protein IucC


(< 0.001)






putative siderophore biosynthesis protein IucD








putative TonB-dependent O-M, iron siderophore receptor/tranporter








possible MotA/TolQ/ExbB proton channel family protein


(< 0.001)


(< 0.001)




pExbD/TolR-family transport protein


(< 0.001)


(< 0.001)




putative bacterioferritin-associated ferredoxin




(< 0.001)








(< 0.001)




conserved hypothetical protein








conserved hypothetical protein








putative ABC transporter, periplasmic iron siderophore ferrichrome binding protein


(< 0.001)


(< 0.001)




putative ABC iron siderophore transporter, permease subunit








putative ABC iron siderophore transporter, ATP-binding subunit








putative catalase


(< 0.001)






putative catalase-hydroperoxidase HPI I





Biotin operon




putative adenosylmethionine-8-amino-7-oxononanoate aminotransferase


(< 0.001)






putative 8-amino-7-oxononanoate synthase


(< 0.001)


(< 0.001)




putative biotin synthesis protein BioC








putative dethiobiotin synthetase





Superoxyde dismutases




putative superoxide dismutase [Mn]


(< 0.001)






superoxide dismutase [Fe]


(< 0.001)


(< 0.001)

Ribonucleotides reductases (RNR)




probable NrdI protein homologue




(< 0.001)




putative ribonucleoside-diphosphate reductase 2 alpha chain


(< 0.001)


(< 0.001)




putative ribonucleoside-diphosphate reductase 2 beta chain








putative glutaredoxin




(< 0.001)




putative ribonucleoside-diphosphate reductase 1 alpha chain


(< 0.001)






putative ribonucleoside-diphosphate reductase 1 beta chain








putative anaerobic ribonucleoside-triphosphate reductase




(< 0.001)




putative anaerobic ribonucleotide reductase activating protein





Mannose and glucose uptake




probable PTS system, mannose-specific IIAB component


(< 0.001)


(< 0.001)




probable PTS system, mannose-specific IIC component




(< 0.001)




probable PTS system, mannose-specific IID component


(< 0.001)


(< 0.001)




putative PTS system, glucose-specific IIBC component


(< 0.001)






probable PTS system, phosphocarrier protein








putative PTS sytem, enzyme I component


(< 0.001)






putative PTS system, glucose-specific IIA component, permease





Sugar metabolism




putative 6-phosphofructokinase







fbaA, fba, fda

possible fructose-bisphosphate aldolase class II








putative phosphoglycerate kinase







gpmA, gpm

putative phosphoglycerate mutase 1


(< 0.001)


(< 0.001)




putative pyruvate kinase II








probable pyruvate kinase I


(< 0.001)






putative phosphoenolpyruvate carboxykinase [ATP]







adhE, ana

putative aldehyde-alcohol dehydrogenase




(< 0.001)




putative malate dehydrogenase




(< 0.001)



fumA, fumB

putative fumarase A fumarate hydratase class I, aerobic isozyme


(< 0.001)






putative fumarate reductase flavoprotein subunit


(< 0.001)


(< 0.001)




putative fumarate reductase iron-sulfur protein


(< 0.001)


(< 0.001)




putative fumarate reductase hydrophobic protei


(< 0.001)


(< 0.001)




putative fumarate reductase hydrophobic protein




(< 0.001)




putative succinate dehydrogenase flavoprotein subunit


(< 0.001)


(< 0.001)




putative succinate dehydrogenase hydrophobic membrane anchor protein


(< 0.001)


(< 0.001)




putative succinate dehydrogenase cytochrome b-556 subunit








putative succinate dehydrogenase iron-sulfur protein




(< 0.001)




putative succinyl-CoA synthetase beta chain


(< 0.001)


(< 0.001)




putative succinyl-CoA synthetase alpha chain


(< 0.001)






putative dihydrolipoamide succinyltransferase component








putative 2-oxoglutarate dehydrogenase E1 component




(< 0.001)




putative aconitate hydratase 2


(< 0.001)


(< 0.001)



aceA, icl

isocitrate lyase







aceB, mas

malate synthase A







fnr, nirR

putative fumarate and nitrate reduction regulatory protein








probable response regulator (OmpR family)









putative outer membrane protein C2, porin








putative outer membrane protein C, porin


(< 0.001)






putative outer membrane porin A protein





Chromosomal virulence factors




putative invasin


(< 0.001)






pH 6 antigen precursor


(< 0.001)






chaperone protein PsaB precursor


(< 0.001)






putative regulatory protein




(< 0.001)

pYV-encoded virulence factors – Type Three Secretion System




YscX, putative type III secretion protein








possible transposase remnant (pseudogene)








LcrF, VirF; putative thermoregulatory protein








LcrG, putative Yop regulator







lcrH, sycD

LcrH, SycD; low calcium response protein H


(< 0.001)






LcrR, hypothetical protein








LcrV, putative V antigen, antihost protein/regulator


(< 0.001)






SycE, yerA; putative yopE chaperone


(< 0.001)






SycH, putative yopH targeting protein


(< 0.001)






putative resolvase


(< 0.001)






VirG; putative Yop targeting lipoprotein








YopB, putative Yop targeting protein


(< 0.001)






YopD, putative Yop negative regulation/targeting component


(< 0.001)






YopM, putative targeted effector protein


(< 0.001)






YopN, LcrE; putative membrane-bound Yop targeting protein


(< 0.001)






hypothetical protein








YscC, putative type III secretion protein








YscD, putative type III secretion protein


(< 0.001)






YscE, putative type III secretion protein








YscF, putative type III secretion protein








YscG, putative type III secretion protein


(< 0.001)






YscI, LcrO; putative type III secretion protein







yscM, lcrQ

YscM, LcrQ, putative type III secretion regulatory








putative Yops secretion ATP synthase


(< 0.001)






YscO, putative type III secretion protein


(< 0.001)






YscQ, putative type III secretion protein








YscR, putative Yop secretion membrane protein








YscS, putative type III secretion protein


(< 0.001)



pYV-encoded virulence factors – Others




YadA, Yersinia adhesion


(< 0.001)



Table 2

Y. pseudotuberculosis IP32953 chromosomal genes (sorted by COG class [28]) that are transcriptionally regulated by growth medium and/or temperature.

COG class

Gene designation

Genoscript spot ID

Gene product/function

Fold ratio in gene transcription (p-value)


Human plasma/Luria Bertani Broth


C: energy production and conversion


YPTB0086 (glpK)


glycerol kinase




YPTB0108 (ppc)


phosphoenolpyruvate carboxylase







putative pyridine nucleotide-disulphide oxidoreductase





YPTB0211 (glpC)


anaerobic glycerol-3-phosphate dehydrogenase subunit C




YPTB0374 (qor)


quinone oxidoreductase




YPTB0410 (frdD)


fumarate reductase hydrophobic protein




YPTB0411 (frdC)


fumarate reductase hydrophobic protein


(< 0.001)


YPTB0412 (frdB)


fumarate reductase iron-sulfur protein


(< 0.001)


YPTB0413 (frdA)


fumarate reductase flavoprotein subunit


(< 0.001)


YPTB0460 (mdh)


malate dehydrogenase




(< 0.001)


YPTB0714 (aceF)


pyruvate dehydrogenase. dihydrolipoyltransacetylase component





YPTB0715 (lpdA)


dihydrolipoamide dehydrogenase component of pyruvate dehydrogenase complex





YPTB0716 (acnB)


aconitate hydratase 2


(< 0.001)


(< 0.001)


YPTB0796 (fumA)


fumarate hydratase. class I


(< 0.001)




YPTB0887 (nqrA)


NADH-ubiquinone oxidoreductase subunit A


(< 0.001)


YPTB0888 (nqrB)


NADH-ubiquinone oxidoreductase subunit B




YPTB0889 (nqrC)


Na+-translocating NADH-quinone reductase subunit c




YPTB0892 (nqrF)


NADH-uniquinone oxidoreductase subunit F






putative exported protein





YPTB0949 (cyoD)


cytochrome O ubiquinol oxidase subunit CyoD





YPTB0952 (cyoA)


cytochrome O ubiquinol oxidase subunit II


(< 0.001)


(< 0.001)


YPTB1125 (fldA)


flavodoxin 1





YPTB1143 (sdhC)


succinate dehydrogenase cytochrome b-556 subunit






YPTB1144 (sdhD)


succinate dehydrogenase hydrophobic membrane anchor protein


(< 0.001)




YPTB1145 (sdhA)


succinate dehydrogenase flavoprotein subunit


(< 0.001)


YPTB1146 (sdhB)


succinate dehydrogenase iron-sulfur protein




YPTB1147 (sucA)


2-oxoglutarate dehydrogenase E1 component




YPTB1148 (sucB)


dihydrolipoamide succinyltransferase component of 2-oxoglutarate dehydro






YPTB1149 (sucC)


succinyl-CoA synthetase beta chain


(< 0.001)


YPTB1150 (sucD)


succinyl-CoA synthetase alpha chain


(< 0.001)


YPTB1151 (cydA)


cytochrome D ubiquinol oxidase subunit I


(< 0.001)


YPTB1152 (cydB)


cytochrome D ubiquinol oxidase subunit II




YPTB1408 (pflB)


formate acetyltransferase 1


(< 0.001)


(< 0.001)


YPTB1723 (putA)


bifunctional PutA protein [includes: proline dehydrogenase and delta-1-p


(< 0.001)


(< 0.001)




putative thioredoxin






putative exported protein







hypothetical protein






putative nitroreductase


(< 0.001)


YPTB2103 (adhE)


aldehyde-alcohol dehydrogenase


(< 0.001)




Fe-S binding NADH dehydrog. (pseudogene. F/S)



(< 0.001)


YPTB2224 (pntB)


NAD(P) transhydrogenase subunit beta





YPTB2248 (ldhA)


D-lactate dehydrogenase




YPTB2253 (nifJ)


putative pyruvate-flavodoxin oxidoreductase





YPTB2427 (icdA)


isocitrate dehydrogenase [NADP]







putative dioxygenase beta subunit




YPTB2578 (nuoK)


NADH dehydrogenase i chain k




YPTB2581 (nuoH)


NADH dehydrogenase I chain H




YPTB2585 (nuoD)


NADH dehydrogenase I chain C/D




YPTB2587 (nuoA)


NADH dehydrogenase I chain A


(< 0.001)


YPTB2597 (ackA)


acetate kinase




YPTB2598 (pta)


phosphate acetyltransferase




YPTB2689 (dmsB)


putative dimethyl sulfoxide reductase chain B protein






putative ion channel protein




YPTB2758 (napC)


cytochrome C-type protein NapC





YPTB3469 (fadH)


2.4-dienoyl-CoA reductase








putative cytochrome



(< 0.001)




putative carbohydrate kinase





YPTB3656 (aceA)


isocitrate lyase






YPTB3762 (pckA)


phosphoenolpyruvate carboxykinase [ATP]




YPTB3782 (glpD)


aerobic glycerol-3-phosphate dehydrogenase




YPTB3927 (fdoG)


formate dehydrogenase-O. major subunit


(< 0.001)




YPTB3928 (fdoH)


formate dehydrogenase-O. iron-sulfur subunit


(< 0.001)




YPTB3929 (fdoI)


formate dehydrogenase. cytochrome b556 protein


(< 0.001)


(< 0.001)


YPTB3967 (atpD)


ATP synthase beta subunit protein





YPTB3968 (atpG)


ATP synthase gamma subunit protein





YPTB3970 (atpH)


ATP synthase delta subunit protein





YPTB3971 (atpF)


ATP synthase subunit B protein





YPTB3972 (atpE)


ATP synthase subunit C protein





YPTB3973 (atpB)


ATP synthase subunit B protein





D: cell division and chromosome partitioning


YPTB0222 (ftsE)


cell division ATP-binding protein





YPTB1430 (mukB)


cell division protein







putative membrane protein


(< 0.001)




possible bacteriophage protein




YPTB3976 (gidA)


glucose inhibited division protein A





E: amino acid transport and metabolism


YPTB0003 (asnA)


aspartate-ammonia ligase





YPTB0024 (glnA)


glutamine synthetase


(< 0.001)


(< 0.001)


YPTB0057 (tdh)


threonine 3-dehydrogenase




YPTB0066 (cysE)


serine acetyltransferase




YPTB0106 (metL)


bifunctional aspartokinase/homoserine dehydrogenase II




YPTB0111 (argB)


acetylglutamate kinase




YPTB0112 (argH)


putative argininosuccinate lyase




YPTB0134 (ilvG)


acetolactate synthase isozyme II large subunit





YPTB0203 (rhtC)


threonine efflux protein





YPTB0210 (glpB)


putative anaerobic glycerol-3-phosphate dehydrogenase subunit B




YPTB0226 (livK)


branched-chain amino acid-binding protein






conserved hypothetical protein




YPTB0248 (metE)


5-methyltetrahydropteroyltriglutamate – homocystei ne methyltransferase







putative methylenetetrahydrofolate reductase


(< 0.001)


YPTB0402 (aspA)


aspartate ammonia-lyase


(< 0.001)




conserved hypothetical protein







putative ABC transporter transporter. ATP-binding protein






(7G) putative extracellular solute-binding protein (pseudogene. F/S)







possible conserved cysteine desulfurase


(< 0.001)


PTB0602 (arcA)


aerobic respiration control protein




YPTB0604 (thrB)


homoserine kinase




YPTB0623 (carA)


carbamoyl-phosphate synthase small chain


(< 0.001)




YPTB0624 (carB)


carbamoyl-phosphate synthase large chain






YPTB0676 (ilvH)


acetolactate synthase isozyme III small subunit




YPTB0711 (aroP)


aromatic amino acid transport protein




YPTB0761 (cysH)


phosphoadenosine phosphosulfate reductase (pseudogene. F/S)







probable extracellular solute-binding protein




YPTB0911 (aroL)


shikimate kinase II




YPTB0920 (brnQ)


branched-chain amino acid transport system II carrier protein




YPTB1108 (glnH)


putative amino acid-binding protein precursoR






putative amino acid transporteR







putative amino acid permease







putative amino acid decarboxylase







putative hydrolase (pseudogene. stop)


(< 0.001)




YPTB1352 (sdaC)


serine transporteR




YPTB1362 (potG)


putrescine transport ATP-binding protein




YPTB1375 (artM)


arginine transport system permease protein






YPTB1384 (poxB)


pyruvate dehydrogenase [cytochrome]





YPTB1411 (ansB)


putative L-asparaginase II precursoR





YPTB1434 (aspC)


aspartate aminotransferase




YPTB1438 (pepN)


putative aminopeptidase N




YPTB1541 (ysuJ)


putative decarboxylase


(< 0.001)


YPTB1621 (aroP)


aromatic amino acid transport protein




YPTB1641 (hpaF)


5-carboxymethyl-2-hydroxymuconate delta-isomerase




YPTB1656 (ptrB)


oligopeptidase B




YPTB1889 (lysA)


possible diaminopimelate decarboxylase




(< 0.001)


YPTB2001 (prsA)


ribose-phosphate pyrophosphokinase


(< 0.001)




conserved hypothetical protein






putative aminotransferase



(< 0.001)


YPTB2105 (oppA)


periplasmic oligopeptide-binding protein precursoR



(< 0.001)


YPTB2108 (oppD)


oligopeptide transport ATP-binding protein


(< 0.001)


YPTB2126 (trpB)


tryptophan synthase beta chain


(< 0.001)


YPTB2258 (mppA)


putative periplasmic murein peptide-binding protein




YPTB2262 (tyrR)


transcriptional regulatory protein


(< 0.001)


YPTB2295 (gloA)


lactoylglutathione lyase


(< 0.001)




YPTB2437 (pepT)


peptidase T




YPTB2548 (glnH)


putative glutamine-binding periplasmic protein





YPTB2549 (glnP)


putative glutamine transport system permease





YPTB2550 (glnQ)


putative glutamine transport ATP-binding protein





YPTB2632 (aroC)


chorismate synthase






putative aminotransferase


(< 0.001)


YPTB2714 (cysK)


cysteine synthase A






putative permease






putative aminopeptidase (pseudogene. F/S)






YPTB2784 (gcvR)


glycine cleavage system transcriptional repressoR




YPTB2869 (glyA)


serine hydroxymethyltransferase





YPTB2882 (yfhB)


putative membrane protein







conserved hypothetical protein




YPTB2942 (ureC)


urease alpha subunit




YPTB2943 (ureB)


urease beta subunit




YPTB2944 (ureA)


urease gamma subunit




YPTB2961 (proX)


glycine betaine-binding periplasmic protein







conserved hypothetical protein





YPTB3006 (dapD)

YPO1041 N-succinyltransferase


(< 0.001)




YPTB3181 (gcsH)


glycine cleavage system H protein


(< 0.001)


YPTB3182 (gcvT)






YPTB3189 (serA)


D-3-phosphoglycerate dehydrogenase






YPTB3214 (proC)


putative pyrroline-5-carboxylate reductase







putative symporter protein




YPTB3570 (aroQ)


putative class II dehydroquinase





YPTB3658 (metA)


homoserine O-succinyltransferase




YPTB3749 (aroB)


3-dehydroquinate synthase




YPTB3813 (gdhA)


NADP-specific glutamate dehydrogenase




YPTB3853 (cysM)


pyridoxal-phosphate dependent protein (pseudogene. partial)



(< 0.001)




putative periplasmic solute-binding protein




F: nucleotide transport and metabolism


YPTB0250 (udp)


uridine phosphorylase




YPTB0519 (nrdD)


anaerobic ribonucleoside-triphosphate reductase




YPTB0584 (deoD)


purine nucleoside phosphorylase





YPTB0623 (carA)


carbamoyl-phosphate synthase small chain


(< 0.001)




YPTB0624 (carB)


carbamoyl-phosphate synthase large chain






YPTB0754 (pyrG)


CTP synthase


(< 0.001)


YPTB0901 (gpt)


xanthine-guanine phosphoribosyltransferase




YPTB0991 (apt)


adenine phosphoribosyltransferase




YPTB1253 (nrdB)


ribonucleoside-diphosphate reductase 1 beta chain





YPTB1254 (nrdA)


ribonucleoside-diphosphate reductase 1 alpha chain


(< 0.001)




YPTB1439 (pyrD)


dihydroorotate dehydrogenase





YPTB2001 (prsA)


ribose-phosphate pyrophosphokinase


(< 0.001)


YPTB2102 (tdk)


thymidine kinase




YPTB2706 (nupC)


nucleoside permease




YPTB2781 (purC)


phosphoribosylaminoimidazole-succinocarboxamide synthase (pseudogene. IS




YPTB2794 (upp)


uracil phosphoribosyltransferase




YPTB2796 (purN)


putative phosphoribosylglycinamide formyltransferase





YPTB2803 (ppx)


putative exopolyphosphatase



(< 0.001)


YPTB2956 (nrdI)


NrdI protein homologue


(< 0.001)


YPTB2957 (nrdE)


ribonucleoside-diphosphate reductase 2 alpha chain


(< 0.001)


YPTB2958 (nrdF)


ribonucleoside-diphosphate reductase 2 beta chain






putative ribonuclease







putative phosphoribosyl transferase protein




G: carbohydrate transport and metabolism


YPTB0074 (pfkA)






YPTB0087 (glpF)


glycerol uptake facilitator protein




YPTB0241 (ugpC)


sn-glycerol-3-phosphate transport. ATP-binding protein






PTS system. IIB component







putative aldolase







putative ABC transporter permease protein






putative pectinesterase


(< 0.001)


YPTB0583 (deoB)






YPTB0782 (dhaK)


putative dihydroxyacetone kinase







putative sugar ABC transporter. permease protein






YPTB0803 (fucR)


putative deoR-family regulatory protein


(< 0.001)




YPTB0804 (araD)


L-ribulose-5-phosphate 4-epimerase


(< 0.001)




probable sugar aldolase








conserved hypothetical protein






conserved hypothetical protein




YPTB1119 (nagB)


putative glucosamine-6-phosphate isomerase






conserved hypothetical protein




YPTB1166 (gpmA)


phosphoglycerate mutase 1


(< 0.001)


YPTB1290 (bglA)








putative ABC transport integral membrane subunit






conserved hypothetical protein




YPTB1522 (mglB)


galactose-binding protein








putative sugar transporteR




YPTB1600 (ybtX)


putative signal transduceR




YPTB1632 (manZ)


PTS system. mannose-specific IID component


(< 0.001)


YPTB1633 (manY)


PTS system. mannose-specific IIC component




YPTB1634 (manX)


PTS system. mannose-specific IIAB component


(< 0.001)




putative sugar ABC transporter. ATP-binding protein






putative sugar transporteR






putative dehydrogenase





YPTB2047 (pykA)


pyruvate kinase II


(< 0.001)




conserved hypothetical protein






YPTB2083 (gapA)


glyceraldehyde 3-phosphate dehydrogenase A







conserved hypothetical protein





YPTB2190 (mlc)


putative ROK family transcriptional regulatory protein






ABC sugar/ribose transporter. permease subunit





YPTB2306 (pykF)


pyruvate kinase I


(< 0.001)


YPTB2318 (ppsA)


phosphoenolpyruvate synthase




YPTB2356 (kduI)


4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase







putative sugar ABC transporter (permease)




YPTB2463 (ptsG)


PTS system. glucose-specific IIBC component


(< 0.001)






conserved hypothetical protein






putative solute-binding protein




YPTB2535 (rbsC)


putative sugar transport system. permease protein




YPTB2715 (ptsH)


PTS system. phosphocarrier protein




YPTB2716 (ptsI)


PTS sytem. enzyme I component


(< 0.001)


YPTB2717 (crr)


PTS system. glucose-specific IIA component








conserved hypothetical protein (pseudogene. IS100)


(< 0.001)




putative PTS transport protein





YPTB3190 (rpiA)


ribose 5-phosphate isomerase A






YPTB3195 (fbaA)


fructose-bisphosphate aldolase class II






YPTB3196 (pgk)


phosphoglycerate kinase






putative sugar transport system permease protein




YPTB3230 (mglA)


putative sugar transport ATP-binding protein






putative membrane protein


(< 0.001)




Sodium:galactoside symporter family protein





YPTB3479 (exuT)


ExuT transport protein






probable phosphosugar isomerase





YPTB3536 (treB)


PTS system. trehalose-specific IIBC component


(< 0.001)




YPTB3537 (treC)


putative trehalose-6-phosphate hydrolase


(< 0.001)




putative carbohydrate transport protein





YPTB3642 (lamB)




(< 0.001)


YPTB3779 (glpR)


glycerol-3-phosphate repressor protein





YPTB3783 (glgP)


glycogen phosphorylase






YPTB3787 (glgB)


1.4-alpha-glucan branching enzyme




H: coenzyme metabolism


YPTB0014 (mobA)


molybdopterin-guanine dinucleotide biosynthesis protein A





YPTB0056 (kbl)


2-amino-3-ketobutyrate coenzyme A ligase




YPTB0134 (ilvG)


acetolactate synthase isozyme II large subunit





YPTB0182 (hemX)


putative uroporphyrin-III C-methyltransferase







conserved hypothetical protein





YPTB0290 (thiC)


thiamine biosynthesis protein ThiC






putative coproporphyrinogen III oxidase




YPTB0463 (ispB)


octaprenyl-diphosphate synthase








hypothetical protein




(< 0.001)




putative protein involved in molybdopterin biosynthesis




(< 0.001)


YPTB0616 (rpsT)


30S ribosomal protein S20







hypothetical protein






YPTB0731 (folK)


2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase




YPTB0739 (fhuC)


ferrichrome transport ATP-binding protein FhuC




YPTB0758 (ygcM)


putative 6-pyruvoyl tetrahydrobiopterin synthase family protein






YPTB0761 (cysH)


phosphoadenosine phosphosulfate reductase (pseudogene. F/S)





YPTB0935 (ribH)


6.7-dimethyl-8-ribityllumazine synthase





YPTB0940 (ispA)






YPTB1003 (wbyH)


putative exported protein





YPTB1091 (lipA)


lipoic acid synthetase




YPTB1163 (pnuC)


intergral membrane NMN transport protein PnuC





YPTB1181 (bioA)


adenosylmethionine-8-amino-7-oxononanoate aminotransferase


(< 0.001)




YPTB1183 (bioF)


8-amino-7-oxononanoate synthase


(< 0.001)


YPTB1184 (bioC)


biotin synthesis protein BioC






YPTB1185 (bioD)


dethiobiotin synthetase






putative siderophore ABC transporter. ATP-binding subunit


(< 0.001)


YPTB1384 (poxB)


pyruvate dehydrogenase [cytochrome]







possible ThiF family


(< 0.001)




conserved hypothetical protein


(< 0.001)




conserved hypothetical protein




(< 0.001)




conserved hypothetical protein




YPTB2136 (btuR)


cob(I)alamin adenosyltransferase






putative dethiobiotin synthetase


(< 0.001)


YPTB2304 (ribE)


riboflavin synthase alpha chain








(< 0.001)


YPTB2561 (menF)


menaquinone-specific isochorismate synthase







putative sodium/panthothenate symporter




I: lipid metabolism


YPTB0416 (psd)


phosphatidylserine decarboxylase proenzyme





YPTB0434 (aidB)


putative acyl-CoA dehydrogenase






possible acyl-CoA dehydrogenase




(< 0.001)




putative AMP-binding enzyme-family protein




YPTB0883 (yafH)


probable acyl-CoA dehydrogenase


(< 0.001)




putative permease



(< 0.001)


YPTB1450 (fabA)


3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase







putative acyl carrier protein





YPTB2242 (acpD)


acyl carrier protein phosphodiesterase





YPTB2470 (acpP)


acyl carrier protein





YPTB2473 (fabH)


3-oxoacyl-[acyl-carrier-protein] synthase III






YPTB2626 (fabB)


3-oxoacyl-[acyl-carrier-protein] synthase I





YPTB2993 (lpxD)


UDP-3-o-[3-hydroxymyristoyl] glucosamine N-acyltransferase








putative membrane protein







hypothetical protein




J: translation, ribosomal structure and biogenesis


YPTB0034 (trmH)


tRNA (guanosine-2'-O-)-methyltransferase





YPTB0041 (rph)


ribonuclease PH





YPTB0276 (tufA)


elongation factor Tu





YPTB0279 (rplK)


50S ribosomal protein L11






YPTB0280 (rplA)


50S ribosomal protein L1






YPTB0281 (rplJ)


50S ribosomal protein L10





YPTB0282 (rplL)


50S ribosomal protein L7/L12





YPTB0408 (efp)


elongation factor P




YPTB0438 (rpsF)


30S ribosomal protein S6






YPTB0441 (rplI)


50S ribosomal protein L9



(< 0.001)


YPTB0464 (rplU)


50S ribosomal protein L21





YPTB0465 (rpmA)


50S ribosomal protein L27






YPTB0480 (infB)


translation initiation factor IF2-2 (pseudogene. inframe deletion)


(< 0.001)


(< 0.001)


YPTB0483 (rpsO)


30S ribosomal protein S15





YPTB0484 (pnp)


polyribonucleotide nucleotidyltransferase




YPTB0529 (valS)


valyl-tRNA synthetase





YPTB0575 (prfC)


peptide chain release factor 3






YPTB0732 (pcnB)


poly(A) polymerase




YPTB0794 (map)


methionine aminopeptidase


(< 0.001)


YPTB0834 (rpsP)


30S ribosomal protein S16





YPTB0835 (rimM)


16S rRNA processing protein






YPTB0836 (trmD)


tRNA (guanine-N1)-methyltransferase





YPTB0844 (yfiA)


putative sigma 54 modulation protein


(< 0.001)




YPTB0846 (rluD)


ribosomal large subunit pseudouridine synthase d







conserved hypothetical protein







conserved hypothetical protein






putative RNA methyltransferase





YPTB1411 (ansB)


putative L-asparaginase II precursoR





YPTB1417 (rpsA)


30S ribosomal protein S1



(< 0.001)


YPTB1436 (asnS)


asparaginyl-tRNA synthetase






putative acetyltransferase





YPTB2005 (prfA)


peptide chain release factor 1








putative RNA pseudouridylate synthase-family protein






translation initiation factor SUI1 family protein






probable formyl transferase





YPTB2336 (pheT)


phenylalanyl-tRNA synthetase beta chain




YPTB2337 (pheS)


phenylalanyl-tRNA synthetase alpha chain





YPTB2339 (rplT)


50S ribosomal protein L20





YPTB2618 (truA)


tRNA pseudouridine synthase A







putative SpoU-family rRNA methylase


(< 0.001)


YPTB3000 (frr)


ribosome recycling factoR





YPTB3002 (tsf)


elongation factor Ts





YPTB3003 (rpsB)


30S ribosomal protein S2



(< 0.001)




Conserved hypothetical protein







Possible bacteriophage protein




YPTB3507 (rpsI)


30S ribosomal protein S9






YPTB3674 (rpsD)


30S ribosomal protein S4





YPTB3675 (rpsK)


30S ribosomal protein S11





YPTB3676 (rpsM)


30S ribosomal protein S13





YPTB3679 (rplO)


50S ribosomal protein L15





YPTB3682 (rplR)


50S ribosomal protein L18





YPTB3684 (rpsH)


30S ribosomal protein S8






YPTB3687 (rplX)


50S ribosomal protein L24





YPTB3688 (rplN)


50S ribosomal protein L14





YPTB3689 (rpsQ)


30S ribosomal protein S17





YPTB3691 (rplP)


50S ribosomal protein L16



(< 0.001)


YPTB3692 (rpsC)


30S ribosomal protein S3





YPTB3693 (rplV)


50S ribosomal protein L22





YPTB3694 (rpsS)


30S ribosomal protein S19





YPTB3695 (rplB)


50S ribosomal protein l2


(< 0.001)


(< 0.001)


YPTB3696 (rplW)


50S ribosomal protein L23





YPTB3698 (rplC)


50S ribosomal protein L3





YPTB3699 (rpsJ)


30S ribosomal protein S10






YPTB3702 (tufA,tufB)


elongation factor EF-Tu





YPTB3703 (fusA)


elongation factor G





YPTB3946 (rnpA)


ribonuclease P protein




K: transcription


YPTB0035 (spoT)


guanosine-3'.5'-bisbis(diphosphate) 3'-pyrophosphydrolase




YPTB0100 (cytR)


transcriptional repressoR




YPTB0167 (rho)


transcription termination factoR


(< 0.001)


YPTB0263 (rfaH)


putative regulatory protein





YPTB0278 (nusG)


transcription antitermination protein





YPTB0284 (rpoC)


DNA-directed RNA polymerase beta' chain





YPTB0291 (rsd)


regulator of sigma D


(< 0.001)






putative LysR-family transcriptional regulatoR





YPTB0387 (rhaR)


L-rhamnose operon transcriptional activatoR




YPTB0479 (nusA)


N utilization substance protein A






YPTB0599 (rob)


putative right origin-binding protein





YPTB0601 (arcA)


aerobic respiration control protein




YPTB0658 (rapA)


RNA polymerase associated helicase




YPTB0712 (pdhR)


pyruvate dehydrogenase complex repressoR




(< 0.001)


YPTB0776 (rpoS)


RNA polymerase sigma factor RpoS





YPTB0803 (fucR)


putative deoR-family regulatory protein


(< 0.001)






putative transcriptional regulatory protein




YPTB0857 (emrR)


MarR-family transcriptional regulatory protein




YPTB1088 (cspE)


putative cold shock protein




YPTB1258 (rcsB)


probable two component response regulator component B





YPTB1332 (psaE)


putative regulatory protein




(< 0.001)


YPTB1392 (cspD)


cold shock-like protein




YPTB1423 (cspE)


putative cold shock protein




YPTB1610 (thuR)


putative ThuR. regulatory protein for trehalosemaltose transp...







conserved hypothetical (pseudogene. F/S)




YPTB1967 (hutC)


putative GntR-family transcriptional regulatory protein




YPTB2048 (hexR)


hex regulon repressoR





YPTB2072 (fadR)


fatty acid metabolism regulatory protein





YPTB2177 (araC)


arabinose operon regulatory protein





YPTB2190 (mlc)


putative ROK family transcriptional regulatory protein




YPTB2230 (rstA)


two-component regulatory system. response regulator protein




YPTB2262 (tyrR)


transcriptional regulatory protein


(< 0.001)


YPTB2288 (rovA)


MarR-family transcriptional regulatory protein



(< 0.001)


YPTB2367 (kdgR)


IclR-family transcriptional regulatory protein





YPTB2414 (cspC)


cold shock protein







AsnC-family transcriptional regulatory protein


(< 0.001)




putative LacI-family transcriptional regulatory protein







putative rpiR-family transcriptional regulatory protein




YPTB2763 (narP)


nitrate/nitrite response regulator protein NarP







conserved hypothetical protein








putative RNA-binding protein





YPTB2890 (rnc)


ribonuclease III





YPTB2897 (rpoE)


RNA polymerase sigma E factoR



(< 0.001)


YPTB2939 (ureG)


urease accessory protein


(< 0.001)


YPTB3017 (gcvA)


glycine cleavage system transcriptional activatoR






lysR-family transcriptional regulatory protein








BolA-like protein




YPTB3538 (rnk)


regulator of nucleoside diphosphate kinase




YPTB3577 (fiS)


DNA-binding protein Fis








Transcriptional regulator (pseudogene. inframe deletion)





YPTB3764 (greB)


transcription elongation factor





YPTB3779 (glpR)


glycerol-3-phosphate repressor protein





YPTB3798 (gntR)


gluconate utilization system Gnt-I transcriptional repressoR





YPTB3847 (uhpA)


two-component system response regulatoR







putative AraC-family transcriptional regulatory protein




L: DNA replication, recombination and repair


YPTB0046 (radC)


putative DNA repair protein








cytoplasmic Dnase (function similar to TatD)


(< 0.001)




conserved hypothetical protein





YPTB0297 (hupA)


DNA-binding protein HU-alpha



(< 0.001)


YPTB0302 (or0218)


putative transposase






YPTB0439 (priB)


primosomal replication protein n







conserved hypothetical protein






putative metalloenzyme




YPTB0658 (rapA)


RNA polymerase associated helicase




YPTB0913 (rdgC)


possible recombination associated protein RdgC




YPTB0941 (xseB)


exodeoxyribonuclease VII small subunit




YPTB0962 (hupB)


DNA-binding protein HU-beta


(< 0.001)




YPTB0964 (ybaV)


putative exported protein




YPTB1418 (ihfB)


integration host factor beta-subunit







putative modification methylase




YPTB2040 (ruvA)


Holliday junction DNA helicase




YPTB2140 (topA)


DNA topoisomerase I






YPTB2221 (ogt)


putative methylated-DNA – protein-cysteine methyltransferase




YPTB2335 (ihfA)


integration host factor alpha-subunit










(< 0.001)




conserved hypothetical protein





YPTB2834 (xseA)


exodeoxyribonuclease VII large subunit







putative MutT-family protein




YPTB3577 (fiS)


DNA-binding protein Fis








putative hydrolase




M: cell envelope biogenesis, outer membrane


YPTB0051 (kdtX)


lipopolysaccharide core biosynthesis glycosyl transferase




YPTB0173 (rffH)


glucose-1-phosphate thymidylyltransferase







putative membrane transport protein







multidrug efflux protein





YPTB0493 (ibeB)


probable outer membrane efflux lipoprotein




YPTB0694 (lpxC)


UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase




YPTB0775 (nlpD)










conserved hypothetical protein





YPTB0955 (yajG)


putative lipoprotein




YPTB0987 (kefA)


putative potassium efflux system




YPTB1002 (prt)


paratose synthase





YPTB1008 (wbyK)


putative mannosyltransferase






YPTB1014 (wzz)


O-antigen chain length determinant





YPTB1109 (cutE)


putative apolipoprotein N-acyltransferase




YPTB1160 (pal)


peptidoglycan-associated lipoprotein Pal


(< 0.001)


(< 0.001)


YPTB1217 (pbpG)


penicillin-binding protein 7 precursoR




YPTB1261 (ompC)


outer membrane protein C. porin


(< 0.001)




YPTB1266 (pla2)


putative outer membrane-associated protease




YPTB1309 (spr)


putative lipoprotein


(< 0.001)






conserved hypothetical protein






putative outer membrane porin C protein


(< 0.001)


YPTB1453 (ompA)


putative outer membrane porin A protein



(< 0.001)




putative exported protein



(< 0.001)


YPTB1528 (yohK)


putative membrane protein






attachment invasion locus protein



(< 0.001)




hypothetical phage protein






putative outer membrane porin C protein


(< 0.001)




putative dehydrogenase







putative exported protein






attachment invasion locus protein precursoR




(< 0.001)


YPTB2117 (tonB)




(< 0.001)


YPTB2123 (ompW)


putative exported protein


(< 0.001)


YPTB2233 (sepC)


insecticidal toxin (pseudogene. inframe insertion)




YPTB2294 (sepC)


insecticidal toxin (pseudogene. inframe insertion)




YPTB2323 (nlpC)


putative lipoprotein




YPTB2979 (cutF)


putative copper homeostasis lipoprotein




YPTB2994 (ompH)


cationic 19 kDa outer membrane protein precursoR


(< 0.001)


(< 0.001)




putative surface antigen







putative membrane protein






putative membrane protein






Conserved hypothetical protein







Conserved hypothetical protein (partial. c-term)






Putative autotransporter secreted protein





YPTB3313 (slyB)


putative lipoprotein




YPTB3407 (rfaE)


ADP-heptose synthase






putative membrane protein




YPTB3497 (mtgA)


monofunctional biosynthetic peptidoglycan transglycosylase





YPTB3513 (murA)









putative glycosyl transferase






putative membrane protein




YPTB3965 (glmU)


UDP-N-acetylglucosamine pyrophosphorylase




N: cell motility and secretion


YPTB0071 (cpxP)


putative exported protein



(< 0.001)




putative chaperone protein






putative outer membrane usher protein







putative outer membrane fimbrial usher protein




YPTB0706 (hofB)


putative type II secretion system protein




YPTB1335 (psaB)


chaperone protein PsaB precursoR


(< 0.001)


YPTB1680 (flgJ)


flagellar protein FlgJ





YPTB1681 (flgK)


flagellar hook-associated protein 1






YPTB1682 (flgL)


flagellar hook-associated protein 3










YPTB1695 (fliN)


flagellar motor switch protein FliN





YPTB1698 (fliK)


flagellar hook-length control protein FliK







probable fimbrial usher protein





YPTB2396 (cheZ)


chemotaxis protein CheZ





YPTB2405 (cheA)


chemotaxis protein CheA






putative fimbrial biogenesis protein





YPTB3347 (fliG)


puative flagellar motor switch protein








flagellar assembly protein






fimbrial protein








hypothetical protein




(< 0.001)




putative exported protein



(< 0.001)


YPTB0123 (yijD)


putative membrane protein







putative membrane protein







putative membrane protein






colicin (pseudogene. partial)






putative colicin immunity protein





YPTB0151 (imm2)


pyocin S2 immunity protein




(< 0.001)


YPTB0212 (dcrB)


putative lipoprotein






putative exported protein









(< 0.001)




conserved hypothetical protein (pseudogene. F/S)







putative exported protein



(< 0.001)




putative lipoprotein






conserved hypothetical protein



(< 0.001)




hypothetical protein







hypothetical protein







putative exported protein


(< 0.001)




hypothetical protein




(< 0.001)




putative membrane protein








hypothetical protein







hypothetical protein







putative IS1400 transposase B


(< 0.001)




putative membrane protein





YPTB0768 (ygbE)


putative membrane protein






hypothetical protein








conserved hypothetical protein


(< 0.001)


YPTB0903 (crl)


curlin genes regulatory protein


(< 0.001)




hypothetical protein





YPTB0978 (ymoA)


modulating protein YmoA (histone-like protein)


(< 0.001)




conserved hypothetical protein


(< 0.001)




hypothetical protein




YPTB1004 (wzx)


putative O-unit flippase





YPTB1018 (ushB)


5'-nucleotidase/UDP-sugar diphosphatase







hypothetical protein




YPTB1042 (int)


phage integrase (pseudogene. Partial)











YPTB1130 (trp1400A)


IS1400 transposase A



(< 0.001)


YPTB1167 (psiF)


putative starvation-inducible protein




YPTB1202 (xapB)


xanthosine permease (pseudogene. IS1541)








conserved hypothetical protein






putative bacteriophage tail fiber protein






hypothetical protein


(< 0.001)




conserved hypothetical protein




YPTB1334 (psaA)


pH 6 antigen precursor (antigen 4) (adhesin)


(< 0.001)




putative membrane protein






putative membrane protein




YPTB1543 (ysuH)


putative siderophore biosynthetic enzyme






putative exported protein


(< 0.001)


YPTB1602 (int)








conserved hypothetical protein








hypothetical protein







putative exported protein






putative acyl carrier protein






putative membrane protein




YPTB1668 (invA)


putative invasin


(< 0.001)


(< 0.001)




putative phage minor tail protein






hypothetical protein







conserved hypothetical protein






O protein [Enterobacteria phage 186] gb|AAC34159.1| (U32222)...






hypothetical protein


(< 0.001)




hypothetical protein





YPTB1798 (yfdM)


conserved hypothetical protein






hypothetical protein


(< 0.001)




hypothetical protein






putative phage protein






putative acyl carrier protein






putative membrane protein






bacteriophage hypothetical protein







gpR [Enterobacteria phage P2] sp|P36933|VPR_BPP2 tAIL COMPLE...







similar to V protein phage 186







putative phage replication protein






possible MFS Superfamliy multidrug-efflux transporter


(< 0.001)




hypothetical protein


(< 0.001)




conserved hypothetical protein






hypothetical protein (pseudogene. IS285)







hypothetical protein






hypothetical protein






putative membrane protein







putative membrane protein


(< 0.001)




putative exported protein






hypothetical protein


(< 0.001)




hypothetical protein




YPTB2151 (osmB)


osmotically inducible lipoprotein B precursoR


(< 0.001)






hypothetical protein







putative exported protein








conserved hypothetical protein




YPTB2237 (asr)


putative acid shock protein





YPTB2269 (pspB)


phage shock protein B






putative exported protein




YPTB2353 (yfeE)


putative yfeABCD locus regulatoR




YPTB2358 (pelY)


periplasmic pectate lyase precursoR







putative exported protein







conserved hypothetical protein






putative exported protein





YPTB2417 (ylaC)


putative membrane protein







hypothetical protein






conserved hypothetical protein




(< 0.001)




probable histidine acid phosphatase







hypothetical protein






hypothetical protein




YPTB2483 (dinI)


DNA-damage-inducible protein I






glucans biosynthesis protein (pseudogene. deletions)













conserved hypothetical protein















putative exported protein






conserved hypothetical protein





YPTB2623 (flk)


putative flagellar assembly regulatory protein. flk






conserved hypothetical protein


(< 0.001)






putative exported protein




YPTB2744 (yfeY)


putative lipoprotein







putative acetyltransferase













hypothetical protein






putative exported protein







putative exported protein






putative membrane protein












putative exported protein


(< 0.001)




putative mobilization protein


(< 0.001)




conserved hypothetical protein





YPTB2954 (asr)


putative acid shock protein






conserved hypothetical protein








hypothetical protein




YPTB3041 (ygeD)


putative membrane protein







putative exported protein






putative membrane protein






putative exported protein







hypothetical protein







conserved hypothetical protein




YPTB3256 (insA)


insertion element protein



(< 0.001)




putative lipoprotein













hypothetical protein








putative flagellar regulatory protein







hypothetical protein







Putative membrane protein (pseudogene. inframe deletion)






hypothetical protein






Fragment of hemagglutinin/hemolysin-related protein













putative exported protein


(< 0.001)




putative exported protein







Insecticidal toxin TcaA







putative exported protein







conserved hypothetical protein




YPTB3641 (malM)


maltose operon periplasmic protein


(< 0.001)


YPTB3769 (feoC)


ferrous iron transport protein C


(< 0.001)




putative exported protein



(< 0.001)




putative membrane protein







putative invasin





YPTB3811 (uspB)


universal stress protein B





YPTB3834 (pelY)


periplasmic pectate lyase precursoR







putative exported protein







putative membrane protein



(< 0.001)




putative exported protein



(< 0.001)




putative membrane protein





YPTB3917 (yiaF)


putative exported protein








hypothetical protein







putative membrane protein







hypothetical protein_




O: posttranslational modification, protein turnover, chaperones


YPTB0404 (groES)


10 kDa chaperonin






YPTB0427 (hflK)


putative membrane protein (pseudogene. inframe deletion)







conserved hypothetical protein


(< 0.001)




putative protease


(< 0.001)


YPTB0518 (nrdG)


anaerobic ribonucleoside-triphosphate reductase Activating protein




YPTB0612 (dnaK)


chaperone protein DnaK






YPTB0647 (clpB)


putative Clp ATPase




(< 0.001)


YPTB0774 (pcm)


protein-L-isoaspartate O-methyltransferase




YPTB0925 (ahpC)


putative alkyl hydroperoxide reductase subunit c



(< 0.001)


YPTB0948 (cyoE)


protoheme IX farnesyltransferase




YPTB0958 (tig)


Trigger factoR





YPTB0995 (htpG)


heat shock protein HtpG







conserved hypothetical protein





YPTB1026 (ybbN)


putative thioredoxin





YPTB1034 (ppiB)


peptidyl-prolyl cis-trans isomerase B






heat shock protein GrpE




YPTB1406 (pflA)


pyruvate formate-lyase 1 activating enzyme






similar to hypothetical bacteriophage P27 protein






putative thioredoxin




YPTB2070 (dsbB)


disulfide bond formation protein B


(< 0.001)






conserved hypothetical protein




YPTB2261 (tpx)


thiol peroxidase


(< 0.001)


(< 0.001)




conserved hypothetical protein







conserved hypothetical protein






putative ATP-dependent transporteR






conserved hypothetical protein




YPTB2734 (cysT)


sulfate transport system permease protein CysT





YPTB2785 (bcp)


bacterioferritin comigratory protein






putative heat shock protein




YPTB2905 (pcp)


putative pyrrolidone-carboxylate peptidase




YPTB2938 (ureD)


urease accessory protein


(< 0.001)


YPTB2939 (ureG)


urease accessory protein


(< 0.001)


YPTB2940 (ureF)


urease accessory protein


(< 0.001)


YPTB2941 (ureE)


urease accessory protein


(< 0.001)


YPTB3408 (glnE)


glutamate-ammonia-ligase adenylyltransferase




YPTB3415 (gcp)


putative glycoprotease




YPTB3710 (fkpA)


peptidyl-prolyl cis-trans isomerase







conserved hypothetical protein




YPTB3734 (ppiA)


peptidyl-prolyl cis-trans isomerase A




(< 0.001)


YPTB3930 (fdhE)


putative formate dehydrogenase formation protein


(< 0.001)



P: inorganic ion transport and metabolism


YPTB0071 (cpxP)


putative exported protein



(< 0.001)


YPTB0270 (trkH)


Trk system potassium uptake protein TrkH




YPTB0336 (hmuV)


hemin transport system ATP-binding protein






YPTB0338 (hmuT)


hemin-binding periplasmic protein






YPTB0339 (hmuS)


hemin transport protein






YPTB0340 (hmuR)


hemin receptor precursoR


(< 0.001)




conserved hypothetical protein




YPTB0354 (terB)


tellurite resistance protein







putative regulatory protein


(< 0.001)


YPTB0516 (phnG)


PhnG protein






putative ABC transporter transporter. ATP-binding protein






putative cation-transporting P-type ATPase




YPTB0662 (thiP)


thiamine transport system permease protein






YPTB0739 (fhuC)


ferrichrome transport ATP-binding protein FhuC




YPTB0740 (fhuD)


ferrichrome-binding periplasmic protein precursoR




YPTB0790 (yhjA)


putative cytochrome C peroxidase


(< 0.001)


YPTB0811 (katY)






(< 0.001)




conserved hypothetical protein





YPTB1246 (katA)




(< 0.001)




putative periplasmic substrate-binding transport protein


(< 0.001)


YPTB1343 (yiuC)


putative siderophore ABC transporter. ATP-binding subunit


(< 0.001)


YPTB1409 (focA)


putative formate transporter 1






YPTB1549 (ysuR)


putative iron-siderophore receptoR


(< 0.001)




YPTB1659 (ftnA)




(< 0.001)




putative membrane protein






putative membrane protein



(< 0.001)




putative exported protein




YPTB1947 (tehB)


putative tellurite resistance protein




YPTB2044 (znuA)


exported high-affinity zinc uptake system protein







putative integral membrane protein




YPTB2108 (oppD)


oligopeptide transport ATP-binding protein


(< 0.001)


YPTB2299 (sodB)


superoxide dismutase [Fe]


(< 0.001)


YPTB2347 (yfeA)


periplasmic-binding protein


(< 0.001)


YPTB2348 (yfeB)


ATP-binding transport protein


(< 0.001)


YPTB2349 (yfeC)


chelated iron transport system membrane protein


(< 0.001)


YPTB2350 (yfeD)


chelated iron transport system membrane protein


(< 0.001)


YPTB2546 (dps)


putative DNA-binding protein



(< 0.001)


YPTB2682 (yfuA)


iron(III)-binding periplasmic protein


(< 0.001)




conserved hypothetical protein





YPTB2769 (ydeN)


putative sulfatase


(< 0.001)




putative binding protein-dependent transport system. inner-membrane comp




YPTB2803 (ppx)


putative exopolyphosphatase



(< 0.001)




putative potassium channel protein


(< 0.001)




putative nickel transport protein


(< 0.001)




ABC transporter permease protein




YPTB2979 (cutF)


putative copper homeostasis lipoprotein






putative carbonic anhydrase


(< 0.001)




putative sulfatase







putative periplasmic substrate-binding transport protein


(< 0.001)




putative TonB-dependent outer membrane receptoR






YPTB3605 (ssuA)


aliphatic sulfonates binding protein (pseudogene. insertion)




YPTB3700 (bfr)







YPTB3701 (bfd)


putative bacterioferritin-associated ferredoxin






conserved hypothetical protein







putative membrane receptor protein (pseudogene. inframe insertion)





YPTB3767 (feoA)


hypothetical ferrous iron transport protein A








putative iron transport protein


(< 0.001)




putative iron transport permease


(< 0.001)




putative iron ABC transporter. ATP-binding protein


(< 0.001)


YPTB3925 (sodA)


superoxide dismutase [Mn]


(< 0.001)




YPTB3963 (pstS)


putative phosphate-binding periplasmic protein


(< 0.001)


Q: secondary metabolite biosynthesis, transport and catabolism


YPTB1030 (ybbP)


putative permease








putative acyl carrier protein





YPTB1544 (ysuG)


putative siderophore biosynthetic enzyme






putative siderophore biosynthetic enzyme


(< 0.001)




YPTB1596 (irp2)


yersiniabactin biosynthetic protein




YPTB1966 (hutI)








putative fumarylacetoacetate hydrolase family protein





YPTB2470 (acpP)


acyl carrier protein





YPTB2471 (fabG)


3-oxoacyl-[acyl-carrier protein] reductase





YPTB2561 (menF)


menaquinone-specific isochorismate synthase





YPTB2626 (fabB)


3-oxoacyl-[acyl-carrier-protein] synthase I





YPTB3258 (yspI)


N-acylhomoserine lactone synthase YspI





YPTB3263 (iucA)


aerobactin synthetase (subunit alpha)


(< 0.001)


YPTB3265 (iucC)


aerobactin synthetase (subunit beta)


(< 0.001)


YPTB3266 (iucD)


putative siderophore biosynthesis protein IucD






putative peptide/polyketide synthase subunit


(< 0.001)


R: general function prediction only




conserved hypothetical protein





YPTB0057 (tdh)


threonine 3-dehydrogenase




YPTB0063 (secB)


protein-export protein





YPTB0071 (cpxP)


putative exported protein



(< 0.001)




putative chaperone protein






putative outer membrane usher protein





YPTB0221 (ftsY)


cell division protein (pseudogene. inframe deletion)





YPTB0257 (aarF)


ubiquinone biosynthesis protein




YPTB0258 (tatA)


Sec-independent protein translocase protein tatA






putative type III secretion apparatus protein







putative integral membrane protein



(< 0.001)


YPTB0353 (terA)


putative tellurite resistance protein



(< 0.001)




putative outer membrane fimbrial usher protein




YPTB0374 (qor)


quinone oxidoreductase






putative exported protein


(< 0.001)




putative membrane protein




YPTB0493 (ibeB)


probable outer membrane efflux lipoprotein




YPTB0576 (osmY)


osmotically inducible protein Y


(< 0.001)




YPTB0706 (hofB)


putative type II secretion system protein






conserved hypothetical protein




YPTB0832 (corE)


putative membrane protein




YPTB0839 (dcuB)


anaerobic C4-dicarboxylate transporter (pseudogene. F/S)






5-methylthioribose kinase




YPTB0929 (yajC)


putative membrane protein






conserved hypothetical protein





YPTB1061 (yapC)


putaive autotransporter protein






conserved hypothetical protein






conserved hypothetical protein




YPTB1159 (tolB)


TolB colicin import protein






putative membrane protein



(< 0.001)




possible ABC transporter multidrug efflux pump. permease subunit






conserved hypothetical protein




YPTB1335 (psaB)


chaperone protein PsaB precursoR


(< 0.001)




putative heme-binding protein


(< 0.001)




ABC transporter ATP-binding protein






YPTB1540 (ysuF)


putative ferric iron reductase


(< 0.001)


YPTB1646 (hpaC)


4-hydroxyphenylacetate 3-monooxygenase coupling protein






putative copper resistance protein


(< 0.001)




YPTB1680 (flgJ)


flagellar protein FlgJ











YPTB1695 (fliN)


flagellar motor switch protein FliN





YPTB1728 (wrbA)


trp repressor binding protein




YPTB1733 (ydgC)


putative membrane protein






probable fimbrial usher protein







ABC transporter. ATP-binding protein








putative dehydrogenase







conserved hypothetical protein




YPTB2101 (hns)


Hns DNA binding protein







putative toxin transport protein (pseudogene. F/S)






putative aldo/keto reductase






putative membrane protein






YPTB2345 (marC)


multiple antibiotic resistance protein




YPTB2368 (ogl)


oligogalacturonate lyase






putative lipoprotein




YPTB2452 (ycfL)


putative lipoprotein








(< 0.001)


YPTB2471 (fabG)


3-oxoacyl-[acyl-carrier protein] reductase







conserved hypothetical protein







conserved hypothetical protein






conserved hypothetical protein






conserved hypothetical (pseudogene. F/S)




YPTB2646 (ccmD)


putative heme exporter protein D


(< 0.001)




putative pyridine nucleotide-disulphide oxidoreductase







putative permease






putative membrane protein






putative acetyltransferase




YPTB2837 (engA)


putative GTP-binding protein






putative fimbrial biogenesis protein





YPTB2891 (lepB)


signal peptidase I








conserved hypothetical protein








hypothetical protein







putative hemolysin III







Putative methyltransferase







putative kinase






Putative autotransporter secreted protein







ABC-transporter transmembrane protein






flagellar assembly protein






putative membrane protein





YPTB3382 (exbD)


ExbD/TolR-family transport protein


(< 0.001)


YPTB3383 (exbB)


MotA/TolQ/ExbB proton channel family protein


(< 0.001)




putative aldo/keto reductase family protein







putative membrane protein






conserved hypothetical protein






putative exported protein






putative exported protein



(< 0.001)


YPTB3558 (tldD)


putative modulator of DNA gyrase







conserved hypothetical protein







putative transferase




YPTB3745 (gph)


phosphoglycolate phosphatase






putative hydrolase






possible type I restriction enzyme (restriction subunit)






fimbrial protein







putative haloacid dehalogenase-like hydrolase




YPTB3948 (yidC)


probable membrane protein






YPTB3953 (yieG)


Xanthine/uracil permeases family protein





S: function unknown


YPTB0015 (mobA)


molybdopterin-guanine dinucleotide biosynthesis protein A







conserved hypothetical protein


(< 0.001)




conserved hypothetical protein








conserved hypothetical protein


(< 0.001)






conserved hypothetical protein



(< 0.001)










conserved hypothetical protein



(< 0.001)




conserved hypothetical protein






conserved hypothetical protein






conserved hypothetical protein






conserved hypothetical protein






conserved hypothetical protein



(< 0.001)




conserved hypothetical protein





YPTB0600 (creA)


putative exported protein


(< 0.001)




putative membrane protein







hypothetical protein



(< 0.001)




hypothetical protein


(< 0.001)




conserved hypothetical protein


(< 0.001)




conserved hypothetical protein



(< 0.001)




conserved hypothetical protein


(< 0.001)




conserved hypothetical protein







conserved hypothetical protein



(< 0.001)




conserved hypothetical protein







hypothetical protein







hypothetical protein




(< 0.001)




putative lipoprotein








conserved hypothetical protein







putative OmpA-family membrane protein



(< 0.001)




conserved hypothetical protein






conserved hypothetical protein


(< 0.001)




conserved hypothetical protein


(< 0.001)




methionine salvage pathway enzyme E-2/E-2'





YPTB0976 (ybaY)


putative lipoprotein







conserved hypothetical protein







putative membrane protein






putative carbohydrate kinase







putative membrane protein







putative exported protein







hypothetical protein







putative membrane protein







conserved hypothetical protein






conserved hypothetical protein







putative membrane protein






putative virulence factoR






conserved hypothetical protein (pseudogene. inframe deletion)







putative exported protein






hypothetical protein






conserved hypothetical protein






conserved hypothetical protein




YPTB1640 (hpaD)


3.4-dihydroxyphenylacetate 2.3-dioxygenase






putative exported protein






conserved hypothetical protein






conserved hypothetical protein


(< 0.001)




putative membrane protein






conserved hypothetical protein






putative membrane protein







putative virulence factoR






putative exported protein






putative membrane protein






conserved hypothetical protein


(< 0.001)




conserved hypothetical protein






conserved hypothetical protein




YPTB2444 (ycfJ)


putative exported protein






conserved hypothetical protein







conserved hypothetical protein







putative exported protein


(< 0.001)




conserved hypothetical protein


(< 0.001)




conserved hypothetical protein




YPTB2651 (lemA)


putative exported protein


(< 0.001)




putative membrane protein






possible OmpA family (pseudogene. IS100 insertion)







hypothetical protein






putative lipoprotein







putative lipoprotein



(< 0.001)


YPTB2745 (ygiW)


putative exported protein







putative membrane protein







conserved hypothetical protein







hypothetical protein






Hypothetical bacteriophage protein.







putative exported protein







conserved hypothetical protein







conserved hypothetical protein






conserved hypothetical protein







putative antigenic leucine-rich repeat protein







conserved hypothetical protein








Conserved hypothetical




YPTB3468 (hdeD)


putative membrane protein


(< 0.001)




putative exported protein





YPTB3485 (yqjD)


putative membrane protein














putative membrane protein





YPTB3573 (panF)


sodium/pantothenate symporteR







putative gamma carboxymuconolactone decarboxylase






putative Rhs accessory genetic element






conserved hypothetical protein







conserved hypothetical membrane protein







conserved hypothetical protein


(< 0.001)




putative membrane protein




T: signal transduction mechanisms


YPTB0022 (ntrC)


nitrogen regulation protein





YPTB0035 (spoT)


guanosine-3'.5'-bisbis(diphosphate) 3'-pyrophosphydrolase




YPTB0071 (cpxP)


putative exported protein



(< 0.001)


YPTB0356 (terD)


tellurium resistance protein




YPTB0357 (terE)


tellurium resistance protein






YPTB0468 (basS)


two-component system sensor protein







putative transcriptional regulatoR




YPTB0570 (hmsT)


HmsT protein








putative exported protein





YPTB0601 (arcA)


aerobic respiration control protein




YPTB0734 (dksA)


DnaK suppressor protein homologue



(< 0.001)




probable extracellular solute-binding protein




YPTB1108 (glnH)


putative amino acid-binding protein precursoR




YPTB1258 (rcsB)


probable two component response regulator component B







putative two component sensor kinase







Putative sensor protein





YPTB1957 (narX)


nitrate/nitrite sensor protein






probable response regulatoR





YPTB2156 (cstA)


putative carbon starvation protein A






YPTB2222 (fnr)


fumarate and nitrate reduction regulatory protein




(< 0.001)


YPTB2230 (rstA)


two-component regulatory system. response regulator protein






conserved hypothetical protein





YPTB2396 (cheZ)


chemotaxis protein CheZ





YPTB2405 (cheA)


chemotaxis protein CheA




YPTB2435 (phoQ)


sensor protein kinase


(< 0.001)


YPTB2548 (glnH)


putative glutamine-binding periplasmic protein





YPTB2635 (sixA)


putative phosphohistidine phosphatase





YPTB2763 (narP)


nitrate/nitrite response regulator protein NarP





YPTB2894 (rseC)


sigma E factor regulatory protein





YPTB2895 (rseB)


sigma E factor regulatory protein





YPTB2896 (rseA)


sigma E factor negative regulatory protein



(< 0.001)


YPTB3350 (fleR)


sigma-54 transcriptional regulatory protein




YPTB3408 (glnE)


glutamate-ammonia-ligase adenylyltransferase






putative exported protein


(< 0.001)


YPTB3463 (terX)


putative tellurium resistance protein


(< 0.001)


YPTB3500 (arcB)


aerobic respiration control sensor/response regulatory protein




YPTB3566 (yhdA)


putative exported protein



(< 0.001)


YPTB3729 (crp)


cAMP-regulatory protein



(< 0.001)


YPTB3812 (uspA)


universal stress protein A


(< 0.001)




YPTB3847 (uhpA)


two-component system response regulatoR







putative periplasmic solute-binding protein




YPTB2341 (infC)


translation initiation factor IF-3



(< 0.001)

Table 3

Y. pseudotuberculosis IP32953 pYV plasmid-harbored genes that are transcriptionally regulated by growth medium and/or temperature.


Fold ratio in gene transcription (p-value)

Gene designation

Genoscript spot ID

Gene product/function

Human plasma/Luria Bertani Broth




hypothetical protein


(< 0.001)





possible transposase remnant







putative resolvase


(< 0.001)




putative YopH targeting protein


(< 0.001)


(< 0.001)



putative YopE chaperone


(< 0.001)





Yop targeting protein YopK, YopQ






putative targeted effector protein


(< 0.001)





putative Yop negative regulation/targeting component


(< 0.001)





putative Yop targeting protein


(< 0.001)


(< 0.001)



low calcium response protein H


(< 0.001)





putative V antigen, antihost protein/regulator


(< 0.001)





putative Yop regulator






hypothetical protein LcrR




(< 0.001)



putative type III secretion protein







putative membrane-bound Yop targeting protein


(< 0.001)





putative Yops secretion ATP synthase


(< 0.001)





putative type III secretion protein


(< 0.001)




putative type III secretion protein






putative type III secretion protein






putative Yop secretion membrane protein






putative type III secretion protein


(< 0.001)





putative Yop targeting lipoprotein





putative thermoregulatory protein






hypothetical protein






putative type III secretion protein




(< 0.001)



putative type III secretion protein


(< 0.001)





putative type III secretion protein







putative type III secretion protein






putative type III secretion protein


(< 0.001)




putative type III secretion protein






putative type III secretion regulatory protein



Free iron limitation is a well-known stimulus encountered by bacteria in plasma [10, 11]. As expected, IP32953 genes required for iron storage (such as the ferritin-encoding gene ftnA [12] (Fig. 1)) were found to be downregulated in plasma. Transcriptional upregulation of most iron uptake systems (along with accessory protein-encoding genes tonB, exbB and exbD) (Fig. 1) is also consistent with this condition and is in agreement with the recent findings in Y. pestis [8]. As iron is used as a cofactor by numerous enzymes (mostly when complexed with sulfur), the metal is essential for a broad range of metabolic processes. Besides activation of iron homeostasis systems, lack of iron is also expected to be associated with a dramatic decrease in the transcription of genes encoding such enzymes, with the underlying goal of lowering iron consumption. This situation is exemplified by the katA gene that encodes catalase (a ferric enzyme involved in oxidative stress defense), whose transcription is decreased in both Y. pestis and Y. pseudotuberculosis during growth in plasma (Fig. 1). However, the increase in transcription of the bio locus (required for biotin synthesis [13]) and observed in both species) suggests that differential genetic control of a subset of iron-dependent enzymes may favor supply of this metal to the pathways that are most important for bacterial survival (and thus presumably at the expense of other, less critical ones). Furthermore, the impact of transcriptional downregulation on reorientation of metabolic fluxes may be minimized by the concomitant activation of genes coding for isoenzymes that are better suited to this situation.
Figure 1
Figure 1

Medium- and temperature-dependent differential expression of Y. pseudotuberculosis chromosomal genes involved in virulence and/or iron uptake & storage. Significant (p < 0.05) upshifts (yellow to red scale) or downshifts (blue scale) in individual gene transcription levels when bacteria were grown in human plasma versus LB (triangles) and/or at 37°C versus 28°C (squares) are indicated by the color scale bar. Genes encoding iron uptake/storage systems, virulence factors and their regulators are symbolized by gray, white and black arrows, respectively. Nomenclature used for gene designation correspond to the Y. pseudotuberculosis IP32953 genome annotation. Mean fold changes in transcription and p-values are indicated in Table 2.

One example is that of the manganese- and iron-dependent superoxide dismutase genes (i.e sodA and sodB), which are Fur-activated and -repressed, respectively (Fig. 1) in both Y. pestis and Y. pseudotuberculosis. Similarly, the class Ib ribonucleotide reductase (RNR)-encoding genes (nrdHIEF) are probably important for bacterial life in plasma, since they were found to be upregulated at the expense of those in classes III (nrdDG) and Ia (nrdAB) (Table 2) – even though all three classes are equally involved in generating the synthetic precursors for DNA. The fact that only the first class is Fur-activated [14] is consistent with this observation. Similar variations have also been recorded in Y. pestis [8]. However, whereas purine/pyrimidine metabolism has been shown to be essential for Y. pestis virulence [15], the role of this metabolic pathway in the physiopathology of Y. pseudotuberculosis has not yet been investigated. Along with class 1b RNRs, more than half of the enzymes in the tricarboxylic acid cycle (TCA) are known to be catalytically iron-dependent and/or believed to be transcriptionally activated by Fur [16]. Accordingly, and in line with transcriptome data from Y. pestis, we observed that transcription of these genes fell significantly when Y. pseudotuberculosis was grown in plasma.

In contrast to the low availability of iron in blood, glucose is readily available in this biological fluid and at a higher concentration (approx. 7 mM) than in LB broth. When Y. pseudotuberculosis was cultured in plasma, genes involved in glycolysis and the upstream, sugar-supplying, phosphoenolpyruvate-dependent systems were found to be upregulated, as depicted in Fig. 2. This finding is reminiscent of an aerobic phenomenon referred to as "glucose overflow metabolism"; this consists in channeling the carbon flow towards acetate formation instead of citrate formation, in order to prevent the excessive accumulation of NADH that would otherwise result from very high glucose consumption rates [17]. However, one main feature of glucose overflow in E. coli is acetate accumulation due to a strong transcriptional repression of the glyoxylate shunt aceBAK operon [18]. Interestingly, at least the first two of these genes are not down- but are up-regulated in Y. pseudotuberculosis (Fig. 2, Additional file 1), suggesting a need for this species to limit acetate overloads. The continuous de-repression of these genes (due to inactivation of the IclR repressor) suggests that this might also be the case in Y. pestis. These pathways are controlled by complex and finely balanced networks involving numerous pleiotropic regulators, including Fur, Crp, Fnr and ArcA [16, 19]. This unexpected upregulation may well result from the combination of both high glucose and low iron levels in plasma. Whether this occurs through the strong transcriptional repression observed with both fnr and arcA remains to be addressed in future experiments.
Figure 2
Figure 2

Medium-dependent differential expression of genes coding for enzymes putatively involved in Y. pseudotuberculosis glycolysis and the tricarboxylic acid cycle (TCA cycle). Significant (p < 0.05) upshifts (yellow to red scale) or downshifts (blue scale) in individual gene transcription levels in human plasma versus LB is indicated by the color scale bar. Open boxes indicate genes whose expression levels did not vary significantly (p > 0.05). Although considered as not significant by statistical analysis of macroarray data (p = 0.053), transcriptional upregulation of aceB in human plasma was confirmed by qRT-PCR. Abbreviations: Ac-CoA: acetyl coenzyme A; PEP: phosphoenolpyruvate. Mean fold changes in transcription and p-values are indicated in Table 2.

Temperature upshift is typically considered to be the main signal indicating to bacteria that they have entered the host; this hypothesis is supported by the thermal dependency of almost all Y. pseudotuberculosis virulence genes and also many of the latter's regulators [3]. Several of these genes were also found to be influenced by growth in plasma and the changes were sometimes in the opposite direction to those seen with temperature upshifts: whereas expression of the invasin-encoding gene inv was significantly repressed during bacterial growth under both conditions, transcription of psaA (coding for the pH6 antigen) was promoted by temperature upshifts [6, 20], but was one of the most strongly repressed in plasma. Interestingly, the impact of this medium on psaA transcription was not considered to be significant in Y. pestis and suggests that the pH6 antigen does not have the same importance in blood dissemination in the two species. In contrast to the latter two adhesins, transcriptional activation of yadA (harbored by the pYV plasmid and involved in adhesion) was found to be the highest of all the Y. pseudotuberculosis genes induced under plasma growth conditions. This observation is consistent with YadA's involvement in microbial resistance to complement [21, 22]. Similarly, ompC whose product is believed to be targeted by lactoferricin [23], a bactericidal peptide derived from lactoferrin by enzymatic cleavage [24], is strongly repressed, whilst no significant modification was observed for the outer membrane-encoding genes ompA and ompC 2.

Lastly, an essential determinant of bacterial virulence is the plasmid-encoded type III secretion system (TTSS) which performs intracellular delivery of a set of Yersinia outer proteins (Yops) that subvert the host's defenses [25]. Interestingly, Y. pseudotuberculosis growth in plasma induced the upregulation of 25 genes required for secretion, translocation and chaperoning of the Yop effector proteins in a similar fashion to that observed upon temperature upshift (Fig. 3). Furthermore, the apparently coordinated regulation of yadA and the TTSS-encoding genes by temperature and growth in plasma suggests the involvement of a common means of genetic control. YmoA (a chromatin-associated (histone-like) protein which is very similar in structure and function to the haemolysin expression modulating protein Hha from Escherichia coli) was shown to negatively influence YadA and Yop expression by favoring supercoiling of the pYV plasmid [26]. A two-fold reduction in ymoA transcription in plasma may be enough to contribute to the TTSS upregulation recorded in Y. pseudotuberculosis. Strikingly, this plasma-induced TTSS activation was not observed in Y. pestis, since only 3 out of the 25 genes mentioned above were found to be upregulated (in line with the statistically non-significant downregulation of ymoA); this raises the possibility that these two pathogenic Yersinia species may differ in their transcriptional regulation of pYV-harbored virulence genes.
Figure 3
Figure 3

Medium- and temperature-dependent differential expression of genes harbored by the Y. pseudotuberculosis virulence plasmid pYV. Significant (p < 0.05) upshifts (yellow to red scale) or downshifts (blue scale) in individual gene transcription levels when bacteria were grown in human plasma versus LB (triangles) and/or at 37°C versus 28°C (squares) are indicated by the color scale bar. Only genes spotted on the macroarray (56 out of 99 pYV-borne genes) are shown and those encoding the secretion apparatus and Yop effectors are represented by grey and black boxes, respectively. Mean fold changes in transcription and p-values are indicated in Table 3.


Overall transcription profiling of Y. pseudotuberculosis grown in an environment mimicking the blood stage of the infectious process revealed gene regulations that could not be anticipated from the results of previously reported single-stimulus studies. Our findings thus provide insight into how a number of simultaneously sensed environmental cues may be taken into account by the bacterium in a hierarchical manner. Furthermore, comparison of our analyses with those previously performed in Y. pestis suggests that transcription of common critical virulence factors may be differently influenced (at least in part) by the plasma environment in these two species.


DNA macroarray construction

Pairs of specific oligonucleotide primers were designed with the Primer 3 software for each of the 3,951 Y. pseudotuberculosis IP32953 CDSs. In order to avoid cross-hybridization, the specificity of the PCR products relative to the complete genome sequence was tested with CAAT-box software [27]. Primers purchased from Eurogentec were chosen in order to specifically amplify a ≈ 400 to 500 base pair (bp) fragment of each open reading frame (ORF), with a melting temperature of 51 to 60°C. Amplification reactions were performed in 96-well plates (Perkin-Elmer) in a 100 μl reaction volume containing 100 ng of Y. pseudotuberculosis IP32953 DNA, DNA polymerase (Dynazyme, New England Biolabs), 10 μM of each primer and 2 mM dNTPs (Perkin-Elmer). Reactions were cycled 45 times (94°C for 30 s; 60°C for 30 s; 72°C for 60 s) with a final cycle of 72°C for 7 min in a thermocycler. Each PCR product was checked by agarose gel electrophoresis and when DNA amplification was unsuccessful, PCR was repeated with another primer set. Overall, 3,951 of the 3,994 CDSs (98%) identified in the Y. pseudotuberculosis IP32953 genome were successfully amplified under our experimental conditions. ORF-specific PCR products, luciferase DNA (10 to 100 ng) and total genomic DNA from strain IP32953 were spotted onto 22 × 7-cm nylon membranes (Genetix) using a Qpix robot (Genetix). Immediately following spot deposition, membranes were immersed for 15 min in 0.5 M NaOH and 1.5 M NaCl, washed three times with distilled water and stored at -20°C until use. To ensure that DNA samples were successfully deposited on the membranes, 33P-labeled genomic DNA was hybridized to the macroarray before transcriptome analysis.

Bacterial culture

The Y. pseudotuberculosis transcriptome was studied in three independent cultures of strain IP32953 in media aliquoted from a single batch. After storage in Luria-Bertani (LB) broth with 40% glycerol at -80°C, the strain was thawed and then grown on LB agar supplemented with 20 μg ml-1 hemin for 48 h at 28°C. From this culture, 8 × 106 cells were inoculated into 40 ml of either LB broth or pooled human plasma from healthy donors (heated at 56°C for 30 min to ensure complement inactivation). Media were then incubated at 28°C or 37°C with shaking and Yersinia growth was monitored by absorbance at 600 nm.

RNA and cDNA probe preparation

Cells were harvested from exponential-phase cultures (A600 of 0.2–0.4 and 0.1–0.2 for LB and human plasma, respectively) by centrifugation at 4°C and the pelleted bacteria were disrupted with RNAwiz reagent (Ambion). After mixing the lysate with chloroform (0.2 v), total RNA was precipitated from the aqueous phase with glycogen (1/50 v) and isopropanol (1 v). The RNA pellet was washed with 70% ethanol and then dissolved in sterile, DNase- and RNase-free water. Contaminating DNA was removed using the DNA-free kit from Ambion. Nucleic acid purity and integrity was checked with a BioAnalyzer 2100 (Agilent) according to the supplier's instructions. After quantification by spectrophotometry at 260 and 280 nm, the RNA solution was stored at -80°C until use. cDNA was further generated from 10 μg of total RNA incubated (in a total volume reaction of 45 μl) for 3 h at 42°C with 50 U AMV reverse transcriptase (Roche), 0.35 pmol. of each amplified CDS-specific 3' oligonucleotide primer, 222 μM dATP, dGTP & dTTP, 2.2 μM dCTP and 50 μCi 33P-labelled dCTP (Amersham Biosciences). Labeled cDNA was purified to remove unincorporated nucleotides using DyeEx 2.0 spin column (Qiagen).

DNA macroarray hybridization

Macroarrays were prewetted in 2 × SSPE (0.18 M NaCl, 10 mM NaH2PO4, 1 mM EDTA, pH 7.7) and prehybridized for 1 h in 13 ml of hybridization solution (5 × SSPE, 2% SDS, 1× Denhardt's reagent, 0.1 mg of sheared salmon sperm DNA ml-1) at 65°C in roller bottles. Hybridization was carried out for 20 h at 65°C with 15 ml of hybridization solution containing the purified cDNA probe. After hybridization, membranes were washed three times at room temperature and three times at 65°C for 20 min in 0.5 × SSPE and 0.2% SDS. Probed macroarrays were exposed to a phosphor screen (Molecular Dynamics) for 24–72 h and imaged using a STORM 860 phosphorimager (Amersham Biosciences). The intensity of all of the pixels associated with each spot was further quantified using ArrayVision software (Imaging Research, Grinnel, IA, USA). The experiment design included three biological replicates for each combination of conditions. Data were analyzed using the SAS software (SAS Institute Inc, Cary, NC, USA). They were first log-transformed and normalized with a median normalization. A linear model was then applied on each gene with the temperature, phase and growth medium as fixed effects. The significance level alpha was set to 0.05.

Real-Time Quantitative PCR

Messenger RNAs (mRNAs) were reverse transcribed from 1 μg of nucleic acid by using the High-Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. The resulting cDNA was amplified by the SYBR Green Real-Time PCR Kit and detected on a Prism 7000 detection system (Applied Biosystems). The forward and reverse primers used were as follows: 5'CGCCATCAAATGCGCTAAT3' and 5'TGAGCGGGATCGTGTTCAA3' for yfeA, 5'TCAAGCAGGGAAACACATTCC3' and 5'GGCTGTTTACCCGCAAAAATC3' for psaA, 5'GGTTAGCCGCGAACAGGATA3' and 5'CGCTCGCCAGAACAAGGTT3' for aceB, 5'TCGATGCTCGCGCTAAGG3' and 5'GCTGGTTTCGCTGCTTCAG3' for yadA, 5'GATCCTGGTTCCATAAAAATTATTCAC3' and 5'ATTGTTCGCCTGGATTACCAA3' for yopJ, 5'GAGAATCCCAGTCGGGTGTTAA3' and 5'TCACTGCATCGCGGTAGGT3' for yopN, 5'GACACCAGTGGGACGCAACT3' and 5'GGGTTCACAAGAAAGAGTAACAGCTT3' for sycH, 5'GGTTACGCGCGGGTATCA3' and 5'CCGCGTCTTTGAGTGTTTTG3' for tnpR, 5'TTCTCGTGGGCAACCTATCC3' and 5'TGCGTTCCCAGCATACACAA3' for nlpD. On completion of the PCR amplification, a DNA melting curve analysis was performed to confirm the presence of a single amplicon. Relative mRNA levels (2ΔΔC) were determined by comparing the PCR cycle thresholds (Ct) for the gene of interest and the constitutively expressed YPTB0775 gene (spot ID YPO3356) coding for the outer membrane lipoprotein NlpD.



quantitative Real Time Reverse Transcription PCR.



This work was funded by grant 02 34 021 from the "Délégation Générale pour l'Armement" and grant PTR88 from the Institut Pasteur and the Institut Pasteur de Lille. We gratefully thank Sandrine Rousseau-Moreira (Plate-Forme 4, Institut Pasteur, Paris, France) for technical assistance during the Genoscript data upload process.

Authors’ Affiliations

Inserm U801, Lille, F-59019, France; Université Lille II (Faculté de Médecine Henri Warembourg), F-59045 Lille, France; Institut Pasteur de Lille, F-59019 Lille, France
Yersinia research Unit, Institut Pasteur, 28 rue du Dr. Roux, F-75724 Paris cedex 15, France
Plate-Forme 4, Institut Pasteur, 28 rue du Dr. Roux, F-75724 Paris cedex 15, France
Plate-Forme 2, Institut Pasteur, 28 rue du Dr. Roux, F-75724 Paris cedex 15, France
Génoscope, 2 rue Gaston Crémieux, CP5706, F-91057 Evry, France
Unité de Prévention et Thérapies Moléculaires des Maladies Humaines, Centre National de Référence de la coqueluche et autres bordetelloses, 28 rue du Dr. Roux, F-75724 Paris cedex 15, France
Fédération de Biologie, Centre Hospitalier de Roubaix, 11-17 Bd Lacordaire, F-59056 Roubaix, France


  1. Vincent P, Leclerc A, Martin L, Yersinia Surveillance Network, Duez J-M, Simonet M, Carniel E: Sudden onset of pseudotuberculosis in humans, France, 2004–05. Emerg Infect Dis. 2008Google Scholar
  2. Putzker M, Sauer H, Sobe D: Plague and other human infections caused by Yersinia species. Clin Lab. 2001, 47 (9–10): 453-466.PubMedGoogle Scholar
  3. Marceau M: Transcriptional regulation in Yersinia: an update. Curr Issues Mol Biol. 2005, 7 (2): 151-177.PubMedGoogle Scholar
  4. Darwin AJ: Genome-wide screens to identify genes of human pathogenic Yersinia species that are expressed during host infection. Curr Issues Mol Biol. 2005, 7 (2): 135-149.PubMedGoogle Scholar
  5. Revell PA, Miller VL: Yersinia virulence: more than a plasmid. FEMS Microbiol Lett. 2001, 205 (2): 159-164. 10.1111/j.1574-6968.2001.tb10941.x.View ArticlePubMedGoogle Scholar
  6. Price SB, Freeman MD, Yeh KS: Transcriptional analysis of the Yersinia pestis pH 6 antigen gene. J Bacteriol. 1995, 177 (20): 5997-6000.PubMed CentralPubMedGoogle Scholar
  7. Collyn F, Lety MA, Nair S, Escuyer V, Ben Younes A, Simonet M, Marceau M: Yersinia pseudotuberculosis harbors a type IV pilus gene cluster that contributes to pathogenicity. Infect Immun. 2002, 70 (11): 6196-6205. 10.1128/IAI.70.11.6196-6205.2002.PubMed CentralView ArticlePubMedGoogle Scholar
  8. Chauvaux S, Rosso ML, Frangeul L, Lacroix C, Labarre L, Schiavo A, Marceau M, Dillies MA, Foulon J, Coppée JY, Médigue C, Simonet M, Carniel E: Transcriptome analysis of Yersinia pestis in human plasma: an approach for discovering bacterial genes involved in septicaemic plague. Microbiology. 2007, 153 (9): 3112-3124. 10.1099/mic.0.2007/006213-0.View ArticlePubMedGoogle Scholar
  9. Chain PS, Carniel E, Larimer FW, Lamerdin J, Stoutland PO, Regala WM, Georgescu AM, Vergez LM, Land ML, Motin VL, Brubaker RR, Fowler J, Hinnebusch J, Marceau M, Médigue C, Simonet M, Chenal-Francisque V, Souza B, Dacheux D, Elliott JM, Derbise A, Hauser LJ, Garcia E: Insights into the evolution of Yersinia pestis through whole-genome comparison with Yersinia pseudotuberculosis. Proc Natl Acad Sci USA. 2004, 101 (38): 13826-13831. 10.1073/pnas.0404012101.PubMed CentralView ArticlePubMedGoogle Scholar
  10. Andrews SC, Robinson AK, Rodriguez-Quinones F: Bacterial iron homeostasis. FEMS Microbiol Rev. 2003, 27 (2–3): 215-237. 10.1016/S0168-6445(03)00055-X.View ArticlePubMedGoogle Scholar
  11. Schaible UE, Kaufmann SH: Iron and microbial infection. Nat Rev Microbiol. 2004, 2 (12): 946-953. 10.1038/nrmicro1046.View ArticlePubMedGoogle Scholar
  12. Abdul-Tehrani H, Hudson AJ, Chang YS, Timms AR, Hawkins C, Williams JM, Harrison PM, Guest JR, Andrews SC: Ferritin mutants of Escherichia coli are iron deficient and growth impaired, and fur mutants are iron deficient. J Bacteriol. 1999, 181 (5): 1415-1428.PubMed CentralPubMedGoogle Scholar
  13. Sanyal I, Cohen G, Flint DH: Biotin synthase: purification, characterization as a [2Fe-2S]cluster protein, and in vitro activity of the Escherichia coli bioB gene product. Biochemistry. 1994, 33 (12): 3625-3631. 10.1021/bi00178a020.View ArticlePubMedGoogle Scholar
  14. Nordlund P, Reichard P: Ribonucleotide reductases. Annu Rev Biochem. 2006, 75: 681-706. 10.1146/annurev.biochem.75.103004.142443.View ArticlePubMedGoogle Scholar
  15. Munier-Lehmann H, Chenal-Francisque V, Ionescu M, Chrisova P, Foulon J, Carniel E, Barzu O: Relationship between bacterial virulence and nucleotide metabolism: a mutation in the adenylate kinase gene renders Yersinia pestis avirulent. Biochem J. 2003, 373 (2): 515-522. 10.1042/BJ20030284.PubMed CentralView ArticlePubMedGoogle Scholar
  16. Zhang Z, Gosset G, Barabote R, Gonzalez CS, Cuevas WA, Saier MH: Functional interactions between the carbon and iron utilization regulators, Crp and Fur, in Escherichia coli. J Bacteriol. 2005, 187 (3): 980-990. 10.1128/JB.187.3.980-990.2005.PubMed CentralView ArticlePubMedGoogle Scholar
  17. Vemuri GN, Altman E, Sangurdekar DP, Khodursky AB, Eiteman MA: Overflow metabolism in Escherichia coli during steady-state growth: transcriptional regulation and effect of the redox ratio. Appl Environ Microbiol. 2006, 72 (5): 3653-3661. 10.1128/AEM.72.5.3653-3661.2006.PubMed CentralView ArticlePubMedGoogle Scholar
  18. Veit A, Polen T, Wendisch VF: Global gene expression analysis of glucose overflow metabolism in Escherichia coli and reduction of aerobic acetate formation. Appl Microbiol Biotechnol. 2007, 74 (2): 406-421. 10.1007/s00253-006-0680-3.View ArticlePubMedGoogle Scholar
  19. Perrenoud A, Sauer U: Impact of global transcriptional regulation by ArcA, ArcB, Cra, Crp, Cya, Fnr, and Mlc on glucose catabolism in Escherichia coli. J Bacteriol. 2005, 187 (9): 3171-3179. 10.1128/JB.187.9.3171-3179.2005.PubMed CentralView ArticlePubMedGoogle Scholar
  20. Lindler LE, Klempner MS, Straley SC: Yersinia pestis pH 6 antigen: genetic, biochemical, and virulence characterization of a protein involved in the pathogenesis of bubonic plague. Infect Immun. 1990, 58 (8): 2569-2577.PubMed CentralPubMedGoogle Scholar
  21. El Tahir Y, Skurnik M: YadA, the multifaceted Yersinia adhesin. Int J Med Microbiol. 2001, 291 (3): 209-218. 10.1078/1438-4221-00119.View ArticlePubMedGoogle Scholar
  22. China B, Sory MP, Nguyen BT, Debruyere M, Cornelis GR: Role of the YadA protein in prevention of opsonization of Yersinia enterocolitica by C3b molecules. Infect Immun. 1993, 61 (8): 3129-3136.PubMed CentralPubMedGoogle Scholar
  23. Sallmann FR, Baveye-Descamps S, Pattus F, Salmon V, Branza N, Spik G, Legrand D: Porins OmpC and PhoE of Escherichia coli as specific cell-surface targets of human lactoferrin. Binding characteristics and biological effects. J Biol Chem. 1999, 274 (23): 16107-16114. 10.1074/jbc.274.23.16107.View ArticlePubMedGoogle Scholar
  24. Orsi N: The antimicrobial activity of lactoferrin: current status and perspectives. Biometals. 2004, 17 (3): 189-196. 10.1023/B:BIOM.0000027691.86757.e2.View ArticlePubMedGoogle Scholar
  25. Cornelis GR: The Yersinia Ysc-Yop 'type III' weaponry. Nat Rev Mol Cell Biol. 2002, 3 (10): 742-752. 10.1038/nrm932.View ArticlePubMedGoogle Scholar
  26. Cornelis GR, Sluiters C, Delor I, Geib D, Kaniga K, Lambert de Rouvroit C, Sory MP, Vanooteghem JC, Michiels T: ymoA, a Yersinia enterocolitica chromosomal gene modulating the expression of virulence functions. Mol Microbiol. 1991, 5 (5): 1023-1034. 10.1111/j.1365-2958.1991.tb01875.x.View ArticlePubMedGoogle Scholar
  27. Frangeul L, Glaser P, Rusniok C, Buchrieser C, Duchaud E, Dehoux P, Kunst F: CAAT-Box, Contigs-Assembly and Annotation Tool-Box for genome sequencing projects. Bioinformatics. 2004, 20 (5): 790-797. 10.1093/bioinformatics/btg490.View ArticlePubMedGoogle Scholar
  28. Tatusov RL, Galperin MY, Natale DA, Koonin EV: The COG database: a tool for genome-scale analysis of protein functions and evolution. Nucleic Acids Res. 2000, 28 (1): 33-36. 10.1093/nar/28.1.33.PubMed CentralView ArticlePubMedGoogle Scholar


© Rosso et al; licensee BioMed Central Ltd. 2008

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
