Practical applicability of ARDRA

The theoretical turnaround time of ARDRA is 6 hours, and the average identification time in practice during this study was 36 hours. It should be emphasized that the technique was not fully implemented in the routine laboratory, but was carried out by the research laboratory technicians, which means that the practical turnaround time should be far less than 36 hours in a routine diagnostic laboratory. Technically, ARDRA is nondemanding, comprising only basic molecular biology techniques like simple DNA extraction, PCR, restriction digestion and submarine agarose gel electrophoresis.

General considerations

We have addressed previously the several limitations of molecular biology based detection in diagnostic bacteriology [23]. Others agree that the expectations that DNA amplification technologies would supplant microscopy, accurately predict culture results and provide an immediate definitive diagnosis were premature and that these claims have to be replaced with a more realistic view of the limitations and of the practical value of molecular diagnostics of tuberculosis [10, 24, 25]. Also the expectation that susceptibility would be carried out solely by means of DNA technology, had to be moderated [26]. Despite the fact that during the last ten years a tremendous effort, both in academic and commercial research, has been put into the applicability of nucleotide amplification techniques for the detection of mycobacteria directly from clinical samples, the CDC approved application of these techniques only for smear positive samples. This implicates that for 52% of the culture positive samples with M. tuberculosis encountered in this study, DNA technology would not have accelerated detection, since microscopy was negative. Recently, AMTD2 (GenProbe) gained FDA approval for testing smear negative sputa, but the cost of the technique keeps limiting its use to only those smear negative samples with strong clinical suspicion of tuberculosis. Moreover, since this kind of direct detection amplification technology is technically demanding or requires specialized equipment and kits, many laboratories carry out these tests only at well-set time intervals [e.g. [11]], delaying diagnosis with several days on average, and as such loosing some of the time gain offered by these direct detection methods. As a final remark, one should keep in mind that direct detection without direct antimicrobial susceptibility testing does not obviate the need for culture after all.

ARDRA compared to other culture based genotypic identification techniques

ARDRA and other gene restriction techniques [14, 15, 21, 27, 28] have been developed as a practical short cut to full sequence determination. From this study and others it is clear that the discriminatory power of these RFLP approaches for identification of mycobacteria is almost as high as that of sequencing. The discriminatory power and reliability of a commercially available rRNA-spacer based hybridisation assay (INNO-LiPA Mycobacteria) is high, but again this approach is somewhat more laborious and more expensive than in house PCR-RFLP-based techniques. Restriction digestion of a 439 bp stretch of the hsp65 gene for identification of mycobacteria was described almost simultaneously with ARDRA and designated PCR-RFLP Analysis (PRA) [15]. Several laboratories have published their experience using this technique [e.g. [14, 27, 28]]. Possible drawbacks of hsp65 gene restriction analysis are the smaller sized restriction fragments and the higher intraspecific variability, which may make interpretation more difficult. The small size differences have led to the use of polyacrylamide gel electrophoresis [27], which is less practical than agarose gel electrophoresis and the interpretation difficulties in general have led to reconsideration of the hsp65 gene restriction profiles used thus far [28]. Comparable remarks can be made for PCR-RFLP analysis of the rRNA spacer region [21].

Future developments

At present, in an effort to have the best of both worlds, we are performing a double PCR, directly on smear positive, decontaminated samples, extracting DNA with the commerially available QiaAmp Tissue kit (Qiagen, Hilden, Germany). One PCR attempts to amplify the full length 16S rRNA gene (1500 bp), which can be used for ARDRA, at an annealing at 55°C, and one PCR amplifies a 123 bp region of the IS6110 at an optimal annealing of 68.6°C [29]. Both PCRs are carried out simultaneously in a T-gradient thermocycler (Biometra, Göttingen, Germany), programmed to have both annealing temperatures in the 96 well block. In case of the presence of the 123 bp fragment on an agarose gel, the identification of M. tuberculosis is completed, and can optionally be confirmed with ARDRA. Due to the higher sensitivity of the IS6110 PCR compared to the rDNA PCR, we could amplify the IS6110 fragment of M. tuberculosis directly from all smear positive, M. tuberculosis culture positive samples thus far. In case only the 16S rDNA fragment of 1500 bp is present, the absence of M. tuberculosis can be confirmed by ARDRA which also immediately provides with the identification of the Mycobacterium species other than tuberculosis. Thus far, this yielded in all cases an identification as a nontuberculous strain, confirming the absence of M. tuberculosis. Also in case both amplifications of the smear positive sample remain negative, this can be interpreted as the absence of M. tuberculosis. A positive culture is then awaited to identify the nontuberculous organism with ARDRA.

Taxonomical considerations

This study also confirmed the robustness of ARDRA based identifications. For example, for the first study [12], we received strains identified by reference laboratories as M. avium and M. xenopi, using phenotypic methods. During the first study already, some strains that had been sent as M. avium could be shown by ARDRA (and subsequent confirmation by another laboratory) to be M. scrofulaceum. For M. xenopi, ARDRA indicated the presence of several groups. In the meantime mycobacterial taxonomy has been refined and the groups we indicated as M. xenopi A and M. xenopi B [12] appear to correspond to genuine M. xenopi, resp. M. celatum (ITG 6147)[30], as becomes apparent when applying the programme RFLP on the 16S rRNA sequence data we obtained. Similarly, strains that we classified as M. fortuitum A and B [12], appear to correspond to M. fortuitum subsp. fortuitum, resp. M. peregrinum.

Strains

A collection of well characterized reference strains belonging to different mycobacterial species was used to create an ARDRA profile library. The strains used are listed in Table 1. The 151 clinical strains used in this evaluation were collected during the period between January 1998 and December 2000 in the routine clinical laboratory of the Ghent University Hospital.

Processing and culturing of the samples

Decontamination of the samples was done by mixing 1 ml of sample with 1 ml of decontamination buffer (3% NaOH/N-acetyl L-cysteine (NALC)). After 15 min of incubation at room temperature the mixture was neutralized by adding 40 ml of 0.067 M phosphate buffer (pH 6.8), followed by centrifugation at 11600 g during 15 min. The supernatant was removed and part of the pellet was used for auramine staining and microscopy. The remaining pellet was suspended in 1 ml of phosphate buffer and used for inoculation of culture media. 100 μl was used for inoculation of a solid medium (Ogawa, Sanofi-Pasteur, Marnes la Coquette, France) and 500 μl for the inoculation of a liquid medium. During this study the automated liquid culture system was changed from the Bactec system (Becton Dickinson, Cockeysville, Md.) to the 3D BacT/Alert system (Organon Teknika, Boxtel, The Netherlands).

DNA extraction

Starting from liquid culture, 500 μl of a positive culture was transferred to a 1.5 ml screw cap Eppendorf tube. After centrifugation at 13.000 rpm for 15 minutes, the supernatant was removed and the resulting pellet was resuspended in 50 μl TE buffer (100 mM Tris-HCl – 10 mM EDTA, pH 8.0). The mixture was heated for 30 minutes at 95°C, followed by a freezing step at -20°C for at least 30 minutes. Starting from solid culture, a loopful of a bacterial colony was suspended in 500 μl of TE buffer. The mixture was heated at 95°C for 30 minutes, followed by a freezing step at -20°C for at least 30 minutes. Prior to PCR, DNA extracts were thawed at 4°C and centrifuged shortly to pellet the debris.

ARDRA for mycobacteria consists of the amplification of the 16S rRNA gene, followed by separate restriction digestion with Hha I, Mbo I and Rsa I The combination of the three obtained fingerprints is designated an ARDRA profile which can be compared with a library of ARDRA profiles, obtained from well-identified mycobacterial strains. In some cases, more discriminatory identification is possible by additional restriction with Bst UI.

Amplification of the 16S rRNA gene

The primers used to amplify the full length 16S rRNA gene (approximately 1500 bp) were MBUZ1 (GAC GAA CGC TGG CGG CGT GCT TAA C) and MBUZ2 (CGT CCC AAT CGC CGA TC). These primers are designated to amplify only the 16S rRNA gene for species of the order Actinomycetales. The PCR mixture consisted of 25 μl Qiagen Mastermix (Qiagen, Hilden, Germany), 0.2 μM of each primer, 5 μl of DNA extract, and was adjusted to 50 μl with distilled water. Thermal cycling consisted of an initial denaturation of 5 min at 94°C, followed by three cycles of 1 min at 94°C, 2 min at 55°C and 1 min at 72°C, followed by 30 cycles of 20 sec at 94°C, 1 min at 55°C and 1 min 72°C, with a final extension of 7 min at 72°C, and cooling at 10°C.

Amplification of 123 bp of the IS6110 region was carried out as described [29] after DNA extraction from decontaminated sputum samples using the QiaAmp Tissue kit (QiaGen, Hilden, Germany).

Restriction digestion

The restriction enzymes used were Hha I (isoschizomer of CfoI)(Amersham Pharmacia Biotech Benelux, Roosendaal, the Netherlands), Mbo I (Fermentas, Vilnius, Lithuania), Rsa I (Amersham Pharmacia). When necessary for further discrimination, digestion with Bst UI (New England Biolabs, Beverly, Ma.) was carried out. Each 16S rDNA amplicon was divided in three separate tubes in aliquots of 10 μl, to which 10 U of the respective restriction enzymes were added, with 2 μl of the corresponding enzyme buffer (10× concentrated, final concentration 2×) and each restriction digestion mixture was adjusted to 20 μl with distilled water and incubated during 2 hours at 37°C in a heater.

Electrophoresis

The DNA restriction fragments were electrophoresed in a 2.5% agarose electrophoresis gel, containing 2% Methaphor (FMC Bioproducts, Rockland, Me.) and 0.5% MP agarose (Roche) in the presence of ethidium bromide (50 ng/ml). The gels were photographed and the fingerprints were compared visually with the overview gels (Figures 1, 2 and 3).

16S rDNA sequencing and comparative analysis

A fragment of the 16S rRNA gene (corresponding to positions 10-1507 in the Escherichia coli numbering system) was sequenced as described previously [31]. Sequencing primers were MB UZ1 (GACGAACGCTGGCGGCGTGCT TAAC, E. coli position 27-50), MB UZ2 (CGTCCCAATCGCCGATC, 1493 – 1476), MBP1 (CCGGCCAACTACGTGCCAGC, 502 – 522), MBP2 (CTGGAATTCCTGGTGTAGCGG, 673 – 693), MBP3R (GCATGTCAAACCCAGGTAAGG, 1006 – 986) and MBP4R (CCACCTTCCTCCGAGTTGACC, 1185 – 1165)

The 16S rDNA sequences obtained in this study are indicated in Table 1. All steps of the comparative sequence analysis were performed by using the GeneBase software package (Applied Maths, St. Martens Latem, Belgium), as described [32]. First, pairwise alignment using UPGMA was carried out with a gap penalty of 100 %, a unit gap cost of 20 % and an ambiguity cost of 50 % of the mismatch cost. Subsequently, global alignment – with N. asteroides ATCC 49872 (Genbank Z82229) used as the outgroup – was carried out on the region corresponding to positions 67 through 1444 of the 16S rRNA gene of E. coli, with costs as above. Finally, a similarity matrix of the aligned sequences was constructed by global alignment homology calculation and a gap penalty of 20 %. The neighbour-joining method was used to construct the dendrogram based on this similarity matrix. Bootstrap values were calculated.