Bacterial strains and inoculum preparation
The study organisms were MAP (American Type Culture Collection (ATCC) 19,698), methicillin-resistant Staphylococcus aureus (ATCC 43300), and Escherichia coli (ATCC 25922). S. aureus and E. coli were included as controls to confirm copper treatment efficacy on Gram-positive and Gram-negative bacteria [12,13,14,15]. MRSA and E. coli strains were kept at −80 °C, then cultured on blood agar plates (Oxoid Diagnostic Reagents, UK) containing 5% lamb’s blood incubated at 37 °C for 24 h. One colony was transferred to a tube of Brain Heart Infusion (Oxoid Diagnostic Reagents, UK) and incubated overnight at 37 °C on an orbital shaker. The broth was then centrifuged at 3000 x g for 15 min at 4 °C, and the pellet was resuspended in 10 mL of sterile PBS. Bacterial concentrations were determined using serial 10-fold dilutions in PBS plate counting on blood agar. For testing, the concentration of bacteria was adjusted using PBS to obtain a final concentration of 1000 CFU mL−1.
MAP was cultured in 40 mL 7H9 broth supplemented with 10% oleic acid-albumin-dextrose- catalase (OADC) (Becton Dickinson and Company, USA), 2 mg mL−1 Mycobactin J (Allied Monitor, USA) and 5 mL L−1 glycerol for 1 month at 37 °C. MAP cultures were declumped by vortexing with sterile 3 mm glass beads. MAP growth was monitored weekly using a Helios Gamma1 spectrophotometer (Thermo Scientific). When the absorbance at 600 nm reached a value of 1.0, it was estimated be in late exponential growth at a concentration of ~ 108 MAP cells mL−1 with minimal dead cells present [20]. Ten-fold serial dilutions of MAP were made in PBS and 10−2, 10−4 and 10−6 dilutions were used for copper inactivation experiments. All bacterial suspensions were kept at 4 °C for no longer than 24 h until use.
Copper treatment
A copper treatment device consisting of a glass receptacle containing 300 mL PBS (0.5X) in which two high purity copper plates were immersed was used. The copper plates were stimulated with a low voltage (24 V) electric current (3 Amperes) to quickly release large concentrations of copper ions. A magnetic stirrer placed in the glass receptacle allowed constant mixing during treatment (Fig. 3).
Test protocol
Copper-treated and non-treated suspensions of MAP (106 CFU mL−1, 104 CFU mL−1, 102 CFU mL−1), and MRSA and E. coli, both at 103 CFU mL−1 were tested. The negative control was unspiked PBS not treated with copper ions. Each treatment was independently replicated five times in duplicate. Bacterial suspensions were sampled before and after each copper treatment.
Evaluation of MAP, MRSA and E. coli viability and enumeration
MAP viability and quantification was determined using three complementary techniques: a phage amplification assay, MGIT culture and qPCR. The phage-based method exploits the ability of D29 mycobacteriophage to replicate within and subsequently lyse only viable cells of mycobacteria. Products of phage amplification following infection are observed as lysed areas (plaques), which can be recorded after 24 h on indicator plates prepared with fast-growing Mycobacterium smegmatis [27]. The phage amplification assay was used to obtain a rapid estimation (within 24–48 h) of MAP numbers and viability as described by Foddai and Grant [28] with minor modifications. Hundred μL of MAP PBS suspension were added to 900 mL of 7H9/OADC/CaCl2 broth (i.e. 10−1 dilution), incubated overnight at 37 °C, and used as sample to be tested by the phage assay. The number of plaque forming units (PFU) has been correlated with the number of colony forming units (CFU) of MAP using the phage amplification assay (r2 = 0.9514) previously [28]. To confirm that plaques were due to MAP, up to 10 plaques were cut from the agar and pooled, before DNA was extracted and tested to confirm MAP by a previously published real-time IS900 PCR method [29]. Primer sequences, which amplified a 63-nucleotide fragment of the IS900 gene target, were 5′-GACGCGATGATCGAGGAG-3′ and 5′-GGGCATGCTCAGGATGAT-3′, and the probe sequence was 5′ 6-FAM/ACCTCCGTAACCGTCATTGTCCAGATCA/3′ BHQ-1. In parallel with the phage amplification assay, 100 μL of MAP PBS suspensions were inoculated into the liquid culture BACTEC-MGIT 960 system (Becton Dickinson, Sparks, MD), used according to manufacturer’s instructions, in order to evaluate the ability of MAP to recover viability or repair damage and grow after treatment. Furthermore, BACTEC-MGIT 960 culture system allowed us to make a semi-quantitative assessment of MAP load by determining the time taken for culture tubes to signal positive (time to detection, TTD). To each MGIT tube was added 800 μL of MGIT ParaTB supplement (Becton Dickinson, Sparks, MD), and 500 μL of egg yolk suspension (Becton Dickinson, Sparks, MD). In order to avoid antibacterial effect other than copper ions, no polymyxin B, amphotericin B, nalidixic acid, trimethoprim, and azlocillin (PANTA) antimicrobial cocktail was added to MGIT tubes. A 200 μl aliquot of all growth positive MGIT cultures was subjected to DNA extraction and purification according to a published protocol [6], then confirmed molecularly to be MAP positive by a real-time PCR technique [6].
Bacterial load (genome equivalent) from MAP PBS suspensions, before and after treatment, were estimated, according to a published protocol [19], based on the concentration of MAP DNA that was measured in a Nanoquant spectrophotometer (TECAN group, Männedorf, Schweiz) adjusted for a 108 dilution and the number of copies of the IS900 target gene, and having the reference of the molecular weight of the genome of MAP ATCC strain 19,698 to establish a standard curve for estimation of MAP numbers in the sample by Roche 2.0 real-time PCR, according to the following equation:
$$ Genome\ equivalent=\frac{DNA\ concentration\ \left( ng/\mu l\right)\times \left(6.022\times {10}^{23}{mol}^{-1}\right)}{\begin{array}{c}\left(4.829\times {10}^6 base\ pairs\right)\times \left(1\times {10}^9 ng/g\times 660g/ mol\right)\\ {}\left( MAP\ ATCC\ 19698\ genome\right)\ \left( Base\ mass\right)\end{array}} $$
For MRSA and E. coli strains, bacterial concentrations in each sample were determined using serial 10-fold dilutions plated on blood agar. From each plate, a colony typical of S. aureus was identified using Staphytec Plus (Oxoid Diagnostic Reagents, UK) [30], or a colony typical of E. coli was identified using a panel of biochemical tests, which included Triple sugar iron agar, Lysine iron agar, Motility indole ornithine medium, Simmon’s citrate agar and Urea agar (all from Oxoid Diagnostic Reagents, UK).
To complement assessment of MAP viability by the phage amplification assay and MGIT culture, a Live/Dead staining technique (Live/Dead BacLight bacterial viability kit, Invitrogen) was applied to PBS suspensions, according to the manufacturer’s instructions, to differentiate cells treated with or without copper ions with undamaged and damaged permeable membranes. Stained samples were analysed using the computer-assisted sperm analysis (CASA) system (viability module of the Sperm Class Analyser®, Microptic, Spain), previously calibrated to bacterial size (field), and coupled to an epifluorescence microscope (Nikon E200, Japan) with a high-velocity camera (Basler AG, Germany). Viability percentages were established from a minimum of 200 cells for each sample obtained in different fields.
Statistical analysis
To test the assumption of normality of the obtained results, Shapiro-Wilk’s test was used. The statistical significance of the increase or reduction in plaque counts (PFU mL−1), MAP counts estimation (genome equivalent), and TTD observed for each treatment applied to buffer samples inoculated with viable MAP was assessed by Wilcoxon signed rank test (not normally distributed data). All data analyses were performed in GraphPad Prism 7.04 and differences with P < 0.05 were considered significant.
