A rapid seamless method for gene knockout in Pseudomonas aeruginosa

Media

E. coli DH5α (New England BioLabs) was maintained on lysogeny broth (LB) agar medium (10 g/L tryptone, 5 g/L yeast extract, 5 g/L NaCl, 15 g/L agar). P. aeruginosa PAO1 (obtained from Professor Michael Vasil, University of Colorado) [10] was maintained on brain-heart infusion (BHI) agar medium (5 g/L beef heart infusion, 12.5 g/L calf brains infusion, 2.5 g/L disodium hydrogen phosphate, 2 g/L glucose, 10 g/L peptone, 5 g/L sodium chloride, 15 g/L agar). For plasmid preparation, E. coli transformants were cultured in terrific broth (TB) (12 g/L peptone, 24 g/L yeast Extract, 9.4 g/L dipotassium hydrogen phosphate, 2.2 g/L potassium dihydrogen phosphate, 4 ml/L glycerol). Tryptone yeast extract and sucrose (TYS10) (10 g/L tryptone, 5 g/L yeast extract, 10% (W/V) filtered sucrose, 15 g/L agar) plates were used in the selection of the second homologous recombination event. Tetracycline at 10 μg/ml and 100 μg/ml were used to select E. coli transformants and P. aeruginosa merodiploids, respectively.

Amplification of the upstream and downstream sequences of the locus of interest

Sequence information was obtained from the Pseudomonas Genome Database (http://www.pseudomonas.com/). Partial overlapping flanking primers were designed to amplify the upstream and the downstream 500 bp DNA sequences of hasS, vreI and vreA using NEBuilder (http://nebuilder.neb.com/) (Additional file 1). We describe here the construction of the hasS deletion as an example, and provide sequencing confirmation for the vreA and vreI deletion constructs (Additional file 2). The flanking primers for the hasS deletion construct are as follows: upstream forward, 5′ cgggtaccgagctcgGCAAGACCCGCGATCCGC 3′ and upstream reverse, 5′ cgcgccgcgtgcggctCTCGTTGGTC 3′; downstream forward, 5′ agccgcacgcggcgcgATCGCTTCCG 3′ and downstream reverse, 5′ ctatgaccatgattacgGCAAGTATTCGCCGTGCACCG 3′ (overlapping bases in lower case, which facilitate fusion as shown in Fig. 1). The PCR reactions contained 200 μM dNTPs, 0.5 μM of forward and reverse primers, 10 ng/μl P. aeruginosa genomic DNA, 0.02 U/μl Q5 high fidelity DNA polymerase (New England Biolabs) in 1× reaction buffer containing 2 mM MgCl₂ supplied by the manufacturer. The thermo cycles were programmed as follows: initial denaturation at 98 °C for 3 min, followed by 30 cycles of 98 °C for 10 s, annealing temperature for 30 s, and 72 °C for 15 s, and a final extension at 72 °C for 2 min. The PCR products were analyzed by DNA agarose electrophoresis and purified by QIAquick spin-column (QIAGEN) before use.

Gibson assembly of the deletion construct

The pEX18Tc suicide plasmid was linearized within the multiple cloning site by restriction digest with EcoRI. The Gibson assembly reaction was performed as described by Gibson et al. [2]. The procedure is illustrated in Fig. 1. Briefly, the reaction mix contained 10 nM of each amplified upstream and downstream genomic DNA fragment, 5 nM of linearized pEX18Tc plasmid, 0.004 U/μl of T5 exonuclease, 4 U/μl of Taq ligase, 0.0125 U/μl of Q5 DNA polymerase, 5% (W/V) of PEG8000, 1 mM of NAD, 0.25 mM of dNTPs in 1× Q5 DNA polymerase reaction buffer containing 2 mM MgCl₂. Individual reagents or master mix can be acquired from New England Biolabs. The reaction mixture was incubated at 50 °C for 1 h and the resulting ligated plasmid was transformed into high efficiency chemically competent E. coli DH5α (New England Biolabs). Transformants were checked by colony PCR using the universal pEX18 vector primers, which flank the multiple cloning site: forward, 5′ GGCTCGTATGTTGTGTGGAATTGTG 3′ and reverse, 5′ GGATGTGCTGCAAGGCGATTAAG 3′ (annealing temperature: 55 °C). Positive clones were further verified by DNA sequencing (Eurofins Scientific). A colony containing the sequenced deletion suicide vector was inoculated in TB medium with 10 μg/ml tetracycline and shaken at 250 rpm, 37 °C for about 23 h. Plasmid DNA was extracted by QIAprep spin miniprep kit (QIAGEN).

Electroporation of P. aeruginosa and selection of the first homologous recombination

A variety of electroporation conditions [11–14] were tested and a method modified on the procedure described by Choi et al. [11] was used. One fresh colony of P. aeruginosa PAO1 was inoculated in 5 ml LB medium and grown overnight at 42 °C without shaking until reaching stationary phase. Cells from overnight cultures (4 ml) were harvested by centrifugation at 13000×g for 1 min at room temperature (~23 °C). The cell pellet was resuspended in 1 ml of 1 mM room temperature MgSO₄ followed by centrifugation and the supernatant was discarded. The cells were washed again and the cell pellet was resuspended in 50 μl of 1 mM room temperature MgSO₄. 5–10 μg of plasmid DNA was mixed with 50 μl of cell mixture, and the resulting mixture was transferred to a 2 mm gap electroporation cuvette (Sigma). Various pulsing parameters were tested for maximum transformation efficiency. Optimum electroporation conditions for PAO1 were determined to be 2.2 KV with a decaying exponential waveform (25 μF capacitor, 600 Ω) in a 2 mm gap cuvette at room temperature (see Results section Fig. 3). After pulsing on a Bio-Rad MicroPulser, 1 ml of BHI medium was added to the cuvette immediately and the mix incubated at room temperature for 5 min. The cells were transferred into a falcon tube and shaken at 37 °C for 3 h. Transformed cells were pelleted and 700 μl of the supernatant was discarded. The cells were resuspended in the remaining medium and plated on two to three BHI agar plates containing 100 μg/ml of tetracycline (BHI/Tc100). The plates were incubated at 37 °C for up to 64 h with recombinants generally appearing within the first 48 h.

sacB counter-selection of the second homologous recombination

Colonies growing on the BHI/Tc100 plates were checked by colony PCR using the pEX18 universal forward primer and a primer specific to the genomic DNA following the cloned 500 bp downstream sequence (5′ ACATCTGCACCAGGTCGTC 3′), as illustrated in Fig. 4. The pEX18 universal reverse primer and a primer specific to the genomic DNA before the cloned 500 bp upstream sequence could also be used to screen recombinants. Positive colonies were purified by streaking on new BHI/Tc100 plates. Purified merodiploids (~ 2 mm) were streaked on TYS10 plates using a single loop/tip and incubated at room temperature (~ 23 °C). Colonies that lost the integrated plasmid usually appear within 48–60 h. Colonies were examined by colony PCR using a set of primers flanking the genomic sequence of the deleted locus hasS (forward, 5′ GATTACCGAGTCTTGCCGGTTC 3′, and reverse, 5′ ACATCTGCACCAGGTCGTC 3′) as illustrated in Fig. 4. Colonies with the confirmed deletion were purified by streaking on a TYS10 plate and further verified by DNA sequencing (Eurofins Scientific).

Rapid and accurate construction of allelic exchange vectors using Gibson assembly

The construction of the allelic exchange vector for gene hasS was performed as shown in Fig. 1. First, the 500 bp upstream and downstream DNA sequences flanking the locus of interest were amplified (Fig. 2a). Gibson assembly was used to fuse and clone these fragments into the pEX18Tc allelic exchange vector as described in the Materials and Methods. Other high fidelity DNA polymerase such as Phusion DNA Polymerase can also be used in the PCR and Gibson assembly. The resulting deletion construct was transformed into E. coli DH5α. Colonies containing the deletion construct were confirmed by colony PCR using the universal pEX18 primer pair flanking the multiple cloning sites (Fig. 2b). Positive colonies containing both the upstream and downstream DNA fragments showed a 1 kbp insert and were further selected for DNA preparation and sequencing. The accuracy of the Gibson assembly was extremely high with more than 95% of the colonies tested during method development (n = 28) containing the mutant deletion allele with the correct sequence.

The pEX18 series of suicide vectors have been widely used for site-directed gene manipulation in P. aeruginosa and related bacteria [7]. The construction of a gene knockout vector usually involves several steps of subcloning. To accelerate the procedure, Wolfgang et al. [15] and Choi et al. [11] used overlap PCR and the Gateway cloning technology (Invitrogen) to generate gene deletion constructs. However, the Gateway technology procedure still requires several extra cloning steps: first, the upstream and downstream fragments are amplified by flanking PCR; secondly, the two fragments are fused together by overlap PCR; and finally the resulting deletion allele is purified by electrophoresis and cloned into a Gateway allelic exchange vector. Furthermore, the pEX18 suicide vectors must be modified to be compatible with the Gateway cloning system by adding the att flanking sites. Gateway proprietary reagents such as Clonase are used to recombine the deletion allele from the Gateway vector into the modified Gateway compatible pEX18 vector. Utilizing the method described herein the complete construct can be generated in two steps: first, the upstream and downstream DNA fragments are amplified by PCR; then the DNA fragments are ligated directly into a linearized pEX18 plasmid by single step Gibson assembly to generate the allelic exchange vector. Neither proprietary reagents nor modifications to the suicide vector are required.

Quick deletion construct transfer by electroporation and merodiploid selection

The transfer of the allelic exchange plasmid into P. aeruginosa is traditionally performed via conjugation. Specifically, the deletion construct is transformed into a conjugative E. coli strain, which is subsequently mated with recipient P. aeruginosa cells. After mating, transformed P. aeruginosa cells are isolated from the conjugation mixture by plating on media containing both triclosan and the antibiotic compatible with the plasmid resistance marker. Repetitive passage of the deletion construct under harsh double antibiotic selection places additional stress on the cells and may promote undesirable spontaneous mutations. Alternatively, we pursued a more direct approach via electroporation that avoids the multiple steps that may cause spontaneous mutations while shortening the protocol. Although transformation of P. aeruginosa by electroporation methods has previously been considered relatively inefficient, we have optimized the electroporation protocol described herein to transformation efficiencies similar to those obtained by conjugation.

To inhibit the DNA restriction-modification system of P. aeruginosa, the cells were grown at 42–43 °C overnight without shaking as described by Rolfe et al. [10]. To optimize the transformation efficiency, a panel of electroporation solutions was tested. Significant cell lysis was observed when water, 10–15% glycerol, HEPES buffer, 300–500 mM sucrose, 300–500 mM sorbitol or various combinations thereof were used. MgSO₄ at 1 mM was found to effectively maintain cell structure integrity and not interfere with electroporation. Therefore, cells were harvested and washed in 1 mM MgSO₄ at either 4 °C or 23 °C.

The optimum electric parameters were investigated by testing the transformation efficiency of a P. aeruginosa replicative plasmid pBSP11Tc^R at both 4 °C and 23 °C using 1 mm gap and 2 mm gap cuvettes at different voltages. The efficiencies of electroporation under these conditions are shown in Fig. 3.

Using these conditions the deletion construct was transferred into P. aeruginosa cells and integrated into the PAO1 chromosome by homologous recombination as shown in Fig. 4. Merodiploids in which the deletion construct is integrated into the chromosome usually appeared on the tetracycline selection plates within 40 h. In some cases, positive colonies appeared up to 60 h after electroporation. Beyond 72 h, spontaneous tetracycline resistant colonies began to appear. Suicide pEX18 vector constructs with alternate antibiotic resistance markers such as carbenicillin and gentamicin were also tested. However, colonies with spontaneous resistance against these antibiotics appeared as early as 20 h, which made selection of merodiploids more difficult. Therefore, tetracycline resistance appears to provide the most optimal selection marker for merodiploids by this method.

Tetracycline resistant colonies were analyzed by colony PCR to confirm the generation of merodiploids (Fig. 5). Using the universal pEX18 vector forward primer (primer 1) and a primer specific to a genomic sequence after the 500 bp downstream sequence (primer 4), colonies in which the plasmid integrated via the upstream homologous sequence yielded a ~ 2 kbp PCR product (Fig. 5, lane 3). Meanwhile, colonies in which the plasmid integrated via the downstream homologous sequence yielded a ~ 1 kbp band (Fig. 5, lane 2). The approximate crossovers for either of these crossover events are illustrated in Fig. 4. If the PCR was performed with the universal pEX18 vector reverse primer (primer 2) and a primer specific to a genomic sequence before the 500 bp upstream (primer 3), reversed patterns would be expected. Generally, 5–10 tetracycline resistant colonies were obtained, all of which were confirmed to be merodiploids by PCR.

Improved sucrose-sacB counter-selection of knockout mutants

Following confirmation by colony PCR, merodiploids were isolated by streaking selected colonies onto a fresh tetracycline selection plate to avoid carryover contamination. Isolated colonies were then streaked onto TYS10 plates containing 300 mM sucrose to select for colonies that have lost the integrated plasmid backbone containing sacB. The sacB gene was originally isolated from Bacillus subtilis and encodes levansucrase, which catalyzes the conversion of sucrose to levans, a molecule that is toxic to P. aeruginosa. The sucrose intolerance of merodiploids expressing sacB is caused by accumulation of levans in the periplasmic space, which is a slow process and does not cause immediate lethality. Direct streaking of tetracycline resistant colonies onto TYS10 plates and the alternative streaking from an intermediate culture in LB were directly compared and no difference was observed. However, considering the possibility that a wild type revertant may gain a growth advantage in an intermediate culture and outcompete the deletion mutant, streaking an isolated tetracycline resistant colony directly onto a TYS10 plate minimizes undesirable population bias arising prior to counter-selection. The TYS10 medium contains no salt and thus increases the sensitivity of cells to the accumulation of levans [16]. The sacB counter-selection was performed at room temperature to reduce sucrose hydrolysis and slow down the growth of P. aeruginosa to allow more effective selection of merodiploids having undergone the second homologous recombination event.

Sucrose-resistant colonies were analyzed by colony PCR. As illustrated in Fig. 4, two populations formed: one included the desired deletion mutants while the other included wild type revertants. The theoretical ratio between two populations is 1:1 and in the case of hasS, the ratio of ΔhasS vs wild type of 14 randomly selected colonies was 8:6, as judged by the 2 kb versus 1 kb insert, respectively (Fig. 6). However, the ratio may be biased towards one population if for example the gene to be deleted is beneficial for bacterial growth. The deletion of hasS was confirmed by DNA sequencing (Additional file 3).