Open Access

Characterizing the pathotype of neonatal meningitis causing Escherichia coli (NMEC)

  • D. S. S. Wijetunge1,
  • S. Gongati1,
  • C. DebRoy2,
  • K. S. Kim3,
  • P. O. Couraud4,
  • I. A. Romero5,
  • B. Weksler6 and
  • S. Kariyawasam1, 7Email author
BMC Microbiology201515:211

https://doi.org/10.1186/s12866-015-0547-9

Received: 11 May 2015

Accepted: 2 October 2015

Published: 14 October 2015

Abstract

Background

Neonatal meningitis-causing Escherichia coli (NMEC) is the predominant Gram-negative bacterial pathogen associated with meningitis in newborn infants. High levels of heterogeneity and diversity have been observed in the repertoire of virulence traits and other characteristics among strains of NMEC making it difficult to define the NMEC pathotype. The objective of the present study was to identify genotypic and phenotypic characteristics of NMEC that can be used to distinguish them from commensal E. coli.

Methods

A total of 53 isolates of NMEC obtained from neonates with meningitis and 48 isolates of fecal E. coli obtained from healthy individuals (HFEC) were comparatively evaluated using five phenotypic (serotyping, serum bactericidal assay, biofilm assay, antimicorbial susceptibility testing, and in vitro cell invasion assay) and three genotypic (phylogrouping, virulence genotyping, and pulsed-field gel electrophoresis) methods.

Results

A majority (67.92 %) of NMEC belonged to B2 phylogenetic group whereas 59 % of HFEC belonged to groups A and D. Serotyping revealed that the most common O and H types present in NMEC tested were O1 (15 %), O8 (11.3 %), O18 (13.2 %), and H7 (25.3 %). In contrast, none of the HFEC tested belonged to O1 or O18 serogroups. The most common serogroup identified in HFEC was O8 (6.25 %). The virulence genotyping reflected that more than 70 % of NMEC carried kpsII, K1, neuC, iucC, sitA, and vat genes with only less than 27 % of HFEC possessing these genes. All NMEC and 79 % of HFEC tested were able to invade human cerebral microvascular endothelial cells. No statistically significant difference was observed in the serum resistance phenotype between NMEC and HFEC. The NMEC strains demonstrated a greater ability to form biofilms in Luria Bertani broth medium than did HFEC (79.2 % vs 39.9 %).

Conclusion

The results of our study demonstrated that virulence genotyping and phylogrouping may assist in defining the potential NMEC pathotype.

Keywords

Biofilms Escherichia coli Genotyping Invasion assay Neonatal meningitis Serotyping Virulence

Background

Escherichia coli is a versatile bacterial species that exists as a commensal in the lower gastrointestinal tract of humans and animals as well as a pathogen that causes a variety of diseases [1, 2]. Unlike commensal E. coli, pathogenic E. coli harbor various virulence genes which provide the basis for categorizing them into different pathovars with each pathovar having the ability to establish a distinct infection [1]. These virulence traits include adhesins, iron acquisition systems, toxins, invasins, and serum resistant components of the cell wall that are encoded by the bacterial chromosome and plasmids [16].

A distinct pathotype of extra-intestinal pathogenic E. coli (ExPEC) known as neonatal meningitis-causing E. coli (NMEC) have the ability to survive in blood and invade meninges of infants to cause meningitis [1, 7, 8]. Escherichia coli associated neonatal meningitis is one of the most common infections that accounts for high mortality and morbidity rates (10–30 %) during the neonatal period [1, 9]. Although distinct sets of virulence traits have been identified in diarrheagenic E. coli and other ExPEC pathovars, distinct virulence traits have not been identified to define the NMEC pathotype [10]. Several studies have attempted to characterize NMEC strains using phenotypic and genotyping methods, such as serotyping, multi-locus sequence typing (MLST), phylogrouping, pulsed-field gel electrophoresis (PFGE), antibiotic resistance gene profiling, and virulence genotyping [7, 1013]. A recent study showed that NMEC strains are diverse in their virulence gene repertoire and the genes that are uniquely associated with NMEC have yet to be identified [10]. Although NMEC have to breach the blood brain barrier (BBB) to reach and infect the meninges, the studies that used various genotypic and phenotypic traits to characterize NMEC have not compared the ability of different NMEC strains to invade the BBB using a model comparable to human brain microvascular endothelial cells. Here, we attempted to determine the genotypic and phenotypic characteristics of NMEC including their ability to invade the BBB and identify a set of virulence genes that were relatively common in NMEC as compared to fecal E. coli from healthy humans (HFEC).

Results

Phylogenetic typing of NMEC and HFEC

All four major phylogenetic lineages (A, B1, B2, and D) were represented by both NMEC and HFEC although the distribution of each lineage among the isolates belonging to two sources (i.e. NMEC and HFEC) (Table 1, Additional file 1: Table S1) was different. Phylogroup B2 was overly represented in NMEC (67.92 %) as compared to HFEC (29.17 %) (p < 0.0001) whereas the phylogroups A and B1 were more common in HFEC (31.25 % and 12.5 %, respectively) than in NMEC (9.43 % and 3.77 %, respectively) (p = 0.0001 and p = 0.0225, respectively). No statistical difference was observed for the distribution of group D between NMEC and HFEC (p = 0.2395).
Table 1

Distribution of different phylogroups between neonatal meningitis E. coli (NMEC) and fecal E. coli from healthy individuals (HFEC). A p <0.05 reflects a statistical significance

Strains

Phylogroup (%)

  
 

A

B1

B2

D

NMEC

9.43

3.77

67.92

18.87

HFEC

31.25

12.5

29.17

27.08

p value

0.001

0.0225

<0.001

0.2359

Serotyping

Serotyping of NMEC and HFEC isolates (Fig. 1 and Table 2) showed that 18 different O serogroups were present in NMEC while 19 different O groups were observed in HFEC. Three isolates of NMEC and six isolates of HFEC were not typeable by the O antisera used in the study. Another four NMEC and two HFEC demonstrated multiple O antigen types. The most common O types present in NMEC were O1 (n = 9), O8 (n = 6), and O18 (n = 7) whereas O20 (n = 8) and O148 (n = 5) were more common in HFEC than the other O types. Similarly, among NMEC strains tested, ten different H types were observed, H7 being the most prevalent (n = 24). HFEC strains belonged to 19 different H types with nine isolates demonstrating an H- negative phenotype.
Fig. 1

Characteristics of neonatal meningitis E. coli (NMEC) and fecal E. coli from healthy individuals (HFEC) used in the study

Table 2

Distribution of O and H antigen types among NMEC and HFEC strains

NMEC

HFEC

O Type

No. of Isolates

H Type

No. of Isolates

O Type

No. of Isolates

H Type

No. of Isolates

1

9

1

4

7

4

4

1

2

3

4

6

8

3

5

2

5

1

5

4

9

2

7

5

6

2

7

24

10

1

8

2

7

2

9

1

20

8

11

2

8

6

10

1

36

1

12

1

11

1

18

1

38

1

15

3

15

1

19

3

46

1

18

1

16

2

27

1

68

3

19

1

18

7

6/41

6

73

1

21

1

19

1

POS

2

104

2

34

1

21

1

  

117

1

39

1

25

2

  

137

1

42

1

75

3

  

146

1

49

1

78

1

  

148

5

53

1

92

1

  

153

1

6/41

1

107

1

  

167

2

40/44

1

12/16

2

  

178

1

NEG

9

M

4

  

91/167

2

POS

13

NEG

3

  

M

1

  
    

NEG

6

  

M multiple O types, POS positive fliC PCR amplification but untypeable, NEG negative (no agglutination with O antisera or no fliC PCR amplification)

Serum resistance

No statistically significant difference in the percentages of serum resistant isolates between NMEC and HFEC (91.82 ± 2.17 and 90.97 ± 1.2, respectively) was observed (p =0.5172).

Virulence genotyping

The number of virulence traits present in NMEC was higher (13 ± 3.84) than in HFEC (5.50 ± 2.49) revealing a considerable variation between the virulence gene profiles of E. coli from two different sources (Additional file 1: Table S1). For example, of the 26 VFs examined in the study, the occurrence of 21 genes was significantly higher (p <0.05) in NMEC than in HFEC (Fig. 2 and Table 3). Notably, K1 capsular type, sfa/foc, sat, hlyA/D, iutA, papG III, and afa genes were only represented in NMEC populations, although their occurrence among NMEC isolates was low except for the K1 capsular type. Virulence traits kpsII, sitA, neuC, iucC, and vat were more commonly associated with NMEC than with HFEC (prevalence >70 % and representation >2-folds higher in NMEC than in HFEC). Similar to the observations made by previous studies, some virulence genes that were implicated in the penetration of BBB, such as fimH, npl, and ibeB were equally present in both NMEC and HFEC strains [10]. On the other hand, some virulence genes, such as cnf1 and traJ, that were considered to be required for NMEC pathogenesis, were possessed only by a minority of NMEC (cnf1 and traJ in 27.45 % and 43.40 % of NMEC, respectively). However, these genes were more frequently observed in NMEC than in HFEC (Table 3).
Fig. 2

Heat map demostrating the distribution of virulence genes in NMEC and HFEC. Red represents the presence and black represents the absence of a virulence gene; a, virulence genes equally present in both NMEC and HFEC; b, virulence genes are more prevalent and overly represented in NMEC than in HFEC; c, virulence genes are less prevalent in both NMEC and HFEC

Table 3

Occurrence (%) of virulence genes between neonatal meningitis E. coli (NMEC) and fecal E. coli (HFEC)

Gene

NMEC

HFEC

Chi Square value

p value

afa

9.43

0.00

7.446

0.0064

aslA

88.68

45.83

41.814

<0.0001

aufA

62.26

20.83

32.952

<0.0001

cnf

27.45

4.17

20.19

<0.0001

fimH

92.45

100.00

6.380

0.0115

hly

30.19

0.00

32.980

<0.0001

hlyD

35.85

0.00

45.995

<0.0001

ibeA

35.85

20.83

6.881

0.0087

ibeB

100.00

91.67

6.380

0.0115

iss

25.49

4.17

16.132

<0.0001

iucC

74.51

2.08

109.471

<0.0001

iutA

30.19

0.00

32.980

<0.0001

K1

75.47

0.00

116.821

<0.0001

kpsII

90.57

27.08

82.038

<0.0001

neuC

71.70

18.75

54.522

<0.0001

nlp1

100.00

97.92

0.505

0.4773

ompA

66.04

60.41

0.536

0.464

papC

3.77

0.00

2.296

0.129

papGII

31.37

2.08

25.833

<0.0001

papGIII

21.57

0.00

22.523

<0.0001

sat

49.02

0.00

62.279

<0.0001

sfa/foc

49.06

0.00

62.279

<0.0001

sitA

92.45

25.00

89.713

<0.0001

traJ

43.40

10.41

26.287

<0.0001

vat

76.47

18.75

32.829

<0.0001

p <0.05 reflects a statistical significance. Virulence genes that were more prevalent in NMEC compared to HFEC are marked in bold

PFGE

Out of the NMEC and HFEC isolates tested, only 98 were typeable by PFGE. The HFEC strain 17 and two NMEC isolates (14 and 20) were nontypeable with XbaI restriction digestion. The typeable isolates demonstrated 86 distinct PFGE fingerprint patterns or pulsotypes (Fig. 1). Of the 86 pulsotypes, 79 were unique and each pattern was present only in one isolate. The other seven pulsotypes were present in two or more isolates of E. coli. Not a single pulsotype was shared between NMEC and HFEC.

Biofilm assay

The ability to form biofilms on a microtitre plate by NMEC and HFEC were assessed using M9 minimal medium supplemented with niacin and Luria Bertani (LB) broth (Additional file 1: Table S1). About 53 % of NMEC strains cultured in M9 minimal medium were able to form biofilms on microtitre plates whereas only 39.9 % of HFEC possessed this phenotype (Fig. 1). However, this difference was not statistically significant (p = 1.000). A higher percentage of NMEC (79.2 %) formed biofilms when they were cultured in LB broth than in the M9 medium (52.8 %) but the ability to form biofilms by HEFC remained the same regardless of the medium used.

Antibiotic susceptibility testing and multilocus sequence typing (MLST)

As depicted in Table 4, a majority of NMEC and HFEC were susceptible to most of the antimicrobials tested in the study. All isolates tested were susceptible to gentamicin, imipenam, meropenem, piperacillin/tazobactam and amikacin. Only five isolates of NMEC and three isolates of HFEC were resistant to all four third generation cephalosporins (cefotaxime, cefpodooxime, ceftazidine and ceftrixone). The minimal inhibitory concentration (MIC) values for these eight isolates were increased by ≥3 folds when cefotaxime and ceftazidine were used in combination with clavulanic acid as compared to the MIC values for cefotaxime and ceftazidine alone confirming that these isolates possessed the ESBL resistance phenotype according to the Clinical Laboratory Standards Institute (CLSI) guidelines. To further characterize E. coli demonstrating an ESBL phenotype, they were subjected to MLST. The eight isolates with an ESBL phenotype fell into eight different sequence types (STs) demonstrating a clonal diversity among the isolates (Table 5).
Table 4

Antibiotic susceptibility profiles of NMEC and HFEC. Number of isolates (stated as percentages) in NMEC and HFEC were categorized as Sensitive (S), Intermediate (I) or Resistant (R) according to CLSI standards

Antibiotic

NMEC

  

HFEC

  
 

S

I

R

S

I

R

Ampicillin

50.94

3.773585

45.28

64.58

4.167

31.25

Cefazolin

96.23

0

3.77

93.75

0

6.25

Cefepime

96.23

0

3.77

100

0

0

Cefotaxime

90.57

0

9.43

93.75

0

6.25

Cefoxitin

90.57

0

9.43

95.83

2.08

2.08

Cefpodoxime

90.57

0

9.43

9.16

0

8.33

Ceftazidime

90.57

0

9.43

93.75

0

6.25

Ceftriaxone

88.68

1

9.43

91.66

2.08

6.25

Cephalothin

100

0

0

100

0

1

Ciprofloxacin

100

0

0

100

0

0

Gentamicin

100

0

0

100

0

0

Imipenem

100

0

0

100

0

0

Meropenem

100

0

0

100

0

0

Piperacillin/Tazobactam

100

0

0

100

0

0

Ceftazidime/Clavulanic acid

100

0

0

100

0

0

Amikacin

100

0

0

100

0

0

Amoxicillin

100

0

0

60.41

2.083

37.5

Chloramphenicol

94.34

0

5.66

97.91

2.083

0

Sulfa/Trimethoprim

81.13

0

18.86

93.75

0

6.25

Kanamycin

86.79

2

9.433

100

0

0

Nalidixic acid

96.23

0

3.773

81.25

0

18.75

Sulfisoxazole

67.92

3

14

68.75

16.66

14.58

Tetracycline

81.13

0

10

91.66

0

8.33

Table 5

Serotypes and multilocus sequence types (ST) of ESBL-positive isolates

Isolate

Serotype

Multilocus sequence alleles

ST

adk

fumC

gyrB

icd

mdh

purA

recA

NMEC2

O75:H7

40

20

19

14

23

1

10

ST843

NMEC3

O2:H1

36

24

9

13

17

11

25

ST73

NMEC44

O78:H4

6

4

12

1

20

13

7

ST23

NMEC46

O1:H7

27

32

24

29

26

19

22

ST59

NMEC50

O18:H7

37

38

19

37

17

11

26

ST95

HFEC2

O137:H6/41

13

14

19

22

17

14

203

ST2678

HFEC9

O167:H7

6

4

5

18

 

8

14

Unknown ST

HFEC13a

H7

6

19

3

16

11

8

173

Unknown ST

aNo agglutination with O antisera

In-vitro cell invasion assay

Invasion frequencies between NMEC and HFEC (85.31 ± 10.60 vs 54.04 ± 7.0387, respectively; p = 0.0196) displayed a statistically significant difference (Fig. 3). Except ten isolates of HEFC, all other HFEC and NMEC isolates were able to invade human cerebral microvascular endothelial cells (hCMECs) albeit at different invasion frequencies (Additional file 1: Table S1). Some HFEC strains demonstrated invasion frequencies similar to or higher than that of the prototypic NMEC strain RS218.
Fig. 3

Relative invasion frequencies observed between NMEC and HFEC populations. **Denotes a statistically significant difference (p < 0.05)

Discussion

Pathogenic E. coli consist of diarrheagenic E. coli causing intestinal disease and ExPEC causing extraintestinal diseases in humans and animals [1, 2]. Both diarrheagenic E. coli and ExPEC are grouped into many pathotypes or pathovars depending on the clinical outcome of the disease and virulence properties of E. coli involved [1, 11, 14]. Of these two major groups of pathogenic E. coli, ExPEC possess the ability to colonize and infect extraintestinal sites of the host by means of horizontally acquired genetic determinants or virulence genes [14]. Several studies have been conducted to identify the unique virulence traits of ExPEC, such as uropathogenic E. coli, NMEC, and avian pathogenic E. coli to understand the genetic makeup and pathogenic potential of different ExPEC pathovars [1013]. However, these studies indicate that substantial genotypic and phenotypic heterogeneity exist within each pathotype, and a pathotype cannot be defined merely based on the presence of a defined set of virulence genes or characteristics. Nevertheless, some virulence attributes are shared among different pathotypes making it difficult to delineate ExPEC pathotypes [7, 10, 12, 13, 15]. Here, we comparatively analyzed genotypic and phenotypic traits of NMEC and HFEC to identify the characteristics that would assist in defining the NMEC pathotype.

In this study, we examined a collection of NMEC for the most prevalent (>70 % of the NMEC population) and overly represented virulence traits found in NMEC as compared to HFEC (>3-fold) for defining the NMEC pathotype. Based on these criteria, we have identified six genes, namely, kpsII, K1, neuC, iucC, sitA, and vat, which were predominantly associated with NMEC pathotype. Among these, some virulence traits such as, kpsII, sitA, and vat are considered as typical traits of NMEC [10]. None of the HFEC isolates surveyed possessed all six genes, whereas 40 % of NMEC isolates harbored all six genes suggesting that these genes might be used to predict the NMEC pathotype (Fig. 4). As depicted in Fig. 4, a majority of NMEC possessed the K1 capsular type (n = 76 %). All K1+ NMEC were positive for sitA together with vat and/or iucC. Except three isolates, all other K1+ NMEC harbored the neuC gene as well. Taken together, these results suggest that a typical NMEC might be described as K1+ and sitA + and having at least two of the other three genes; vat, neuC and iucC. Using this criterion, it was possible to designate 74 % of NMEC used in this study as typical NMEC whereas none of the HFEC satisfied these benchmarks. However, typing of a larger collection of NMEC isolates representing different geographical regions might be required to confirm these observations.
Fig. 4

Distributin of K1, sitA, vat, neuC, and iucC genes among NMEC strains (n = 53). Red, positive for a gene; Grey, negative for a gene. Encircled area indicates the isolates used to define a typical NMEC

A PCR-based phylogrouping has been established to determine the clonality within E. coli pathotypes [16, 17]. Previous studies have identified group B2 as the most common phylogroup of ExPEC suggesting that phylogrouping may be used as a rapid typing method to identify potential ExPEC [10, 12, 14, 18]. In the present study, we observed that 67.9 % of NMEC fell into B2 phylogroup as compared to 29.2 % of HFEC tested in the study. Phylogroups A and B1 were more commonly associated with HFEC than with NMEC. The virulence gene profiles of NMEC strains belonging to each phylogroup lineage exhibited a higher prevalence of virulence genes as compared to HFEC strains belonging to the corresponding lineage (Table 6). Taken together, our observations emphasize that phylogrouping alone is not suitable for predicting potential NMEC.
Table 6

Number of virulence traits present in neonatal meningitis E. coli (NMEC) and fecal E. coli (HFEC) belonging to different phylogroups

Phylogroup

No. Virulence associated traits (Mean ± SD)

p value

 

NMEC

HFEC

 

A

10 ± 2.74

5.13 ± 2.33

0.0011a

B1

8.0 ± 2.83

6.5 ± 3.02

0.5610

B2

15.19 ± 3.21

4.64 ± 1.95

<0.0001a

D

12.4 ± 3.92

6.38 ± 2.79

0.0003a

aDenotes a statistically significant difference between NMEC and HFEC

Pulsotyping and serotyping have been used in various studies to identify pathogenic clones and to distinguish between pathogenic and nonpathogenic strains of many bacterial species [7, 19, 20]. In our study, we observed a considerable heterogeneity among both NMEC and HFEC. As depicted in Table 2, despite this diversity, many NMEC strains belonged to O1, O8, and O18 serogroups and H7 flagellar antigen type. Similar to our observation, previous studies have also noted that the H7 antigen is present in major virulent clones of ExPEC pathotypes making it a potential target for future diagnostic and therapeutic interventions [21, 22]. Two subtypes of H7 antigen have been identified for enterohemorrhagic E. coli (EHEC) based on the flicC (H7) allelic polymorphism, a technique which possibly can be used to type EHEC [23, 24]. For example, H7a and H7c subtypes have been identified in E. coli O157: H7 irrespective of their geographical origin and genetic variation observed with other molecular typing methods [23]. However, whether this genetic polymorphism of H7 does or does not exist in ExPEC pathotypes is currently unknown. Future studies focused on H7 allelic polymorphism of ExPEC may provide useful information to develop a novel subtyping technique to distinguish different ExPEC pathovars. The heterogeneity observed with PFGE was even greater than serotyping indicating that PFGE is not useful in distinguishing NMEC strains from HFEC.

Ability to form biofilms in different environmental conditions facilitates bacterial survival on abiotic surfaces and their resistance to antimicrobials and antiseptics [25, 26]. Given that biofilm formation is reported to assist in bacterial survival, colonization, and protection from host immune responses and antimicrobial agents, the ability to produce biofilms may play an important role in NMEC virulence [2527]. Therefore, we compared the capacity for biofilm formation by NMEC and HFEC. There was no significant difference in the ability of biofilm formation between NMEC and HFEC isolates when they were grown in M9 medium. However, when LB broth was used as the medium, NMEC demonstrated approximately 39 % increase in their ability to form biofilms. In consistent with our observations, previous studies have demonstrated that growth medium has an effect on biofilm formation by pathogenic bacteria [28, 29] . Jackson et al. noted that central carbon flux has a regulatory effect on the formation of biofilms [28]. In particular, readily available glucose has a negative regulatory effect on biofilm formation suggesting that the ability to form biofilms is a survival strategy by bacteria when the source of carbon is limited or complex [28]. The M9 medium contained 2 % glucose which is a readily available carbon source whereas in LB broth catabolizable amino acids are the source carbon source for bacterial growth. Increase in biofilm formation by NMEC in LB broth as compared to M9 medium might be due to readily available glucose in M9 medium suggesting that the source of carbon has an effect on biofilm formation by NMEC but not by HFEC.

Beta-lactam antibiotics are one of the major treatment options available for controlling meningitis in infant patients [30]. We evaluated the antibiotic sensitivity profiles of NMEC and HFEC along with ESBL resistance profiles. Although the majority of strains were sensitive to most of the antibiotics tested, eight isolates showed an ESBL-resistance phenotype. Interestingly, three of the ESBL-resistant isolates were fecal commensal isolates implying fecal flora as a source for the emergence of ESBL-resistance. Previous studies have indicated an association between ESBL types and MLST types [31]. The ESBL-positive E. coli identified in this study fell into ST73, ST23, and ST59 MLST types, which are known to contain E. coli possessing certain ESBL types. However, none of the ESBL-positive E. coli detected here did belong to ST131, a major MLST type associated with ESBL-positive E. coli [31]. The ESBL genes are commonly located on mobilizable elements (e g. transposons and broad host range plasmids) and ESBL genes are distributed among commensal microflora of humans and animals [32]. Although a positive correlation between the presence of ESBL-positive HFEC and ESBL-positive UPEC has been observed by many investigators, there is no evidence to suggest an association between the presence of ESBL-producing bacteria in vaginal or fecal flora of pregnant women and corresponding ESBL-producing bacterial infections in neonates [33]. Nevertheless, it has been demonstrated that the risk factors, such as premature delivery, premature membrane rupture, and low birth weight which are known to predispose infants to E. coli meningitis were correlated with the colonization of ESBL-producing Enterobacteriaceae in the infant gut [33].

Genetic heterogeneity of NMEC pathotype is one of the major constraints posing today to understand the pathogenesis of neonatal meningitis [7, 10, 12]. Concordance with these previous studies, we have also observed marked heterogeneity in the virulence gene profiles of NMEC. Although NMEC possessed more virulence genes than HFEC, some of the virulence genes (ibeA, sfa/foc, traJ, and cnf1), which have previously been implicated in NMEC pathogenesis were present only in <50 % of NMEC examined (Fig. 2) [3436]. The virulence traits, such as fimH, ompA, and nlp1 that are considered to be essential for NMEC survival in blood and the penetration of BBB were prevalent in both NMEC and HFEC suggesting these genes do not define the NMEC pathotype [3439]. The NMEC and HFEC strains that did not harbor these “essential” virulence genes were still able to invade hCMEC/D3. These data indicate that NMEC pathogenicity is poorly understood and highlight the need for future research directed at mining novel virulence traits that are truly involved in the penetration of BBB.

In the present study, NMEC strains harbored genes that encode iron acquisition systems (iutA, iucC, and sitA) and hemolysins (hlyA and hlyD), which were more frequently present in NMEC than in HFEC. In addition to providing a source of iron for bacterial growth through cell lysis, bacterial hemolysins are known to play some other mechanistic roles as well [40]. For example, sublytic amounts of E. coli hemolysin have been shown to increase the permeability of endothelial cell monolayers in a time- and dose-dependent manner in cultured pulmonary artery endothelial cells [40] . In the same study, a low dose of hemolysin was found to induce a toxin-mediated loss of endothelial barrier function. However, there is no scientific evidence to support the involvement of hemolysins of NMEC in increasing the permeability of BBB thereby aiding the disease pathogenesis.

In this study, an in vitro invasion assay was conducted to correlate the virulence traits of each isolate of E. coli with its ability to penetrate the BBB. As expected, NMEC strains which carried more virulence genes than HFEC were also more invasive in hCMEC/D3 cells than HFEC (Fig. 3). Interestingly, ten isolates of HFEC which demonstrated a noninvasive phenotype with in vitro cell invasion assay were negative for K1 capsular type, ibeA, traJ, and sfa/foc but were positive for fimH, ibeB, and nlpl indicating that ibeA, traJ, and sfa/foc may be important in NMEC pathogenesis even though their occurrence in NMEC was less than some other virulence genes. Except these ten noninvasive isolates, all other HFEC were able to invade the BBB barrier in vitro suggesting fecal commensal E. coli as a potential source of NMEC. It is known that a high level of bacteremia is a prerequisite for the attachment and invasion of BBB by NMEC [9, 41]. The present study also demonstrated that NMEC and HFEC were equally able to survive in human serum, supporting the speculation that commensal E. coli in the mother’s gut could be a source for NMEC in the baby. Perhaps serum resistance of NMEC may not be as important as previously thought because neonatal serum is deficient in many complement factors. It would be worthy to compare the survival potential of NMEC in serum collected from healthy adults and neonates. Further investigations on HFEC strains exhibiting invasive properties using animal models of meningitis may be needed to confirm that HFEC indeed have the potential to cause neonatal meningitis.

Conclusions

The current study results indicate that regardless of the genotypic and phenotypic heterogeneity observed among NMEC strains, some genotypic characteristics can still be used to distinguish NMEC from commensal E. coli.

Materials and methods

Bacterial strains and media

The NMEC comprised of 51 strains isolated from the cerebrospinal fluid of neonates with meningitis plus two well-characterized NMEC strains, RS218 (O18:K1:H7) and EC10 (O7: K1). The RS218 [42] and EC10 [43, 44] strains isolated from the cerebrospinal fluid of neonates with meningitis in the 1970’s were kindly provided by Dr. James Johnson, University of Minnesota, St. Paul, MN, USA and Dr. David Klumpp, Northwestern University, Evanston, IL, USA, respectively. Other NMEC strains (n = 51) isolated between 1989 and 1997 from patients in the United States were provided by Dr. K. S. Kim, Johns Hopkins University School of Medicine, Baltimore, Maryland, USA [10, 42]. Fecal E. coli (n = 48) isolated from feces of healthy individuals (HFEC) were obtained from the E. coli Reference Center collection (Pennsylvania State University, University, Park, PA, USA). These isolates were collected during the period between 1985 and 2005 from healthy individuals in two states of the U.S., New York and Pennsylvania. Unless otherwise mentioned, all the bacterial strains were grown in Luria Bertani (LB) broth (BD Technologies, Research Triangle Park, NC, USA) or LB agar (BD Technologies).

Phylogrouping of E. coli

All strains were assigned to four main phylogenetic groups; A, B1, B2 and D according to the method described by Clemont et al. [17]. Classification of phylogenetic groups was based on the amplification of two genes, chuA and yjaA and the DNA fragment, TspE4C2 by using a multiplex polymerase chain reaction (PCR) assay. The primers used are listed in Table 7.
Table 7

Primers used in the study

Primer Name

Gene/Function

Sequence 5’–3’

Product size

Reference

chuA.1

Phylogrouping

GACGAACCAACGGTCAGGAT

279

[17]

chuA.2

 

TGCCGCCAGTACCAAAGACA

  

yjaA.1

Phylogrouping

TGAAGTGTCAGGAGACGCTG

211

[17]

yjaA.2

 

ATGGAGAATGCGTTCCTCAAC

  

TspE4C2.1

Phylogrouping

GAGTAATGTCGGGGCATTCA

152

[17]

TspE4C2.2

 

CGCGCCAACAAAGTATTACG

  

afaF

Afimbrial adhesin

CAT CAA GCT GTT TGT TCG TCC GCC G

750

[52]

afaR

 

GCT GGG CAG CAA ACT GAT AAC TCT C

  

aslAF

Arylsulfatase

GCG TGA TGT TCA TGT CAA CC

463

[44]

aslAR

 

ATC CGC CAG ATC TAC AAT GC

  

aufAF

Auf fimbriae

TGC ACA TCA GGA AAC CAG ATA C

350

This study

aufR

 

GGC TCA CTG ATA TGG ATG ACA A

  

cnfF

Cytotoxic necrotizing factor1

CAT TCA GAG TCC TGC CCT CAT TAT T

498

[53]

cnfR

 

AAG ATG GAG TTT CCT ATG CAG GAG

  

fimHF

Type I fimbriae

GCA GTC ACC TGC CCT CCG GTA

508

[53]

fimHR

 

TGC AGA ACG GAT AAG CCG TGG

  

hlyAF

Alpha hemolysin

ACC ATA TAA GCG GTC ATT CCC GTC A

1177

[53]

hlyAR

 

AAC AAG GAT AAG CAC TGT TCT GGC T

  

hlyDF

Secretion protein for HlyA

CTC CGG TAC GTG AAA AGG AC

904

[54]

hlyDR

 

GCC CTG ATT ACT GAA GCC TG

  

ibeAF

Invasin of brain endothelium A

CAT TAG CTC TCG GTT CAC GCT

171

[55]

ibeAR

 

TTA CCG CCG TTG ATG TTA TCA

  

ibeBF

Invasin of brain endothelium B

GCA TATTCTGCTGGTTTCTAATGTC

660

This study

ibeBR

 

GTT CTG GAT TTT CTG TTC ATA ATT CA

  

issF

Increased serum survival

CAG CAA CCC GAA CCA CTT GAT G

323

[54]

issR

 

AGC ATT GCC AGA GCG GCA GAA

  

iutAF

Aerobactin synthesis

ATGAGCATATCTCCGGACG

587

[52]

iutAR

 

CAGGTCGAAGAACATCTGG

  

iucCF

Aerobactin synthesis

ACC CGT CTG CAA ATC ATG GAT

269

[55]

iucCR

 

AAA CCT GGC TTA CGC AAC TGT

  

sitAF

Periplasmic iron-binding protein

AGG GGG CAC AAC TGA TTC TCG

608

[56]

sitAR

 

TAC CGG GCC GTT TTC TGT GC

  

kpsMTII F

Capsular type II

GCG CAT TTG CTG ATA CTG TTG

272

[57]

kpsMT IIR

 

CAT CCA GAC GAT AAG CAT GAG CA

  

kpsMT K1

K 1 capsule

TAG CAA ACG TTC TAT TGG TGC

153

[57]

kpsMT IIR

 

CAT CCA GAC GAT AAG CAT GAG CA

 

[57]

neuCF

Capsular N-acetylneuraminic acid synthesis

GGT GGT ACA TTC CGG GAT GTC

676

[52]

neuCR

 

AGG TGA AAA GCC TGG TAG TGT G

  

Nlp I F

New lipoprotein I (adhesin/invasin)

AGT AAT ACT TCC TGG CGT AAA AGT GA

662

This study

Nlp I R

 

AAA TAG AAG TTG GTT TCA CTG AGA TG

  

ompAF

Outer membrane protein A

CACTAAATCCAACGTTTATGGTAAAA

 

This study

ompAR

 

GATACCTTTAACTTCGATCTCTACGC

  

papCF

Outer membrane usher protein of P pili

ATA TCC TTT CTG CAG GGA TGC AAT A

205

[57]

papCR

 

GAC GGC TGT ACT GCA GGG TGT GGC G

  

papG IF

Fimbrial adhesin PapG allele I

CTA CTA TAG TTC ATG CTC AGG TC

474

[54]

papG IR

 

CCT GCA TCC TCC ACC ATT ATC GA

  

papG IIF

Fimbrial adhesin PapG allele II

CCC AGC TTT GTT ATT TTC CTT G

190

[54]

papGIIR

 

TTC TTA CCA TGG CTG TAT GTC G

  

papGIIIF

Fimbrial adhesin PapG allele III

GGC CTG CAA TGG ATT TAC CTG G

258

[54]

papGIIIR

 

CCA CCA AAT GAC CAT GCC AGA C

  

satF

Secreted autotransporter toxin

GCAGCAAATATTGATATATCA

630

[58]

satR

 

GTTGTTGACCTCAGCAAGGAA

  

sfa/focF

S fimbrial adhesin

CGG AGG AGT AAT TAC AAA CCT GGC A

410

[57]

sfa/focR

 

CTC CGG AGA ACT GGG TGC ATC TTA C

  

trajF

Conjugal transfer

CAA TGG GGC TTT TAT TGA ACT C

369

This study

trajR

 

TGA CCA ACA CCC AGC ATA TAA A

  

vat1

Vacuolating cytotoxin

TCC TGG GAC ATA ATG GTC AG

900

This study

vat2

 

GTG TCA GAA CGG AAT TGT

  

adkF

MLST

ATTCTGCTTGGCGCTCCGGG

583

[49]

adkR

 

CCGTCAACTTTCGCGTATTT

  

fumCF

MLST

TCACAGGTCGCCAGCGCTTC

806

[49]

fumR

 

GTACGCAGCGAAAAAGATT

  

gyrBF

MLST

TCGGCGACACGGATGACGGC

911

[49]

gyrBR

 

GTCCATGTAGGCGTTCAGGG

  

icdF

MLST

ATGGAAAGTAAAGTAGTTGTTCCGGCACA

878

[49]

icdR

 

GGACGCAGCAGGATCTGTT

  

mdhF

MLST

ATGAAAGTCGCAGTCCTCGGCGCTGCTGGCGG

932

[49]

mdhR

 

TTAACGAACTCCTGCCCCAGAGCGATATCTTTCTT

  

purAF

MLST

TCGGTAACGGTGTTGTGCTG

816

[49]

purAR

 

CATACGGTAAGCCACGCAGA

  

recAF

MLST

CGCATTCGCTTTACCCTGACC

780

[49]

recAR

 

TCGTCGAAATCTACGGACCGGA

  

Serotyping

Serotyping was performed at the E. coli Reference Center (Pennsylvania State University) using a standard serum agglutination assay for the presence of all designated O groups (O1 to O187 except O13, O22, O31, O47 and O94 that are not designated) and H types (H1 to H56) [45].

Serum resistance

Survival of bacterial strains (both NMEC and HFEC) in normal human serum (EMD Millipore Corporation, Temecula, CA, USA) was determined by colorimetric microassay as previously described [46]. Briefly, log phase cultures of bacterial strains were incubated for 3 h at 42 °C in Peptone/Glucose broth containing 0.75 % bromothymol blue with or without 20 % normal human serum (NHS). Serum resistance of each strain was determined by comparing the color change from green to yellow in the presence of NHS.

Virulence typing of E. coli

NMEC and HFEC strains were examined for the presence of 26 genes encoding virulence factors (VFs) that have been previously attributed to the establishment of meningitis in neonates [1, 9]. The VFs included adhesins, invasins, toxins, siderophores, and structural components of E. coli. Virulence genes were detected by PCR amplification carried out on a Master Cycler Pro (Eppendorf, Hamburg, Germany). All primers were obtained from Integrated DNA Technologies (Coralville, IA, USA) and are listed in Table 7. Crude DNA was extracted by a rapid boiling method [47]. All PCRs were performed in 25-μl reactions containing 1 U of Taq DNA polymerase (Denville Scientific Inc., Metuchen, NJ, USA), 25 pmol each of the forward and reverse primers, and 5 nmol of each deoxynucleoside triphosphate (Denville) in 1× buffer (15 mM MgCl2, 100 mM KCl, 80 mM (NH4)2SO4, 100 mM Tris–HCl, pH 9.0, 0.5 % NP-40). The cycling conditions were as follows: initial denaturation at 94 °C for 3 min, followed by 30 cycles of three steps consisting denaturation at 94 °C for 1 min, primer annealing at the temperatures indicated in Table 7 for 1 min, and extension at 72 °C for at least 30 s, according to the size of the amplified fragment (1 min/Kbp), and followed by a final extension at 72 °C for 10 min. Products were electrophoresed in a 1.5 % agarose gel (Denville) for 1 h at 120 V, stained with ethidium bromide (Bio-Rad Laboratories, Hercules, CA, USA), and photographed under UV light using a gel documentation system (AlphaImager® HP, Alpha Innotech Corporation, San Leandro, CA, USA). Each PCR included a negative control that contained all reagents except template DNA and a positive control that contained an E. coli that is known to carry the respective virulence gene.

Pulsed-field gel electrophoresis

PFGE was conducted according to the method described by PulseNet [48]. Chromosomal DNA was digested with the XbaI restriction enzyme. The electrophoresis was performed using a CHEF DRII system (Bio-Rad, Marnes-la-Coquette, France) and the conditions consisted of an initial time of 2.2 s, a final time of 54.2 s at a gradient of 6 V cm−1 and an included angle of 120°. The gels were electrophoresed for 24 h. Salmonella enterica serotype Braenderup strain H9812 (ATCC BAA664, Manassas, VA, USA) was used as a molecular weight standard. A dendrogram was constructed using the Dice similarity coefficient and the unweighted-pair group method by average linkages (UPGMA) or neighbor joining algorithm with 3 % position tolerance using Bionumerics 4.0 software (Applied Maths, Austin, Texas, USA).

Biofilm assay

Qualitative biofilm assay was performed following the procedure described previously [27]. Briefly, overnight bacterial cultures were diluted to 1:100 in M9 minimal medium (BD Technologies) containing 10 μg/ml niacin or LB medium followed by inoculation into U-bottom 96-well plates (Denville) in triplicates. The plates were incubated at room temperature for 24 h at 37 °C. The plates were washed three times with distilled water and biofilms were stained with 0.1 % crystal violet for 15 min. After three washes with distilled water, the presences or absence of biofilms was evaluated.

Antibiotic susceptibility testing

Kirby-Bauer (KB) disk diffusion assay was conducted to determine antibiotic resistance profiles using antibiotic paper disks (BD Technologies). The antibiotics used in KB test were amikacin (30 μg), amoxicillin with clavulanic acid (20/10 μg), chloramphenicol (30 μg), kanamycin (30 μg), nalidixic acid (30 μg), sulfamethoxazole with trimethoprim (23.75/1.25 μg), sulfisoxazole (0.25 μg), and tetracycline (30 μg). Susceptibility or resistance profiles were interpreted according to Clinical Laboratory Standards Institute (CLSI) guidelines. Extended spectrum β-lactamase (ESBL) sensitivity profiles were screened using confirmatory ESBL plates according to manufacturer’s instructions (Sensititre; Thermo Fisher Scientific, Oakwood Village, OH, USA). The dilution range of antibiotic concentrations used were as follows; cefazolin (8–16 μg/ml), cefepime (1–16 μg/ml), cefoxitin (4–64 μg/ml), meropenem (1–8 μg/ml), cephalothin (8–16 μg/ml), cefpodoxime (0.5–64 μg/ml), ceftriaxone (1–128 μg/ml), ciprofloxacin (1–2 μg/ml), gentamicin (4–16 μg/ml), ampicillin (8–16 μg/ml), imipenem (0.5–16 μg/ml), piperacillin/tazobactam (4/4–64/4 μg/ml), ceftazidime (0.25–128 μg/ml), ceftazidime/clavulanic Acid (0.25/4–128/4 l μg/ml) and cefotaxime (0.25–64 μg/ml). Plates were incubated at 37 °C for 18 h and read automatically using Sensititre System (Thermo Fisher Scientific).

Multilocus sequence typing

Multilocus sequence typing (MLST) of ESBL-positive E. coli isolates was performed using seven housekeeping genes (adk, fumC, gyrB, icd, mdh, purA, and recA), as described previously [49]. Primer sequences were obtained from the E. coli MLST database website (http://mlst.ucc.ie/mlst/dbs/Ecoli) (Table 7). The cycling conditions were as follows: initial denaturation at 95 °C for 5 min, followed by 30 cycles of initial denaturation at 95 °C for 30 s, primer annealing at the melting temperatures for 30 s, and extension at 72 °C 1 min and followed by a final extension at 72 °C for 10 min. The PCR products were treated with exonuclease I and shrimp alkaline phosphatase (Affymetrix, Santa Clara, CA, USA) and sequenced at the Genomics Core Facility (Penn State University) with the same primers used to generate PCR products. Sequences were compared with E. coli MLST database website to determine the MLST types.

In-vitro cell invasion assay

The hCMEC/D3 cell line, which is known to possess the main characteristics of primary brain endothelial cells, was kindly provided by Dr. Babette Weksler at Weill Cornell Medical College (New York, NY, USA) [50]. Invasion assays were performed in triplicates using the method described previously [51]. Briefly, hCMEC/D3 cells were seeded on 96-well tissue culture plates coated with rat collagen (R&D Systems, Inc., Minneapolis, MN, USA) and maintained at 37 °C for six days in a humidified chamber containing 5 % CO2 to form a confluent monolayer. The complete medium used for culturing of hCMEC/D3 cells was EBM-2 endothelial basal medium (Lonza, Allendale, NJ, USA) containing 5 % bovine serum (GE Healthcare Bio-Sciences, Pittsburgh, PA, USA), 1.4 μM hydrocortisone (Sigma-Aldrich, St. Louis, MO, USA), 5 μg/ml ascorbic acid (Sigma), 1 % chemically defined lipid concentrate (Invitrogen, Carlsbad, CA, USA), 10 mM HEPES (GE Healthcare Bio-Sciences), and 1 ng/ml human basic fibroblast growth factor (Sigma). Cells were infected with E. coli strains with a multiplicity of infection (MOI) of 100 (100 bacteria per hCMEC/D3) and incubated for 2 hours at 37 °C in 5 % CO2. Cells were then washed with phosphate-buffered saline (PBS, pH 7) three times and incubated with fresh complete EBM-2 medium containing 100 μg/ ml gentamicin (Sigma) for one hour to kill extracellular bacteria. Subsequently, 0.2 ml of 0.01 % Triton X-100 (Sigma) was added to each well to release intracellular bacteria. Cells were fully disrupted by repeated pipetting and viable bacteria were enumerated by plating onto LB agar. Invasion frequencies were calculated comparing the ratio between the number of colony forming units (CFU) released from the cells and the number of CFU inoculated per well. To standardize the comparison of invasion frequencies, relative invasion was calculated as a percent of invasion in comparison to the well-characterized NMEC strain RS218, which was arbitrarily set at 100 %.

Ethics statement

Both NMEC and HFEC isolates, in their entirety, were collected for purposes other than this study and were given without any Health Insurance Portability and Accountability Act (HIPAA) identifiers by Dr. K.S. Kim (Johns Hopkins University, Baltimore, MD, USA) and Dr. C. DebRoy (E. coli Reference Center, University Park, PA, USA).

Statistical analysis

Data were statistically analyzed by Fisher’s exact test (virulence genotyping and phylogrouping), two-tailed student’s t -test (invasion frequency), and a p < 0.05 was considered statistically significant. The heat map of virulence gene profiles was constructed using the R code (version 3.1.1).

Availability of supporting data

The raw data supporting the results of this article are provided in the Additional file 1: Table S1.

Abbreviations

BBB: 

Blood brain barrier

CFU: 

Colony forming units

CLSI: 

Clinical Laboratory Standards Institute

ESBL: 

Extended spectrum β-lactamase

ExPEC: 

Extra-intestinal pathogenic E. coli

hCMEC: 

Human cerebral microvascular endothelial cells

HEPES: 

4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid

HFEC: 

Healthy fecal E. coli

MLST: 

Multi-locus sequence typing

NMEC: 

Neonatal meningitis-causing E. coli

PBS: 

Phosphate buffered saline

PCR: 

Polymerase chain reaction

PFGE: 

Pulsed-field gel electrophoresis

UPEC: 

Uropathogenic E. coli

VFs: 

Virulence factors

Declarations

Acknowledgements

This research was supported by start-up funds to S.K. from the Department of Veterinary and Biomedical Sciences at the Pennsylvania State University.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Veterinary and Biomedical Sciences, Pennsylvania State University
(2)
E. coli Reference Center, Department of Veterinary and Biomedical Sciences, Pennsylvania State University
(3)
Division of Pediatric Infectious Diseases, Johns Hopkins University School of Medicine
(4)
Department of Cell Biology, University of Paris Descartes
(5)
Department of Biological Sciences, Open University
(6)
Department of Medicine, Weill Cornell Medical College in New York
(7)
Center for Molecular Immunology and Infectious Disease, Pennsylvania State University

References

  1. Kaper JB. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004;2:123–40.View ArticlePubMedGoogle Scholar
  2. Croxen MA, Finlay BB. Molecular mechanisms of Escherichia coli pathogenicity. Nat Rev Micro. 2010;8:26–38.Google Scholar
  3. Smith JL, Fratamico PM, Gunther NW. Extraintestinal pathogenic Escherichia coli. Foodborne Pathog Dis. 2007;4:134–63.View ArticlePubMedGoogle Scholar
  4. Johnson JR. Extraintestinal pathogenic Escherichia coli: the other bad E. coli. J Lab Clin Med. 2002;139:155–62.View ArticlePubMedGoogle Scholar
  5. Johnson TJ, Nolan LK. Pathogenomics of the virulence plasmids of Escherichia coli. Microbiol Mol Biol Rev. 2009;73:750–74.PubMed CentralView ArticlePubMedGoogle Scholar
  6. Wijetunge DSS, Karunathilake KHEM, Chaudhari A, Katani R, Dudley EG, Kapur V, et al. Complete nucleotide sequence of pRS218, a large virulence plasmid, that augments pathogenic potential of meningitis-associated Escherichia coli strain RS218. BMC Microbiol. 2014;14:203.PubMed CentralView ArticlePubMedGoogle Scholar
  7. Bonacorsi S, Bingen E. Molecular epidemiology of Escherichia coli causing neonatal meningitis. Int J Med Microbiol. 2005;295:373–81.View ArticlePubMedGoogle Scholar
  8. Glode MP, Sutton A, Moxon ER, Robbins JB. Pathogenesis of neonatal Escherichia coli meningitis: induction of bacteremia and meningitis in infant rats fed E. coli K1. Infect Immun. 1977;16:75–80.PubMed CentralPubMedGoogle Scholar
  9. Kim KS. Pathogenesis of bacterial meningitis: from bacteraemia to neuronal injury. Nat Rev Neurosci. 2003;4:376–85.View ArticlePubMedGoogle Scholar
  10. Logue CM, Doetkott C, Mangiamele P, Wannemuehler YM, Johnson TJ, Tivendale KA, et al. Genotypic and phenotypic traits that distinguish neonatal meningitis-associated Escherichia coli from fecal E. coli isolates of healthy human hosts. Appl Environ Microbiol. 2012;78:5824–30.PubMed CentralView ArticlePubMedGoogle Scholar
  11. Bingen E. Phylogenetic analysis of strains causing neonatal meningitis suggests horizontal gene transfer from a predominant pool of highly virulent B2 group strains. J Infect Dis. 1998;177:642–50.View ArticlePubMedGoogle Scholar
  12. Johnson J, Oswald E, O’Bryan T, Kuskowsk iM, Spanjaard L. Phylogenetic distribution of virulence associated genes among isolates associated with neonatal bacterial meningitis in the Netherlands. J Infect Dis. 2002;185:774–84.View ArticlePubMedGoogle Scholar
  13. Johnson TJ, Logue CM, Johnson JR, Kuskowski MA, Sherwood JS, Barnes HJ, et al. Associations between multidrug resistance, plasmid content, and virulence potential among extraintestinal pathogenic and commensal Escherichia coli from humans and poultry. Foodborne Pathog Dis. 2012;9:37–46.PubMed CentralView ArticlePubMedGoogle Scholar
  14. Johnson JR, Delavari P, Kuskowski M, Stell AL. Phylogenetic distribution of extraintestinal virulence-associated traits in Escherichia coli. J Infect Dis. 2001;183:78–88.View ArticlePubMedGoogle Scholar
  15. Tivendale KA, Logue CM, Kariyawasam S, Jordan D, Hussein A, Li G, et al. Avian-Pathogenic Escherichia coli strains are similar to neonatal meningitis E. coli strains and are able to cause meningitis in the rat model of human disease. Infect Immun. 2010;78:3412–9.PubMed CentralView ArticlePubMedGoogle Scholar
  16. Adamus-Bialek W, Wojtasik A, Majchrzak M, Sosnowski M, Parniewski P. (CGG)4-Based PCR as a novel tool for discrimination of uropathogenic Escherichia coli strains: comparison with enterobacterial repetitive intergenic consensus-PCR. J Clin Microbiol. 2009;47:3937–44.PubMed CentralView ArticlePubMedGoogle Scholar
  17. Clermont O, Bonacorsi S, Bingen E. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl Environ Microbiol. 2000;66:4555–8.PubMed CentralView ArticlePubMedGoogle Scholar
  18. Picard B, Garcia JS, Gouriou S, Duriez P, Brahimi N, Bingen E, et al. The link between phylogeny and virulence in Escherichia coli extraintestinal infection. Infect Immun. 1999;67:546–53.PubMed CentralPubMedGoogle Scholar
  19. Mora A, Lopez C, Dabhi G, Blanco M, Blanco J, Alonso M, et al. Extraintestinal pathogenic Escherichia coli O1:K1:H7/NM from human and avian origin: detection of clonal groups B2 ST95 and D ST59 with different host distribution. BMC Microbiol. 2009;9:132.PubMed CentralView ArticlePubMedGoogle Scholar
  20. Liu D. Identification, subtyping and virulence determination of Listeria monocytogenes, an important foodborne pathogen. J Med Microbiol. 2006;55:645–59.View ArticlePubMedGoogle Scholar
  21. Korhonen TK, Valtonen MV, Parkkinen J, Väisänen-Rhen V, Finne J, Orskov F, et al. Serotypes, hemolysin production, and receptor recognition of Escherichia coli strains associated with neonatal sepsis and meningitis. Infect Immun. 1985;48:486–91.PubMed CentralPubMedGoogle Scholar
  22. Russo TA, Johnson JR. Proposal for a new inclusive designation for extraintestinal pathogenic isolates of Escherichia coli: ExPEC. J Infect Dis. 2000;181:1753–4.View ArticlePubMedGoogle Scholar
  23. Ratiner YA, Salmenlinna S, Eklund M, Keskimaki M, Siitonen A. Serology and genetics of the flagellar antigen of Escherichia coli O157:H7a,7c. J Clin Microbiol. 2003;41:1033–40.PubMed CentralView ArticlePubMedGoogle Scholar
  24. Wang L, Rothemund D, Curd H, Reeves PR. Species-wide variation in the Escherichia coli flagellin (H-Antigen) gene. J Bacteriol. 2003;185:2936–43.PubMed CentralView ArticlePubMedGoogle Scholar
  25. Stewart PS. Antibiotic resistance of bacteria in biofilms. Lancet. 2001;358:135–8.View ArticlePubMedGoogle Scholar
  26. Parsek MR. Bacterial biofilm: an emerging link to disease pathogenesis. Ann Rev Microbiol. 2003;57:677–701.View ArticleGoogle Scholar
  27. O’Toole GA. Microtiter dish biofilm formation assay. J Vis Exp. 2011; doi: 10.3791/2437
  28. Jackson DW, Simecka JW, Romeo T. Catabolite repression of Escherichia coli biofilm formation. J Bacteriol. 2002;184:3406–10.PubMed CentralView ArticlePubMedGoogle Scholar
  29. Reisner A, Krogfelt KA, Klein BM, Zechner EL, Molin S. In vitro biofilm formation of commensal and pathogenic Escherichia coli strains: impact of environmental and genetic factors. J Bacteriol. 2006;188:3572–81.PubMed CentralView ArticlePubMedGoogle Scholar
  30. Boyer-Mariotte S, Duboc P, Bonacorsi S, Lemeland JF, Bingen E, Pinquier D. CTX-M-15-producing Escherichia coli in fatal neonatal meningitis: failure of empirical chemotherapy. J Antimicrob Chemother. 2008;62:1472–4.View ArticlePubMedGoogle Scholar
  31. Oteo J, Diestra K, Juan C, Bautista V, Novais A, Pérez-Vázquez M, et al. Extended-spectrum β-lactamase-producing Escherichia coli in Spain belong to a large variety of multilocus sequence typing types, including ST10 complex/A, ST23 complex/A and ST131/B2. Intl J Antimicrob Agents. 2009;34:173–6.View ArticleGoogle Scholar
  32. Poirel L, Naas T, Nordmann P. Genetic support of extended-spectrum β-lactamases. Clin Microbiol Infect. 2008;14:75–81.View ArticlePubMedGoogle Scholar
  33. Duman M, Abacioglu H, Karaman M, Duman N, Ozkan H. β-lactam antibiotic resistance in aerobic commensal fecal flora of newborns. Pediatr Int. 2005;47:267–73.View ArticlePubMedGoogle Scholar
  34. Badger JL, Wass CA, Weissman SJ, Kim KS. Application of signature-tagged mutagenesis for identification of Escherichia coli K1 genes that contribute to invasion of human brain microvascular endothelial cells. Infect Immun. 2000;68:5056–61.PubMed CentralView ArticlePubMedGoogle Scholar
  35. Chi F, Jong TD, Wang L, Ouyang Y, Wu C, Li W, et al. Vimentin-mediated signalling is required for IbeA+ E. coli K1 invasion of human brain microvascular endothelial cells. Biochem J. 2010;427:79–90.View ArticlePubMedGoogle Scholar
  36. Khan NA, Wang Y, Kim KJ, Chung JW, Wass CA, Kim KS. Cytotoxic necrotizing factor-1 contributes to Escherichia coli K1 invasion of the central nervous system. J Biol Chem. 2002;277:15607–12.View ArticlePubMedGoogle Scholar
  37. Teng CH, Cai M, Shin S, Xie Y, Kim KJ, Khan NA, et al. Escherichia coli K1 RS218 interacts with human brain microvascular endothelial cells via type 1 fimbria bacteria in the fimbriated state. Infect Immun. 2005;73:2923–31.PubMed CentralView ArticlePubMedGoogle Scholar
  38. Teng C-H, Tseng Y-T, Maruvada R, Pearce D, Xie Y, Paul-Satyaseela M, et al. NlpI contributes to Escherichia coli K1 strain RS218 interaction with human brain microvascular endothelial cells. Infec Immun. 2010;78:3090–6.View ArticleGoogle Scholar
  39. Prasadarao NV, Wass CA, Weiser JN, Stins MF, Huang SH, Kim KS. Outer membrane protein A of Escherichia coli contributes to invasion of brain microvascular endothelial cells. Infect Immun. 1996;64(1):146–53.PubMed CentralPubMedGoogle Scholar
  40. Suttorp N, Floer B, Schnittler H, Seeger W, Bhakdi S. Effects of Escherichia coli hemolysin on endothelial cell function. Infect Immun. 1990;58:3796–801.PubMed CentralPubMedGoogle Scholar
  41. Dietzman DE, Fischer GW, Schoenknecht FD. Neonatal Escherichia coli septicemia--bacterial counts in blood. J Pediatr. 1974;85:128–30.View ArticlePubMedGoogle Scholar
  42. Silver RP, Aaronson W, Sutton A, Schneerson R. Comparative analysis of plasmids and some metabolic characteristics of Escherichia coli K1 from diseased and healthy individuals. Infect Immun. 1980;29:200–6.PubMed CentralPubMedGoogle Scholar
  43. Lu S, Zhang X, Zhu Y, Kim KS, Yang J, Jin Q. Complete genome sequence of the neonatal-meningitis-associated Escherichia coli strain CE10. J Bacteriol. 2011;193:7005.PubMed CentralView ArticlePubMedGoogle Scholar
  44. Yao Y, Xie Y, Kim KS. Genomic comparison of Escherichia coli K1 strains isolated from the cerebrospinal fluid of patients with meningitis. Infect Immun. 2006;74:2196–206.PubMed CentralView ArticlePubMedGoogle Scholar
  45. Orskov I, Orskov F, Jann B, Jann K. Serology, chemistry, and genetics of O and K antigens of Escherichia coli. Bacteriol Rev. 1977;41:667–710.PubMed CentralPubMedGoogle Scholar
  46. Moll A, Cabello F, Timmis KN. Rapid assay for the determination of bacterial resistance to the lethal activity of serum. FEMS Microbiol Lett. 1979;6:273–6.View ArticleGoogle Scholar
  47. Queipo-Ortuno MI, De Dios CJ, Macias M, Bravo MJ, Morata P. Preparation of bacterial DNA Template by boiling and effect of immunoglobulin G as an Inhibitor in real-time PCR for serum samples from patients with brucellosis. Clin Vac Immun. 2008;15:293–6.View ArticleGoogle Scholar
  48. Swaminathan B, Barrett TJ, Hunter SB, Tauxe RV. PulseNet: the molecular subtyping network for foodborne bacterial disease surveillance. United States Emerg Infect Dis. 2001;7:382–9.View ArticlePubMedGoogle Scholar
  49. Wirth T, Falush D, Lan R, Colles F, Mensa P, Wieler LH, et al. Sex and virulence in Escherichia coli: an evolutionary perspective. Mol Microbiol. 2006;60:1136–51.PubMed CentralView ArticlePubMedGoogle Scholar
  50. Weksler BB, Subileau EA, Perrier N, Charneau P, Holloway K, Leveque M, et al. Blood–brain barrier-specific properties of a human adult brain endothelial cell line. FASEB J. 2005;19:1872–4.PubMedGoogle Scholar
  51. Germon P, Chen YH, He L, Blanco JE, Brée A, Schouler C, et al. ibeA, a virulence factor of avian pathogenic Escherichia coli. J Microbiol. 2005;151:1179–86.View ArticleGoogle Scholar
  52. Moulin-Schouleur M, Schouler C, Tailliez P, Kao M-R, Bree A, Germon P, et al. Common Virulence factors and genetic relationships between O18:K1:H7 Escherichia coli isolates of human and avian origin. J Clin Microbiol. 2006;44:3484–92.PubMed CentralView ArticlePubMedGoogle Scholar
  53. Tiba MR, Yano T, Leite DS. Genotypic characterization of virulence factors in Escherichia coli strains from patients with cystitis. Rev Inst Med Trop Sao Paulo. 2008;50:255–60.View ArticlePubMedGoogle Scholar
  54. Rodriguez-Siek KE, Giddings CW, Doetkott C, Johnson TJ, Nolan LK. Characterizing the APEC pathotype. Vet Res. 2005;36:241–56.View ArticlePubMedGoogle Scholar
  55. Watt S, Lanotte P, Mereghetti L, Moulin-Schouleur M, Picard B, Quentin R. Escherichia coli strains from pregnant women and neonates: intraspecies genetic distribution and prevalence of virulence factors. J Clin Microbiol. 2003;41:1929–35.PubMed CentralView ArticlePubMedGoogle Scholar
  56. Runyen-Janecky LJ, Reeves SA, Gonzales EG, Payne SM. Contribution of the Shigella flexneri Sit, Iuc, and Feo iron acquisition systems to iron acquisition in vitro and in cultured cells. Infect Immun. 2003;71:1919–28.PubMed CentralView ArticlePubMedGoogle Scholar
  57. Johnson JR, Stell AL. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. J Infect Dis. 2000;181:261–72.View ArticlePubMedGoogle Scholar
  58. Taddei CR, Moreno AC, Fernandes FA, Montemor LP, Martinez MB. Prevalence of secreted autotransporter toxin gene among diffusely adhering Escherichia coli isolated from stools of children. FEMS Microbiol Lett. 2003;227:249–53.View ArticlePubMedGoogle Scholar

Copyright

© Wijetunge et al. 2015