Skip to main content

Table 7 Primers used in the study

From: Characterizing the pathotype of neonatal meningitis causing Escherichia coli (NMEC)

Primer Name Gene/Function Sequence 5’–3’ Product size Reference
chuA.1 Phylogrouping GACGAACCAACGGTCAGGAT 279 [17]
chuA.2   TGCCGCCAGTACCAAAGACA   
yjaA.1 Phylogrouping TGAAGTGTCAGGAGACGCTG 211 [17]
yjaA.2   ATGGAGAATGCGTTCCTCAAC   
TspE4C2.1 Phylogrouping GAGTAATGTCGGGGCATTCA 152 [17]
TspE4C2.2   CGCGCCAACAAAGTATTACG   
afaF Afimbrial adhesin CAT CAA GCT GTT TGT TCG TCC GCC G 750 [52]
afaR   GCT GGG CAG CAA ACT GAT AAC TCT C   
aslAF Arylsulfatase GCG TGA TGT TCA TGT CAA CC 463 [44]
aslAR   ATC CGC CAG ATC TAC AAT GC   
aufAF Auf fimbriae TGC ACA TCA GGA AAC CAG ATA C 350 This study
aufR   GGC TCA CTG ATA TGG ATG ACA A   
cnfF Cytotoxic necrotizing factor1 CAT TCA GAG TCC TGC CCT CAT TAT T 498 [53]
cnfR   AAG ATG GAG TTT CCT ATG CAG GAG   
fimHF Type I fimbriae GCA GTC ACC TGC CCT CCG GTA 508 [53]
fimHR   TGC AGA ACG GAT AAG CCG TGG   
hlyAF Alpha hemolysin ACC ATA TAA GCG GTC ATT CCC GTC A 1177 [53]
hlyAR   AAC AAG GAT AAG CAC TGT TCT GGC T   
hlyDF Secretion protein for HlyA CTC CGG TAC GTG AAA AGG AC 904 [54]
hlyDR   GCC CTG ATT ACT GAA GCC TG   
ibeAF Invasin of brain endothelium A CAT TAG CTC TCG GTT CAC GCT 171 [55]
ibeAR   TTA CCG CCG TTG ATG TTA TCA   
ibeBF Invasin of brain endothelium B GCA TATTCTGCTGGTTTCTAATGTC 660 This study
ibeBR   GTT CTG GAT TTT CTG TTC ATA ATT CA   
issF Increased serum survival CAG CAA CCC GAA CCA CTT GAT G 323 [54]
issR   AGC ATT GCC AGA GCG GCA GAA   
iutAF Aerobactin synthesis ATGAGCATATCTCCGGACG 587 [52]
iutAR   CAGGTCGAAGAACATCTGG   
iucCF Aerobactin synthesis ACC CGT CTG CAA ATC ATG GAT 269 [55]
iucCR   AAA CCT GGC TTA CGC AAC TGT   
sitAF Periplasmic iron-binding protein AGG GGG CAC AAC TGA TTC TCG 608 [56]
sitAR   TAC CGG GCC GTT TTC TGT GC   
kpsMTII F Capsular type II GCG CAT TTG CTG ATA CTG TTG 272 [57]
kpsMT IIR   CAT CCA GAC GAT AAG CAT GAG CA   
kpsMT K1 K 1 capsule TAG CAA ACG TTC TAT TGG TGC 153 [57]
kpsMT IIR   CAT CCA GAC GAT AAG CAT GAG CA   [57]
neuCF Capsular N-acetylneuraminic acid synthesis GGT GGT ACA TTC CGG GAT GTC 676 [52]
neuCR   AGG TGA AAA GCC TGG TAG TGT G   
Nlp I F New lipoprotein I (adhesin/invasin) AGT AAT ACT TCC TGG CGT AAA AGT GA 662 This study
Nlp I R   AAA TAG AAG TTG GTT TCA CTG AGA TG   
ompAF Outer membrane protein A CACTAAATCCAACGTTTATGGTAAAA   This study
ompAR   GATACCTTTAACTTCGATCTCTACGC   
papCF Outer membrane usher protein of P pili ATA TCC TTT CTG CAG GGA TGC AAT A 205 [57]
papCR   GAC GGC TGT ACT GCA GGG TGT GGC G   
papG IF Fimbrial adhesin PapG allele I CTA CTA TAG TTC ATG CTC AGG TC 474 [54]
papG IR   CCT GCA TCC TCC ACC ATT ATC GA   
papG IIF Fimbrial adhesin PapG allele II CCC AGC TTT GTT ATT TTC CTT G 190 [54]
papGIIR   TTC TTA CCA TGG CTG TAT GTC G   
papGIIIF Fimbrial adhesin PapG allele III GGC CTG CAA TGG ATT TAC CTG G 258 [54]
papGIIIR   CCA CCA AAT GAC CAT GCC AGA C   
satF Secreted autotransporter toxin GCAGCAAATATTGATATATCA 630 [58]
satR   GTTGTTGACCTCAGCAAGGAA   
sfa/focF S fimbrial adhesin CGG AGG AGT AAT TAC AAA CCT GGC A 410 [57]
sfa/focR   CTC CGG AGA ACT GGG TGC ATC TTA C   
trajF Conjugal transfer CAA TGG GGC TTT TAT TGA ACT C 369 This study
trajR   TGA CCA ACA CCC AGC ATA TAA A   
vat1 Vacuolating cytotoxin TCC TGG GAC ATA ATG GTC AG 900 This study
vat2   GTG TCA GAA CGG AAT TGT   
adkF MLST ATTCTGCTTGGCGCTCCGGG 583 [49]
adkR   CCGTCAACTTTCGCGTATTT   
fumCF MLST TCACAGGTCGCCAGCGCTTC 806 [49]
fumR   GTACGCAGCGAAAAAGATT   
gyrBF MLST TCGGCGACACGGATGACGGC 911 [49]
gyrBR   GTCCATGTAGGCGTTCAGGG   
icdF MLST ATGGAAAGTAAAGTAGTTGTTCCGGCACA 878 [49]
icdR   GGACGCAGCAGGATCTGTT   
mdhF MLST ATGAAAGTCGCAGTCCTCGGCGCTGCTGGCGG 932 [49]
mdhR   TTAACGAACTCCTGCCCCAGAGCGATATCTTTCTT   
purAF MLST TCGGTAACGGTGTTGTGCTG 816 [49]
purAR   CATACGGTAAGCCACGCAGA   
recAF MLST CGCATTCGCTTTACCCTGACC 780 [49]
recAR   TCGTCGAAATCTACGGACCGGA