Open Access

Molecular features of heterogeneous vancomycin-intermediate Staphylococcus aureus strains isolated from bacteremic patients

  • Yasmin Maor1, 2Email author,
  • Levona Lago1, 3,
  • Amir Zlotkin1,
  • Yeshayahu Nitzan3,
  • Natasha Belausov4,
  • Debby Ben-David1,
  • Nathan Keller4 and
  • Galia Rahav1, 2
Contributed equally
BMC Microbiology20099:189

https://doi.org/10.1186/1471-2180-9-189

Received: 16 December 2008

Accepted: 4 September 2009

Published: 4 September 2009

Abstract

Background

Heterogeneous vancomycin-intermediate Staphylococcus aureus (hVISA) bacteremia is an emerging infection. Our objective was to determine the molecular features of hVISA strains isolated from bacteremic patients and to compare them to methicillin resistant S. aureus (MRSA) and methicillin sensitive S. aureus (MSSA) blood isolates.

Results

We assessed phenotypic and genomic changes of hVISA (n = 24), MRSA (n = 16) and MSSA (n = 17) isolates by PCR to determine staphylococcal chromosomal cassette (SCCmec) types, Panton-Valentine leukocidin (PVL) and the accessory gene regulator (agr) loci. Biofilm formation was quantified. Genetic relatedness was assessed by PFGE. PFGE analysis of isolates was diverse suggesting multiple sources of infection. 50% of hVISA isolates carried SCCmec type I, 21% type II; 25% type V; in 4% the SCCmec type could not be identified. Among MRSA isolates, 44% were SCCmec type I, 12.5% type II, 25% type V, 12.5% were non-typable, and 6% were SCCmec type IVd. Only one hVISA isolate and two MSSA isolates carried the PVL. Biofilm formation and agr patterns were diverse.

Conclusion

hVISA isolates were diverse in all parameters tested. A considerable number of hVISA and MRSA strains carried the SCCmec type V cassette, which was not related to community acquisition.

Background

In recent years there have been growing numbers of reports from many countries of strains of Staphylococcus aureus showing heterogeneous intermediate resistance to vancomycin (hVISA). The frequency of heteroresistance among MRSA isolates has recently reached 6% to 11% [13]. In our institution there are approximately 200 S. aureus bacteremias each year. Of these, 50% are MRSA and 6% demonstrate hVISA resistance [2, 3]. Molecular assessment of the clonal dissemination of hVISA isolates has yielded conflicting results. Several studies found genetic linkage between hVISA isolates, reflected by a single pulsed field gel electrophoresis (PFGE) clone [46], while others showed that hVISA isolates were genetically diverse [7, 8].

The mechanism by which hVISA occurs is still under investigation. The hVISA phenotype has a thickened cell wall, altered peptidoglycan cross-linking, altered penicillin-binding protein expression, and slower growth rate [13, 7]. Several genes related to cell regulation pathways have been proposed as involved in the development of resistance to glycopeptides. For example vraSR, graSR saeSR, and agr, [912], but the global mechanism of resistance and the interactions between these various pathways are not clear. Most of hVISA isolates were acquired in hospital settings, and most patients had recurrent hospitalizations, substantial comorbidities [13, 7] and poor response to vancomycin therapy [7, 8].

The staphylococcal cassette chromosome (SCCmec) encodes methicillin resistance as well as genes responsible for resistance to other antibiotics. At least five different types of SCCmec were found in S. aureus (SCCmec types I to V), and SCCmec types IV and V were associated with community acquired MRSA [13, 14]. SCCmec typing has rarely been performed on hVISA isolates, and when performed, most isolates carried the SCCmec type I and II, similar to hospital-acquired MRSA [6, 14, 15].

The accessory gene regulator (agr) operon in S. aureus coordinates quorum sensing as well as virulence pathways. In general, agr activates genes encoding tissue-degrading factors (secreted virulence factors) and represses genes that encode factors important for colonization (virulence factors expressed on the staphylococcal cell surface). DNA sequence polymorphisms at this locus comprise four S. aureus agr groups (I-IV), and S. aureus strains of specific agr groups have been associated with certain clinical characteristics. In several studies performed in Japan and the USA, VISA and hVISA clinical isolates belonged to agr groups I or II [16, 17].

Similarly, the expression of Panton-Valentine leukocidin (PVL), a two-component pore-forming cytolytic toxin that targets mononuclear and polymorphonuclear cells and causes cell death, has been strongly associated with community acquired MRSA. However, its association with hVISA strains has not been defined yet [18].

Many staphylococcal infections are associated with communicating cell groups known as biofilms in which cells are attached to abiotic or biotic surfaces and posses altered growth rates and altered gene expression profiles compared to planktonic bacteria. It was demonstrated that hVISA isolates that belonged to agr-group II were defective in agr-function; conversely, these strains were strong biofilm producers. These findings led to the hypothesis that VISA strains may exhibit diminished virulence and might have an enhanced ability to form a thick biofilm due to agr-locus inactivation [16].

The purpose of this study was to assess the clonal dynamics of hVISA bacteremia in our hospital, to carry out comprehensive phenotypic and genotypic analyses of hVISA, MRSA and MSSA blood isolates recovered in Israel, and to determine whether any additional phenotypic or genotypic characteristic could be used in the recognition of hVISA.

Results

The study included 24 hVISA isolates, 16 MRSA isolates and 17 MSSA isolates. All hVISA isolates were identified as such by the Etest macromethod and the hVISA phenotype was confirmed by population analysis in all cases. All MRSA and MSSA isolates did not demonstrate heteroresistance to vancomycin as shown by the etest macromethod.

PFGE of hVISA isolates

The PFGE profiles of hVISA isolates exhibited a large diversity. Of the 18 isolates examined, 15 different pulsotypes were found, suggesting concomitant multiple sources of infection (Figure 1). In two cases similar hVISA pulsotypes between two patients were identified. Similarly, there was a great diversity in the pulsotypes of the MRSA isolates tested; only one of the MRSA pulsotypes was similar to one of the hVISA pulsotypes.
Figure 1

PFGE of hVISA, MRSA and MSSA isolates.

SCCmec type

Fifty percent (n = 12), 21% (n = 5) and 25% (n = 6) of the hVISA isolates carried SCCmec type I, SCCmec type II and SCCmec type V, respectively. Ten isolates that were nontypable using Olivera's method carried SCCmec type V by Zhang's method, except one isolate that was nontypable by both methods (Figure 2). The distribution of SCCmec types among the16 MRSA isolates revealed SCCmec type I in 44% (n = 7), type V in 25% (n = 4), type II in 12.5% (n = 2) and type IVd in 6% (n = 1). Two isolates were nontypable using both methods. None of the hVISA or MRSA isolates with SCCmec type IV or V had antibiotic susceptibility patterns compatible with community acquisition (Table 1), as almost all isolates were resistant to gentamicin and fluoroquinolones. However, the majority of these isolates were susceptible to erythromycin and clindamycin.
Table 1

Antibiotic susceptibility of hVISA and MRSA isolates which carried SCCmec type IV and V

 

SCCmec type

RIF

CLIN

ERYT

GENT

AMIK

OFL

FUS

TMP-SMZ

hVISA

Isolate #

         

25717

V

S

R

R

R

S

R

S

S

24406

V

S

S

S

R

S

R

S

S

18981

V

R

S

S

R

S

R

S

S

34139

V

S

S

S

R

S

R

S

S

22035

V

S

S

S

R

S

R

S

S

7555

V

S

S

S

R

S

R

S

S

MRSA

Isolate #

         

13372

V

S

R

R

R

S

R

S

S

13468

V

S

R

R

S

S

R

S

S

41901

V

S

S

S

R

S

R

S

S

41168

V

S

S

S

R

S

R

S

S

13731

IVd

S

S

S

R

S

R

R

R

Antibiotic susceptibility of isolates was tested using the disc diffusion method according to the CLSI guidelines.

Figure 2

SCC mec typing among hVISA and MRSA isolates using Zhang's method [32].

PVL genes

Only one hVISA isolate and two MSSA isolates carried PVL. Furthermore, even the MRSA isolate with SCCmec type IVd did not carry the PVL gene.

Agr-genotype

All agr types were represented in the 24 isolates of hVISA (Figure 3): 37.5% were agr-group I, 50.0% agr-group II, 8.4% agr-group III and 4.1% were non-typable. The 16 isolates of MRSA carried agr-group I (18.8%) and agr-group II (81.2%). The 17 isolates of MSSA carried agr-group I (17.6%), agr-group II (41.2%) or agr group III (29.4%), and 11.8% were non-typable.
Figure 3

agr typing among hVISA, MRSA and MSSA isolates.

Biofilm

Determination of biofilm production Quantitative determination of biofilm formation showed a strong biofilm production in 6 of 24 isolates (25%) of hVISA, 9 of 16 isolates of MRSA (55.5%) and 5 of 17 MSSA isolates (29%). There was no relation between biofilm production and agr group.

Discussion

Molecular assessment of hVISA isolates indicated a number of PFGE groups, with no substantive evidence of clonal dissemination. Isolates that appeared to be clonal were generally not epidemiologically linked by department or by time. Although the molecular epidemiology of the MRSA isolates in hospitals in Israel has not been explored yet, the high diversity among MRSA isolates in our study is remarkable. In previous reports, VISA and hVISA strains described in Europe belonged to a restricted range of epidemic multidrug-resistant MRSA strains [48], a worrisome finding that highlighted the potential of MRSA strains with reduced susceptibility to vancomycin to become widespread. However, in our study, genetic lineage was not demonstrated between the hVISA and MRSA isolates. All hVISA isolates had a similar resistance profile to multiple antimicrobial agents, including aminoglycosides and fluoroquinolones. This association between hVISA and a multiresistance phenotype was reported previously [19].

The majority of hVISA and MRSA isolates in the current study harbored SCCmec type I or II, consistent with nosocomial acquisition. However, 25% and 31% of hVISA and MRSA isolates, respectively, carried the SCC mec types IV or V that are related to community acquisition [13, 14]; none of these patients acquired the infection in a community setting, and the antibiotic susceptibility of isolates was compatible with nosocomial acquisition. Furthermore, the PVL gene was found in only one hVISA isolate. Our study reasserted that hVISA, as well as nosocomial acquired MRSA, may carry the so-called community acquired SCCmec types IV and V. It is possible that these clones originated in the community and were introduced by patients who were hospitalized. However, during the study period there were no truly community-acquired cases, suggesting that community acquisition is rare.

In that respect, once introduced into the hospital, the SCCmec type V strains may present a competitive advantage over the predominant endemic multiresistant MRSA clones, in a similar manner SCCmec type IV now seen in the United States, where the multiplication and transmission rates appear superior to those of MRSA strains with other SCCmec types [20]. Another possibility is that S. aureus SCCmec type V is originally nosocomial and has spread to the community. In several other reports, the SCCmec types common among hVISA isolates were I and II [6, 14, 15].

Only 5.2% of the S. aureus isolates in this investigation contained the PVL gene, supporting the findings of another study that the prevalence of community MRSA and carriage of the PVL gene among S. aureus isolates in Israel is low [21]. The low prevalence of the PVL gene in our isolates may be due to the impact of geography on the genetic make-up of S. aureus. Strains of MSSA causing skin and soft tissue infections in South Africa were significantly more likely to contain a variety of toxins or leukocidins, including PVL, than MSSA isolates causing similar infections from the United States [22]. The current study did not focus on S. aureus isolated from skin and soft tissue infections, a clinical condition with which PVL has been strongly associated, and this might also explain the above observations.

In several studies on agr groups among VISA/hVISA strains, most isolates had agr II polymorphism. It was suggested that loss of function of the agr operon might confer a survival advantage to S. aureus under vancomycin selection pressure, particularly in strains with the agr group II genotype [16, 17]. In the present study, agr II was the most common agr group among MRSA isolates; hVISA isolates on the other hand, demonstrated high diversity in agr polymorphism, which supports the suggestion that agr is probably not associated with the development of resistance to vancomycin.

Reports regarding biofilm formation and hVISA are conflicting. Some demonstrated a reduction of biofilm formation among hVISA isolates [23], while others documented an increase [24]. Although hVISA infections are associated with the presence of foreign bodies [7], we could not find high incidence of biofilm producers among the hVISA isolates.

Conclusion

hVISA isolates are genetically diverse in their PFGE profile, their SSCmec and agr types, and most strains in Israel do not harbor the PVL genes. A considerable number of hVISA and MRSA isolates in Israel carried SCCmec type V cassette, which was not related to community acquisition.

Methods

All blood isolates of hVISA that were identified during 2003 to 2006 at the Sheba Medical Center, a tertiary care center with 1,480 beds, affiliated ambulatory clinics and long-term care facilities, were included (n = 24). Sixteen and 17 randomly selected blood isolates of MRSA and methicillin sensitive S. aureus (MSSA), respectively, formed the control groups. The study was approved by Sheba's Institutional Review Board.

Identification and confirmation of methicillin and intermediate vancomycin resistance

During 2003-2004, resistance to methicillin was identified by the Kirbi-Bauer oxacillin disk diffusion method. Thereafter the method was changed to the cefoxitin disk diffusion method detailed by the Clinical and Laboratory Standards Institute [25, 26]. All isolates included in the study were assessed for the presence of hVISA by the Etest macromethod [27]. Antibiotic susceptibility tests were performed on fresh samples, because reversion of resistance after laboratory manipulation had been reported [28]. In brief, strains were grown for 18-24 hours on blood agar plates. Randomly selected single colonies were inoculated into fresh brain-heart infusion (BHI) broth. One hundred microliters of 2.0 McFarland suspensions were drawn onto BHI agar plates. Etest strips (AB Biodisk, Solna, Sweden) for vancomycin and teicoplanin were applied on the same plate, which was subsequently incubated at 35°C for 48 h. Strains were considered hVISA if readings were ≥8 μg/ml for vancomycin and teicoplanin or ≥12 μg/ml for teicoplanin alone. All isolates that were positive for hVISA using the macromethod were further tested using population analysis method as previously described [29]. Briefly, after 24 hours of incubation cultures were diluted in saline to 10-3, 10-6 and 10-8 and plated on to BHIA plates containing 0.5, 1, 2, and 4 mg/L vancomycin. Colonies were counted after 48 hours of incubation at 37°C and the viable count was plotted against vancomycin concentration. The area under the curve (AUC) was used to distinguish hVISA from glycopeptide susceptible isolates. A ration of the AUC of the test isolate was divided by the corresponding AUC for a strain validated against a Mu 3 strain (courtesy of Roland Jones, JMI Laboratories, North Liberty, IA 52317, USA). The criteria used for detection of hVISA were AUC ≥ 0.9.

Pulsed field gel electrophoresis

Genetic relatedness of hVISA strains digested with SmaI was assessed by PFGE, as described elsewhere [30]. Strains were considered indistinguishable if there was no difference in bands, and related (i.e. variants of the same PFGE subtype) if they varied by 1 to 3 bands. A PFGE dendogram was constructed using GelCompar II (Applied Maths, Sint-Martens-Latem, Belgium) to calculate similarity coefficients and to perform unweighted pair group analysis using arithmetic mean clustering. Dice coefficient with 0.5% optimization and 1.0% position tolerance was used.

Polymerase chain reaction (PCR) for genotyping

Genomic DNA was extracted using Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA) according to the manufacturer's protocol for Gram positive bacteria. DNA samples were stored at -20°C until used for analysis. Bacterial determinants that were examined using PCR assays included PVL, agr groups I to IV, and SCCmec types. Primers and conditions used to amplify the genes of interest are described in Table 2. Positive and negative controls were included in each PCR run.
Table 2

List of primers used for the various PCR reactions

Locus/Type

Primer

Nucleotide Sequence

Size (bp)

SCC mec

A

CIF2 F2

TTCGAGTTGCTGATGAAGAAGG

495

 

CIF2 R2

ATTTACCACAAGGACTACCAGC

 

B

KDP F1

AATCATCTGCCATTGGTGATGC

284

 

KDP R1

CGAATGAAGTGAAAGAAAGTGG

 

C

MECI P2

ATCAAGACTTGCATTCAGGC

209

 

MECI P3

GCGGTTTCAATTCACTTGTC

 

D

DCS F2

CATCCTATGATAGCTTGGTC

342

 

DCS R1

CTAAATCATAGCCATGACCG

 

E

RIF4 F3

GTGATTGTTCGAGATATGTGG

243

 

RIF4 R9

CGCTTTATCTGTATCTATCGC

 

F

RIF5 F10

TTCTTAAGTACACGCTGAATCG

414

 

RIF5 R13

GTCACAGTAATTCCATCAATGC

 

G

IS431 P4

CAGGTCTCTTCAGATCTACG

381

 

pUB110 R1

GAGCCATAAACACCAATAGCC

 

H

IS431 P4

CAGGTCTCTTCAGATCTACG

303

 

pT181 R1

GAAGAATGGGGAAAGCTTCAC

 

mecA

MECA P4

TCCAGATTACAACTTCACCAGG

162

 

MECA P7

CCACTTCATATCTTGTAACG

 

SCC mec type V

Type I

Type I-F

GCTTTAAAGAGTGTCGTTACAGG

613

 

Type I-R

GTTCTCTCATAGTATGACGTCC

 

Type II

Type II-F

CGTTGAAGATGATGAAGCG

398

 

Type II-R

CGAAATCAATGGTTAATGGACC

 

Type III

Type III-F

CCATATTGTGTACGATGCG

280

 

Type III-R

CCTTAGTTGTCGTAACAGATCG

 

Type IVa

Type IVa-F

GCCTTATTCGAAGAAACCG

776

 

Type IVa-R

CTACTCTTCTGAAAAGCGTCG

 

Type IVb

Type IVb-F

TCTGGAATTACTTCAGCTGC

493

 

Type IVb-R

AAACAATATTGCTCTCCCTC

 

Type IVc

Type IVc-F

ACAATATTTGTATTATCGGAGAGC

200

 

Type IVc-R

TTGGTATGAGGTATTGCTGG

 

Type IVd

Type IVd-F5

CTCAAAATACGGACCCCAATACA

881

 

Type IVd-R6

TGCTCCAGTAATTGCTAAAG

 

Type V

Type V-F

GAACATTGTTACTTAAATGAGCG

325

 

Type V-R

TGAAAGTTGTACCCTTGACACC

 

mecA

MecA147-F

GTG AAG ATA TACCAAGTG ATT

147

 

MecA147-R

ATG CGCTATAGATTG AAAGGAT

 

Panton-Valentine leukocidin (PVL)

 

luk-PV-1

ATCATTAGGTAAAATGTCTGGACATGATCCA

433

 

luk-PV-2

GCATCAASTGTATTGGATAGCAAAAGC

 

Accessory gene regulator ( agr )

 

agrSa agr1-4Sa-1

ATGCACATGG TGCACATGC

 
 

agr-1Sa agr1Sa-2

GTCACAAGTA CTATAAGCTG CGAT

439

 

agr-2Sa agr2Sa-2

TATTACTAAT TGAAAAGTGC CATAGC

572

 

agr-3Sa agr3Sa-2

GTAATGTAAT AGCTTGTATA ATAATACCCAG

321

 

agr-4Sa agr4Sa-2

CGATAATGCC GTAATACCCG

657

Gyrase

 

gyrA-F

AGTACATCGT CGTATACTAT ATGG

280

 

gyrA-R

ATCACGTAAC AGTTCAAGTGTG

 

SCCmec typing

Multiplex PCR was used to determine SCCmec type I-V on all hVISA and MRSA isolates, according to the methods published by Oliveira [31] and Zhang [32] using respectively the ReddyMix PCR master mix (ABgene, UK) and Phusion HF master Mix (Finnzymes, Finland).

Panton-Valentine leukocidin

PVL genes were detected by co-amplification of the lukS-PV and lukF-PV genes as described by Lina [33], using the Phusion HF master Mix. S. aureus ATCC 25923 was a positive control.

Accessory gene regulator

The agr locus was defined by multiplex PCR according to the published protocol [34].

Assessment of biofilm formation

Biofilm formation was quantified using a colorimetric microtiter plate assay [35]. Two hundred μL of bacterial suspension were placed into the wells of sterile 96-well polystyrene U-bottom microtiter plates. After overnight incubation, media and non-adherent planktonic bacteria were removed by gentle washing of the plate with sterile normal saline. The attached bacteria were fixed by adding 99% methanol to each well, and then the wells were emptied and dried before 200 μL of 2% gentian violet 4% in 12% ethanol was added. The dye bound to the adherent cells was resolubilized by adding 200 μL of gentian violet 4% in 12% ethanol to each well. The optical density (OD) of each well was determined photometrically at 595 nm. Wells originally containing sterile medium and non-biofilm producing bacteria Staphylococcus epidermidis, ATCC 12228 served as a control. The test was carried out in quadruplicate. The reference value for calculating adherence was OD 0.126. This number was calculated from the blank readings as mean + 3 × SD. Readings ≤ 0.126 OD were classified as a non biofilm producer and readings > 0.126 OD as a biofilm producer [35].

Statistical analysis

Fisher exact test was used for comparing hVISA, MRSA and MSSA results. Significance level was set at p < 0.05.

Notes

Abbreviations

MSSA: 

methicillin sensitive S. aureus

PCR: 

polymerase chain reaction

SCCmec

staphylococcal chromosomal cassette

PVL: 

Panton-Valentine leukocidin

Agr

accessory gene regulator

PFGE: 

pulsed field gel electrophoresis

AUC: 

area under the curve

RIF: 

rifampin

CLIND: 

clindamycin

ERYT: 

erythromycin

GENT: 

gentamicin

AMIK: 

amikacin

OFL: 

ofloxacin

FUS: 

fusidic acid

TMP-SMZ: 

trimethoprim/sulfamethoxazole

S: 

Sensitive

R: 

Resistant

Declarations

Acknowledgements

The work was part of the M.A. thesis of Ms. L. Lago and was supported by a grant from the Ministry of health, Israel.

Authors’ Affiliations

(1)
Infectious Diseases Unit, Sheba Medical Center
(2)
Faculty of Medicine, Tel Aviv University
(3)
The Mina and Everard Goodman Faculty of Life Sciences, Bar Ilan University
(4)
Microbiology Laboratory, Sheba Medical Center

References

  1. Garnier F, Chainier D, Walsh T, Karlsson A, Bolmström A, Grelaud C, Mounier M, Denis F, Ploy MC: A 1-year surveillance study of glycopeptide-intermediate Staphylococcus aureus strains in a French hospital. J Antimicrob Chemother. 2006, 57: 146-149. 10.1093/jac/dki413.PubMedView ArticleGoogle Scholar
  2. Maor Y, Rahav G, Belausov N, Ben-David D, Smollan G, Keller N: Prevalence and characteristics of heteroresistant vancomycin-intermediate Staphylococcus aureus bacteremia in a tertiary care center. J Clin Microbiol. 2007, 45: 1511-1514. 10.1128/JCM.01262-06.PubMed CentralPubMedView ArticleGoogle Scholar
  3. Maor Y, Hagin M, Belausov N, Keller N, Ben-David D, Rahav G: Clinical features of heteroresistant vancomycin-intermediate Staphylococcus aureus bacteremia versus those of methicillin-resistant S. aureus bacteremia. J Infect Dis. 2009, 199: 619-624. 10.1086/596629.PubMedView ArticleGoogle Scholar
  4. de Lassence A, Hidri N, Timsit JF, Joly-Guillou ML, Thiery G, Boyer A, Lable P, Blivet A, Kalinowski H, Martin Y, Lajonchere JP, Dreyfuss D: Control and outcome of a large outbreak of colonization and infection with glycopeptide-intermediate Staphylococcus aureus in an intensive care unit. Clin Infec Dis. 2006, 42: 170-178. 10.1086/498898.View ArticleGoogle Scholar
  5. Mallaval FO, Carricajo A, Delavenna F, Recule C, Fonsale N, Manquat G, Raffenot D, Rogeaux O, Aubert G, Tous J: Detection of an outbreak of methicillin resistant Staphylococcus aureus with reduced susceptibility to glycopeptides in a French hospital. Clin Microbiol Infect. 2004, 10: 459-461. 10.1111/j.1469-0691.2004.00878.x.PubMedView ArticleGoogle Scholar
  6. Nonhoff C, Denis O, Struelens MJ: Low prevalence of methicillin-resistant Staphylococcus aureus with reduced susceptibility to glycopeptides in Belgian hospitals. Clin Microbiol Infect. 2005, 11: 214-220. 10.1111/j.1469-0691.2004.01060.x.PubMedView ArticleGoogle Scholar
  7. Howden BP, Ward PB, Charles PG, Korman TM, Fuller A, du Cros P, Grabsch EA, Roberts SA, Robson J, Read K, Bak N, Hurley J, Johnson PD, Morris AJ, Mayall BC, Grayson ML: Treatment outcomes for serious infections caused by methicillin-resistant Staphylococcus aureus with reduced vancomycin susceptibility. Clin Infect Dis. 2004, 38: 521-528. 10.1086/381202.PubMedView ArticleGoogle Scholar
  8. Charles PG, Ward PB, Johnson PD, Howden BP, Grayson ML: Clinical features associated with bacteremia due to heterogeneous vancomycin-intermediate Staphylococcus aureus. Clin Infect Dis. 2004, 38: 448-451. 10.1086/381093.PubMedView ArticleGoogle Scholar
  9. Howden BP, Smith DJ, Mansell A, Johnson PDR, Ward PB, Stinear TP, Davies JK: Different bacterial gene expression patterns and attenuated host immune responses are associated with the evolution of low-level vancomycin resistance during persistent methicillin-resistant Staphylococcus aureus bacteraemia. BMC Microbiol. 2008, 8: 39-53. 10.1186/1471-2180-8-39.PubMed CentralPubMedView ArticleGoogle Scholar
  10. Neoh H, Cui L, Yuzawa H, Takeuchi F, Matsuo M, Hiramatsu K: Mutated Response Regulator graR Is Responsible for Phenotypic Conversion of Staphylococcus aureus from Heterogeneous Vancomycin-Intermediate Resistance to Vancomycin-Intermediate Resistance. Antimicrob Agent Chemotherap. 2008, 52: 45-53. 10.1128/AAC.00534-07.View ArticleGoogle Scholar
  11. Howden BP, Stinear TP, Allen DL, Johnson PDR, Ward PB, Davies JK: Genomic Analysis Reveals a Point Mutation in the Two-Component Sensor Gene graS That Leads to Intermediate Vancomycin Resistance in Clinical Staphylococcus aureus. Antimicrobial Agents And Chemotherapy. 2008, 52: 3755-62. 10.1128/AAC.01613-07.PubMed CentralPubMedView ArticleGoogle Scholar
  12. Cui L, Neoh H, Shoji M, Hiramatsu K: Contribution of vraSR and graSR Point Mutations to Vancomycin Resistance in Vancomycin-Intermediate Staphylococcus aureus. Antimicrob Agent Chemotherapy. 2009, 53: 1231-4. 10.1128/AAC.01173-08.View ArticleGoogle Scholar
  13. Lindsay JA, Holden MTG: Understanding the rise of the superbug: investigation of the evolution and genomic variation of Staphylococcus aureus. Funct Integr Genomics. 2006, 6: 186-201. 10.1007/s10142-005-0019-7.PubMedView ArticleGoogle Scholar
  14. Deurenberg RH, Vink C, Kalenic S, Friedrich AW, Bruggeman CA, Stobberingh EE: The molecular evolution of methicillin-resistant Staphylococcus aureus. Clin Microbiol Infect. 2007, 13: 222-235. 10.1111/j.1469-0691.2006.01573.x.PubMedView ArticleGoogle Scholar
  15. Hanaki H, Hososaka Y, Yanagisawa C, Otsuka Y, Nagasawa Z, Nakae T, Sunakawa K: Occurrence of vancomycin-intermediate-resistant Staphylococcus aureus in Japan. J Infect Chemother. 2007, 13: 118-121. 10.1007/s10156-006-0498-z.PubMedView ArticleGoogle Scholar
  16. Sakoulas GR, Moellering C, Eliopoulos GM: Adaptation of methicillin-resistant staphylococcus aureus in the face of vancomycin therapy. Clin Infec Dis. 2007, 42: S40-S50. 10.1086/491713.View ArticleGoogle Scholar
  17. Verdier I, Reverdy ME, Etienne J, Lina G, Bes M, Vandenesch F: Staphylococcus aureus isolates with reduced susceptibility to glycopeptides belong to accessory gene regulator group I or II. Antimicrob Agents Chemother. 2004, 48: 1024-1027. 10.1128/AAC.48.3.1024-1027.2004.PubMed CentralPubMedView ArticleGoogle Scholar
  18. Boyle-Vavra S, Daum RS: Community-acquired methicillin-resistant Staphylococcus aureus: the role of Panton-Valentine leukocidin. Lab Inves. 2007, 87: 3-9. 10.1038/labinvest.3700501.View ArticleGoogle Scholar
  19. Fridkin S: Vancomycin-intermediate and -resistant Staphylococcus aureus: what the infectious disease specialist needs to know. Clin Infect Dis. 2001, 32: 108-115. 10.1086/317542.PubMedView ArticleGoogle Scholar
  20. Patel M, Waites KB, Hoesley CJ, Stamm AM, Canupp KC, Moser SA: Emergence of USA300 MRSA in a tertiary medical centre: implications for epidemiological studies. J Hosp Infect. 2008, 68: 208-213. 10.1016/j.jhin.2007.12.010.PubMedView ArticleGoogle Scholar
  21. Regev-Yochay G, Carmeli Y, Raz M, Pinco E, Etienne J, Leavitt A, Rubinstein E, Navon-Venezia S: Prevalence and genetic relatedness of community-acquired methicillin-resistant Staphylococcus aureus in Israel. Eur J Clin Microbiol Infect Dis. 2006, 25: 719-722. 10.1007/s10096-006-0210-3.PubMedView ArticleGoogle Scholar
  22. Campbell SJ, Deshmukh HS, Nelson CL, Bae IG, Stryjewski ME, Federspiel JJ, Tonthat GT, Rude TH, Barriere SL, Corey R, Fowler VG: Genotypic characteristics of Staphylococcus aureus isolates from a multinational trial of complicated skin and skin structure infections. J Clinc Microbiol. 2008, 46: 678-684. 10.1128/JCM.01822-07.View ArticleGoogle Scholar
  23. Howden BP, Johnson PD, Ward PB, Stinear TP, Davies JK: Isolates with low-level vancomycin resistance associated with persistent methicillin-resistant Staphylococcus aureus bacteremia. Antimicrob Agent Chemother. 2006, 50: 3039-3047. 10.1128/AAC.00422-06.View ArticleGoogle Scholar
  24. Vuong CH, Saenz L, Gotz F, Otto M: Impact of the agr quorum-sensing system on adherence to polystyrene in Staphylococcus aureus. J Infect Dis. 2000, 182: 1688-1693. 10.1086/317606.PubMedView ArticleGoogle Scholar
  25. National Committee for Clinical Laboratory Standards, Performance standards for antimicrobial susceptibility testing: 15th informational supplement M100-S15. 2005, National Committee for Clinical Laboratory Standards, Wayne, PA: NCCLSGoogle Scholar
  26. Clinical and Laboratory Standards Institute/NCCLS: Performance Standards for Antimicrobial Susceptibility Testing. 15th informational supplement. M100-S16. 2006, Wayne, PA: CLSIGoogle Scholar
  27. Walsh TR, Bolmström A, Qwärnström A, Ho P, Wootton M, Howe RA, MacGowan AP, Diekema D: Evaluation of current methods for detection of staphylococci with reduced susceptibility to glycopeptides. J Clin Microbiol. 2001, 39: 2439-2444. 10.1128/JCM.39.7.2439-2444.2001.PubMed CentralPubMedView ArticleGoogle Scholar
  28. Boyle-Vavra S, Berke SK, Lee JC, Daum RS: Reversion of the glycopeptide resistance phenotype in Staphylococcus aureus clinical isolates. Antimicrob Agents Chemother. 2000, 44: 272-277. 10.1128/AAC.44.2.272-277.2000.PubMed CentralPubMedView ArticleGoogle Scholar
  29. Wootton M, Howe RA, Hillman R, Walsh TR, Bennett PM, MacGowan AP: A modified population analysis profile (PAP) method to detect hetero-resistance to vancomycin in Staphylococcus aureus in a UK hospital. J Antimicrob Chemother. 2001, 47: 399-403. 10.1093/jac/47.4.399.PubMedView ArticleGoogle Scholar
  30. Mulvey MR, Chui L, Ismail J, Louie L, Murphy C, Chang N, Alfa M, Canadian Committee for the Standardization of Molecular Methods: Development of a Canadian standardized protocol for subtyping methicillin-resistant Staphylococcus aureus using pulsed-field gel electrophoresis. J Clin Microbiol. 2001, 39: 3481-3485. 10.1128/JCM.39.10.3481-3485.2001.PubMed CentralPubMedView ArticleGoogle Scholar
  31. Oliveira DC, de Lencastre H: Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother. 2002, 46: 2155-2161. 10.1128/AAC.46.7.2155-2161.2002.PubMed CentralPubMedView ArticleGoogle Scholar
  32. Zhang K, McClure JA, Elsayed S, Louie T, Conly JM: Novel multiplex PCR assay for characterization and concomitant subtyping of Staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J Clin Microbiol. 2005, 43: 5026-5033. 10.1128/JCM.43.10.5026-5033.2005.PubMed CentralPubMedView ArticleGoogle Scholar
  33. Lina G, Piémont Y, Godail-Gamot F, Bes M, Peter MO, Gauduchon V, Vandenesch F, Etienne J: Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infec Dis. 1999, 29: 28-32. 10.1086/313461.View ArticleGoogle Scholar
  34. Lina G, Boutite F, Tristan A, Bes M, Etienne J, Vandenesch F: Bacterial competition for human nasal cavity colonization: role of Staphylococcal agr alleles. App Environ Microbiol. 2003, 69: 18-23. 10.1128/AEM.69.1.18-23.2003.View ArticleGoogle Scholar
  35. Christensen GD, Simpson WA, Younger JJ, Baddour LM, Barrett FF, Melton DM, Beachey EH: Adherence of coagulase-negative Staphylococci to plastic tissue culture plates: a quantitative model for the adherence of staphylococci to medical devices. J Clinl Microbiol. 1985, 22: 996-1006.Google Scholar

Copyright

© Maor et al; licensee BioMed Central Ltd. 2009

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement