Skip to main content

Table 2 List of primers used for the various PCR reactions

From: Molecular features of heterogeneous vancomycin-intermediate Staphylococcus aureus strains isolated from bacteremic patients

Locus/Type Primer Nucleotide Sequence Size (bp)
SCC mec
A CIF2 F2 TTCGAGTTGCTGATGAAGAAGG 495
  CIF2 R2 ATTTACCACAAGGACTACCAGC  
B KDP F1 AATCATCTGCCATTGGTGATGC 284
  KDP R1 CGAATGAAGTGAAAGAAAGTGG  
C MECI P2 ATCAAGACTTGCATTCAGGC 209
  MECI P3 GCGGTTTCAATTCACTTGTC  
D DCS F2 CATCCTATGATAGCTTGGTC 342
  DCS R1 CTAAATCATAGCCATGACCG  
E RIF4 F3 GTGATTGTTCGAGATATGTGG 243
  RIF4 R9 CGCTTTATCTGTATCTATCGC  
F RIF5 F10 TTCTTAAGTACACGCTGAATCG 414
  RIF5 R13 GTCACAGTAATTCCATCAATGC  
G IS431 P4 CAGGTCTCTTCAGATCTACG 381
  pUB110 R1 GAGCCATAAACACCAATAGCC  
H IS431 P4 CAGGTCTCTTCAGATCTACG 303
  pT181 R1 GAAGAATGGGGAAAGCTTCAC  
mecA MECA P4 TCCAGATTACAACTTCACCAGG 162
  MECA P7 CCACTTCATATCTTGTAACG  
SCC mec type V
Type I Type I-F GCTTTAAAGAGTGTCGTTACAGG 613
  Type I-R GTTCTCTCATAGTATGACGTCC  
Type II Type II-F CGTTGAAGATGATGAAGCG 398
  Type II-R CGAAATCAATGGTTAATGGACC  
Type III Type III-F CCATATTGTGTACGATGCG 280
  Type III-R CCTTAGTTGTCGTAACAGATCG  
Type IVa Type IVa-F GCCTTATTCGAAGAAACCG 776
  Type IVa-R CTACTCTTCTGAAAAGCGTCG  
Type IVb Type IVb-F TCTGGAATTACTTCAGCTGC 493
  Type IVb-R AAACAATATTGCTCTCCCTC  
Type IVc Type IVc-F ACAATATTTGTATTATCGGAGAGC 200
  Type IVc-R TTGGTATGAGGTATTGCTGG  
Type IVd Type IVd-F5 CTCAAAATACGGACCCCAATACA 881
  Type IVd-R6 TGCTCCAGTAATTGCTAAAG  
Type V Type V-F GAACATTGTTACTTAAATGAGCG 325
  Type V-R TGAAAGTTGTACCCTTGACACC  
mecA MecA147-F GTG AAG ATA TACCAAGTG ATT 147
  MecA147-R ATG CGCTATAGATTG AAAGGAT  
Panton-Valentine leukocidin (PVL)
  luk-PV-1 ATCATTAGGTAAAATGTCTGGACATGATCCA 433
  luk-PV-2 GCATCAASTGTATTGGATAGCAAAAGC  
Accessory gene regulator ( agr )
  agrSa agr1-4Sa-1 ATGCACATGG TGCACATGC  
  agr-1Sa agr1Sa-2 GTCACAAGTA CTATAAGCTG CGAT 439
  agr-2Sa agr2Sa-2 TATTACTAAT TGAAAAGTGC CATAGC 572
  agr-3Sa agr3Sa-2 GTAATGTAAT AGCTTGTATA ATAATACCCAG 321
  agr-4Sa agr4Sa-2 CGATAATGCC GTAATACCCG 657
Gyrase
  gyrA-F AGTACATCGT CGTATACTAT ATGG 280
  gyrA-R ATCACGTAAC AGTTCAAGTGTG