Phylogenetic analysis of Shiga toxin 1 and Shiga toxin 2 genes associated with disease outbreaks

James E Lee; Junelina Reed; Malcolm S Shields; Kathleen M Spiegel; Larry D Farrell; Peter P Sheridan

doi:10.1186/1471-2180-7-109

Research article

Open Access

Phylogenetic analysis of Shiga toxin 1 and Shiga toxin 2 genes associated with disease outbreaks

James E Lee¹Email author,
Junelina Reed¹,
Malcolm S Shields¹,
Kathleen M Spiegel¹,
Larry D Farrell¹ and
Peter P Sheridan¹

BMC Microbiology20077:109

https://doi.org/10.1186/1471-2180-7-109

Received: 20 February 2007

Accepted: 04 December 2007

Published: 04 December 2007

Abstract

Background

Shiga toxins 1 and 2 (Stx1 and Stx2) are bacteriophage-encoded proteins that have been associated with hemorrhagic colitis, hemolytic uremic syndrome and other severe disease conditions. Stx1 and Stx2 are genetically and immunologically distinct but share the same compound toxin structure, method of entry and enzymatic function.

Results

Phylogenetic analysis was performed using Stx1 and Stx2 amino acid and nucleotide sequences from 41 strains of Escherichia coli, along with known stx sequences available from GenBank. The analysis confirmed the Stx1 and Stx2 divergence, and showed that there is generally more sequence variation among stx2 genes than stx1. The phylograms showed generally flat topologies among our strains' stx1 and stx2 genes. In the stx2 gene, 39.5% of the amino acid sites display very low nonsynonymous to synonymous substitution ratios.

Conclusion

The stx1 and stx2 genes used in this phylogenetic study show sequence conservation with no significant divergence with respect to place or time. These data could indicate that Shiga toxins are experiencing purifying selection.

Keywords

Hemolytic Uremic SyndromeBovine Leukemia VirusAmino Acid SiteAmino Acid DifferenceShiga Toxin

Background

Shiga toxin was discovered in Shigella dysenteriae serotype 1 by Kiyoshi Shiga in 1898 [1]. The cytotoxic effects of Escherichia coli-produced Shiga toxin on Vero cells were first described 29 years ago [2]. A few years later, the toxin was closely associated with hemorrhagic colitis, hemolytic uremic syndrome (HUS) and other severe disease conditions [3, 4]. Shiga toxin producing E. coli have been implicated in food borne, waterborne and airborne outbreaks in studies all over the world [5–7]. Much of the focus of identification and characterization of Shiga toxin has been on E. coli O157:H7 strains, even though many cases of Shiga toxin associated disease were caused by other serotypes of E. coli [8]. The toxin has also been observed in other bacterial genera, including Citrobacter, Enterobacter and Acinetobacter [9–11].

Shiga toxin 1 (Stx1) and Shiga toxin 2 (Stx2) are encoded on a lambdoid bacteriophage. Stx1 is genetically and immunologically distinct from Stx2, showing 55–60% genetic and amino acid identity [12]. Stx1 is very similar to the Shiga toxin (Stx) found in Shigella dysenteriae type 1 [13]. Several variants of Stx1 (Stx1c and Stx1d) and Stx2 (Stx2c, Stx2d, Stx2e, Stx2f, and Sxt2g) have been described [14–17]. Both Stx1 and Stx2 are compound toxins made up of one 32 kDa A subunit and five identical 7.7 kDa B subunits[18, 19]. The B subunits form a pentameric hollow ring that encircles the carboxyl end of the A amino acid chain. The B subunits of Stx1, and most Stx2 type toxin molecules bind to specific glycosphingolipid globotriaosylceramide (Gb3) receptors in eukaryotic cell membranes. Stx2e B subunits preferentially bind to globotetraosylceramide (Gb4) [20], which allows the toxin to target different cell types. Once bound, receptor mediated endocytosis produces toxin-containing vesicles that travel through the Golgi apparatus and endoplasmic reticulum. The A subunit is then proteolytically cleaved into A1 (27.5 kDa) and A2 (4.5 kDa), but A1 and A2 remain covalently connected through a disulfide bond between two cysteine residues. When the cysteines are reduced, the catalytically active A1 enzyme cleaves a specific adenine from the 28S rRNA of the 60S ribosomal subunit [21]. Without this adenine, the GTP/elongation factor Tu/amino acyl-tRNA complex is unable to associate properly with the ribosome. Amino acid chain elongation is stopped, usually resulting in cell death.

Shiga toxin was shown to have the same N-glycosidase depurinating enzymatic function and active site conformation found in another ribosomal inhibiting protein (RIP), ricin [22, 23]. Comparison of the crystal structures of Stx from Shigella dysenteriae [19] and Stx2 from E. coli [24] showed that the active sites were similar to that of ricin. Both ricin and Shiga toxin are considered type II RIPs because of the lectin property of the B subunit that allows the enzymatic A subunit to be internalized for access to the ribosome. Abrin, modeccin, volkensin and viscumin are examples of other RIPs that use the same method of entry and mechanism of action [25–28].

Despite their similarities, Stx1 and Stx2 produce different degrees and types of tissue damage. Enterohemorrhagic E. coli that produce Stx2 are more likely to cause hemolytic uremic syndrome than are Stx1 producers [29]. This could be due to accessibility of the active site, differences in the carboxyl end of the A subunit, or differences in binding affinities of the B subunit pentamer to Gb3 [24].

Other studies have shown how different types of pathogenic E. coli and Shigella have developed using multilocus sequence typing (MLST) of several housekeeping genes [30–32], genomic hybridization by microarray [33] and comparative genomic sequencing by microarray [34]. Since Shiga toxin is encoded on a mobilizable bacteriophage, we focused on the phylogenetic diversity of the gene rather that the bacterium that happens to carry it. In this study we compared Shiga toxin gene nucleotide and amino acid sequences from twenty nine reference strains from the National Food Safety & Toxicology Center at Michigan State University and twelve clinical isolates from the Idaho Department of Health that contained one or both Stx genes. The E. coli strains used are both temporally and spatially distinct (Table 1). Included in the analysis were unique Shiga gene sequences that were available from Genbank. We confirmed that Stx2 shows more sequence variation than Stx1 among our reference and clinical isolates. We also showed that our isolates' stx1 and stx2 genes each respectively showed little divergence and may display purifying selection.

Table 1

E. coli reference strains used in this study. Information for the strains obtained from the National Food Safety & Toxicology Center at Michigan State University was taken directly from their web site.

Michigan State Name	Name Used in This Study¹	Shiga Toxin Gene	GenBank Accession Number	O antigen	H antigen	Host	Location	Date
EDL933		stx1		157	7	Food	Michigan	1982
		stx2
93–111	E12	stx1	EF441572	157	7	Human	Washington	1993
		stx2	EF441599
OK-1	E13	stx1	EF441573	157	7	Human	Japan	1996
		stx2	EF441600
86-24	E14	stx2	EF441601	157	7	Human	Washington	1986
2886-75	E15	stx1	EF441574	157	7	Human	California	1975
493/89	E16	stx2	EF441602	157	-	Human	Germany	1989
E32511	E17	stx2	EF441603	157	-	Human	No Data	1985
G5101	E18	stx1	EF441575	157	7	Human	Washington	1995
		stx2	EF441604
5905	E19	stx2	EF441605	55	7	Food	No data	1994
DEC8B	E22	stx1	EF441576	111	8	Human	Idaho	1986
		stx2	EF441606
3007-85	E23	stx1	EF441577	111	-	Human	Nebraska	1985
		stx2	EF441607
TB226A	E24	stx2	EF441608	111	-	Human	Washington	1991
928/91	E25	stx1	EF441578	111	-	Human	Germany	1991
		stx2	EF441609
412/55	E26	stx1	EF441579	111	No data	Human	Germany	1955
DEC8C	E27	stx1	EF441580	111	-	Calf	Scotland	No data
C412	E28	stx1	EF441581	111	No data	Calf	S. Dakota	1986
H19	E29	stx1	EF441582	26	11	Human	Canada	1977
DEC10B	E210	stx1	EF441583	26	11	Human	Australia	1986
TB285C	E213	stx1	EF441584	26	-	Human	Washington	1991
BCL19	E216	stx1	EF441585	No data	-	Cow	California	No data
DEC10J	E217	stx1	EF441586	70	11	Human	Canada	1988
ED-31	E218	stx1	EF441587	111	-	Human	Italy	No data
		stx2	EF441610
CL-3	S1	stx2	EF441618	113	21	Human	Canada	1980
G5506	S3	stx2	EF441619	104	21	Human	Montana	1994
B2F1	S4	stx2	EF441620	91	21	Human	Canada	1985
TB154A	S7	stx1	EF441595	103	6	Human	Washington	1991
88–1509	S8	stx1	EF441596	15	27	Human	Canada	1988
		stx2	EF441621
M2113	S10	stx1	EF441597	156	21	Cow	Germany	No data
BCL17	S11	stx1	EF441598	5	No data	Cow	California	No data
90–1787	S12	stx2	EF441622	X03	-	Cow	Canada	No data

¹These names used only in the alignments.

Results and Discussion

Similarity of Shiga Toxin 1 A and B subunit genes

The Shiga Toxin 1 A and B subunit genes showed very little difference in amino acid sequence (Figure 1). There were only four amino acid differences among the stx1 genes in the entire alignment. The change from threonine to serine at A67 in strains H19, BCL17 and I6650 would predictably have little effect on the enzymatic activity of the A subunit. The B354 change from threonine to serine in 88–1509 and the B357 change from valine to alanine in H19 are also unlikely to change the binding function of the B subunit.

Figure 1
**Stx1 A and B Subunit Amino Acid Alignment**. Sequences that are identical are on the same line and are pipe-delimited.

The phylogenetic trees made from the nucleotide sequences (Figure 2) and the amino acid sequences (Figure 3) were topologically the same with very short branch lengths. Bootstrap replicates in both trees supported the H19/BCL17/I6650 clade and the Shigella dysenteriae/88–1509 clade. The short branch lengths and relatively low bootstrap values can be directly attributed to the low number of informative characters in the analysis.

Figure 2
stx1 **Maximum Likelihood Nucleotide Phylogenetic Tree (unrooted)**. Bootstrap values over 50% are displayed. Pipe-delimited strain names indicate identical sequences. Dates and locations of the isolates are shown if available. The horizontal bar shows 0.001 nucleotide substitutions per site.

Figure 3
**Stx1 Distance Amino Acid Phylogenetic Tree (unrooted)**. Bootstrap values over 50% are displayed. Pipe-delimited strain names indicate identical sequences. Dates and locations of the isolates are shown if available. The horizontal bar shows 0.001 amino acid substitutions per site.

Similarity of Shiga Toxin 2 A and B subunit genes

The Shiga toxin 2 A and B subunit sequences showed much more sequence diversity than did the Stx1 group. None of the putative substitutions replaced key residues used in the active site [24] or either of the cysteines that form the disulfide bridge between A1 and A2. There were 56 total amino acid differences from EDL933 Stx2 in this study's sequences, 28 in the A subunit and 28 in the B subunit. Twenty-five of these changes occurred in I7606 Stx2. The number of positions in each subunit that were affected was 17 for the A subunit and 15 for the B subunit. The Stx2 alignment (Figure 4) shows all of the amino acid differences among this study's sequences, along with Stx2d1, Stx2d2, Stx2e, Stx2f, Stx2g and Citrobacter freundii Stx2 sequences from GenBank.

Figure 4
**Stx2 A and B Subunit Amino Acid Alignment**. Sequences that are identical are on the same line and are pipe-delimited.

Strains E32511 and B2F1 have each been shown to contain two copies of the stx2 gene [35, 36]. E32511 carries one stx2 gene that is almost identical to the EDL933 sequence and a second that differs by 15 nucleotides. Three of these nucleotide differences result in three amino acid changes in the B subunit only. The stx2 amplified from E32511 matches the Genbank accession number M59432 with no equivocal peaks in the chromatogram. B2F1 carries the stx2d1 and stx2d2 genes represented by the accessions AF479828 and AF479829, respectively. These sequences differ from EDL933 stx2 by 10 nucleotides with one amino acid change. The sequencing reaction chromatogram from our stx2 amplicon of the B2F1 strain showed nucleotide differences between both stx2d1 and stx2d2 with no ambiguities. These differences resulted in three amino acid changes along the sequence. In both E32511 and B2F1, the few sequence differences did not affect our analysis. However, until further analysis of our E32511 and B2F1 strains is complete to determine whether they contain one or two stx2 genes, our sequences EF441603 and EF441620 should be held in question.

The ratio non-synonymous (d_N) to synonymous (d_S) substitutions was used to estimate whether positive or purifying selection had occurred at each amino acid site. A nonsynonymous:synonymous (d_N:d_S) ratio of greater than one indicates positive selection at that amino acid site whereas a d_N:d_S ratio of less than one shows purifying selection. Forty percent of the amino acid sites in the full alignment showed purifying selection using the Selecton program [37]. The Stx2 A and B subunits showed 37.3% and 44.9%, respectively, of their amino acid sites were well conserved. (Figure 5)

Figure 5
**Color Coded Selecton Results for** stx2 **Sequences**. Nonsynonymous:synonymous (d_N:d_S) ratios using the output from the Selecton program. Shades of yellow (1 and 2) indicate a d_N:d_S ratio of > 1 or positive selection. Any shade of bordeaux (4–7) indicates a d_N:d_S ratio of < 1 or purifying selection.

The nucleotide phylogenetic tree (Figure 6) and the amino acid phylogenetic tree (Figure 7) showed almost the same topology with short branch lengths for our strains. The obvious dissimilarity of Stx2e, Stx2f and Stx2g is striking in both the alignment and phylogenetic trees and is well supported by the high bootstrap values. Idaho strain I7606 had the most divergent sequence among the strains obtained from the Idaho State Health Department and is most closely related to Stx2d A subunit [38]. The lower bootstrap values in the figures are characteristic of highly similar sequences in the branches. Interestingly, the C. freundii Stx2 grouped with the Stx2d group of elastase activated Shiga toxins [39].

Figure 6
stx2 **Maximum Likelihood Nucleotide Phylogenetic Tree (unrooted)**. Bootstrap values over 50% displayed. Pipe-delimited strain names indicate identical sequences. Dates and locations of the isolates are shown if available. The horizontal bar shows 0.1 nucleotide substitutions per site.

Figure 7
**Stx2 Distance Amino Acid Phylogenetic Tree (unrooted)**. Bootstrap values over 50% are displayed. Pipe-delimited strain names indicate identical sequences. Dates and locations of the isolates are shown if available. The horizontal bar shows 0.1 amino acid substitutions per site.

Conclusion

This investigation into the phylogenetic relationships among Shiga toxins confirmed that the two major groups, Stx1 and Stx2, are easily differentiated by both their amino acid and nucleotide sequences. The phylogram in Figure 8 shows stx1 and stx2 forming two distinct clades with stx2f branching off significantly from both. The stx1 group displayed an almost flat phylogeny whereas the stx2 group has much more sequence diversity. Stx2d, Stx2e and Stx2g all show at least 91% similarity to the EDL933 stx2 gene. The Stx2f amino acid and nucleotide sequences are only 72.5 and 70.4 percent similar to EDL933 Stx2 sequences, respectively, making it the most divergent Stx2 found to date. The greater diversity of Stx2 sequences could be the result of sampling bias. Since the majority of the gene sequences came from human outbreak pathogens and because Stx2 is associated with more severe disease, this could have an effect on what strains are recovered. Despite the fact that diarrheal illness is a leading causes of death worldwide [40], most sources providing isolates used in this study are located in areas with well established public health systems. This source location could also introduce bias into the isolates investigated.

Figure 8
**Unrooted Maximum Likelihood Nucleotide Phylogenetic Tree of all Shiga Toxin Sequences**. The horizontal bar shows 0.1 nucleotide substitutions per site.

The significance of compiling these sequences became clear when both the Stx1 tree and Stx2 tree showed generally flat topologies. Our further analysis of the nucleotide sequences for Stx2 A and B subunits showed that a large proportion of the amino acid sites had undergone purifying selection. Our hypothesis when undertaking this project was that Shiga toxin sequences from different places and collected at different times would show divergence. Our data analysis indicates that there is no significant divergence among either the Stx1 or Stx2 gene sequences based on collection time or location. The Stx1 phylogeny (Figure 2 and 3) shows that these genes do not vary greatly and are perhaps undergoing purifying selective pressure. The Stx2 phylogeny (Figure 4 and 5) is also generally flat among the strains we tested. This would indicate that among our strains, both the Stx1 and Stx2 gene sequences are closely conserved. One reason for the conservation of this sequence could be that intestinal Shiga toxin producing E. coli in the bovine host are mitigating Bovine Leukemia Virus induced disease [41]. Another recent finding suggests that the Shiga toxin might play a role in helping E. coli survive predation from bacteriovores outside of the cow [42]. Since many of our strains can be related to illness produced from bovine feces, it is possible that a Shiga toxin gene that is beneficial to the bacterium that carries it has undergone purifying selection to the benefit of both their bacterial and mammalian host.

Methods

Culture and Colony Isolation

Forty-one strains of Escherichia coli were used, including 29 outbreak reference strains provided by the National Food Safety & Toxicology Center at Michigan State University, and twelve clinical isolates from patients reported to the Idaho Department of Health. The characteristics and sources of E. coli strains used are described in Table 1. The specimens were received as 25% glycerol stocks on wet ice. E. coli strains were grown at 37°C in Luria-Bertani (LB) broth and isolated on LB agar.

DNA Extraction

After isolation on LB agar, each strain was grown in 11 ml of LB broth for 18–24 hours at 37°C with shaking. All DNA extractions were performed using the PureGene DNA Isolation Kit (Gentra Systems, Minneapolis, MN). To maximize the yield of DNA, the following modifications to the PureGene protocol were made: 1) The time for cell lysis was increased to 10 minutes; 2) The DNA was precipitated using 300 μl 100% Isopropanol (tubes were inverted 50 times, incubated at -20°C for 1 hour and then centrifuged for 5 minutes at 13–16,000 × g); 3) DNA was dissolved in 100 μl sterile filtered 10 mM Tris, pH 8.3.

Amplification of Stx genes

Primer sequences targeting specific stx1 and stx2 genes are listed in Table 2, along with PCR conditions used. The stx1 primers amplified 1178 bp of the 1227 bp sequence. The stx2 primers amplified the entire 1241 bp sequence. PCR master mix was made to final concentration of 1 × ThermoPol Reaction Buffer (New England BioLabs, Beverly, MA), 500 μM dNTP's (New England BioLabs), 0.02 units/μl Vent exo(-) polymerase (New England BioLabs), and 1 μM of each of the stx1 primers or stx2 primers. Five microliters of each amplification reaction was analyzed by 1% agarose gel electrophoresis. All gels were run at 80–90 V for 90 minutes in 1 × TAE buffer. Both gel and buffer contained 0.5 mg/ml ethidium bromide.

Table 2

Idaho E. coli strains used in this study. Information on the Idaho strains was obtained from the Idaho Department of Health.

Strain Name	Shiga Toxin Gene	GenBank Accession Number	O antigen	H antigen	Host	Location	Date
I5365	stx1	EF441588	26	11	Human	Idaho	2004
I5518	stx2	EF441611	121	19	Human	Idaho	2004
I5533	stx1	EF441589	157	-	Human	Idaho	2004
	stx2	EF441612
I6581	stx2	EF441613	157	7	Human	Idaho	2004
I6650	stx1	EF441590	No data	No data	Human	Idaho	2004
I6896	stx2	EF441614	145	-	Human	Idaho	2004
I6940	stx1	EF441591	145	-	Human	Idaho	2004
I7004	stx2	EF441615	157	7	Human	Idaho	2004
I7606	stx2	EF441616	146	21	Human	Idaho	2004
I8257	stx1	EF441592	157	7	Human	Idaho	2004
	stx2	EF441617
I8361	stx1	EF441593	111	-	Human	Idaho	2004
I8419	stx1	EF441594	103	25	Human	Idaho	2004

Purification and Sequencing of Amplification Products

Amplicons were extracted from agarose gels using the QIAquick Gel Extraction Kit (Qiagen, Valencia, CA) according to the manufacturer's specifications. The amplicons were further purified for sequencing using Millipore Montage PCR filters (Billerica, MA). All sequencing was performed by the Idaho State University Molecular Research Core Facility using primers listed in Table 2. Accession numbers for nucleotide sequences submitted to GenBank are shown in Table 3.

Table 3

Primer sequences

Primer Name	Nucleotide Sequence 5'-3'	Target	PCR Conditions^a
	PCR Primers		Denature	Anneal	Extension
BGR1U	TCAACGAAAAATAACTTCGCTGAATCCC	Stx1 Base 1–28	95°C,	61°C,	72°C,
BGR1D	CAGTTAATGTGGTTGCGAAGGAATTTACC	Stx1 Base (1150–1178)	60 sec	60 sec	240 sec
BGR2U	ATGAAGTGTATATTATTTAAATGGGTACTGTG	Stx2 Base 1–32	95°C,	61°C,	72°C,
BGR2D	TCAGTCATTATTAAACTGCACTTCAG	Stx2 Base (1201–1226)	60 sec	60 sec	240 sec
	Sequencing Primers	Target
Stx1SeqF	TGTAACCGCTGTTGTACCTGG	Stx1 Base (367–387)
Stx1SeqR	TTAATACTGAATTGTCATCATCATGC	Stx1 Base 778–803
Stx2SeqF	TTGCATTAGCTTCTGTTAATGCA	Stx2 Base 1000–1022
Stx2SeqR	CATTCCGGAACGTTCCAG	Stx2 Base (433–450)

^a PCR was performed for 30 cycles followed by a final extension step of 10 min at 72°C.

Sequence Alignment and Phylogenetic Analysis

All amplicons were sequenced on both strands except the first and last 30 bases that were sequenced in only one direction in duplicate from internal primers. Raw sequence alignment was performed using Vector NTI 9 (InforMax, Invitrogen, Carlsbad, CA). Reference sequences for Shiga toxins used in the analysis were obtained from GenBank and are indicated in the phylogenetic tree by their accession numbers. Consensus sequences were entered into BioEdit 7.0.5.2 [43], aligned using ClustalW and then manually trimmed so that the nucleotide sequence accurately reflected the amino acid sequence. Amino acid sequence phylogenetic trees were created by distance analysis of the alignment using PAUP 4.0 Beta 10 [44]. Nucleotide phylogenetic trees were generated by maximum likelihood analysis of the alignment using PAUP 4.0 Beta 10 [44]. The Hasegawa-Kishino-Yano or HKY (stx1) and HKY with gamma likelihood models (stx2) were chosen after the data were analyzed using ModelTest [45] in PAUP. Construction of the nucleotide trees was done using the neighbor joining method with 1000 bootstrap replicates. The Selecton program [37] was used to determine the ratio of non-synonymous to synonymous substitutions. The top two purifying selection categories of 6 and 7 on the selection scale were used to calculate percentage of amino acids that were undergoing purifying selection. The maximum likelihood nucleotide phylogenetic tree produced above was inputted and the M8 evolutionary model [46] was used with EDL933 stx2 as the query sequence. Other evolutionary models available (M8a, M7, M5, MEC) produced results that were not significantly different. (data not shown) The full table of non-synonymous to synonymous ratios for stx2 sequences is available in additional file 1.

Declarations

Acknowledgements

This work was partially supported by grant number F04-107 from the Graduate Student Research and Scholarship Committee of Idaho State University, Pocatello, ID. We wish to thank the Idaho State University Molecular Core Research Facility for their fast service and high quality sequence. We would also like to acknowledge Vivian Lockary of the Idaho Department of Health for providing strains. Acknowledgement is also made to the National Food Safety & Toxicology Center at Michigan State University for providing strains.

Electronic supplementary material

12866_2007_426_MOESM1_ESM.txt Additional file 1: Selecton Output. Selecton output file showing non-synonymous to synonymous ratio and confidence intervals of the stx2 sequences. (TXT 32 KB)

Below are the links to the authors’ original submitted files for images.

12866_2007_426_MOESM2_ESM.doc Authors’ original file for figure 1

12866_2007_426_MOESM3_ESM.doc Authors’ original file for figure 2

12866_2007_426_MOESM4_ESM.doc Authors’ original file for figure 3

12866_2007_426_MOESM5_ESM.pdf Authors’ original file for figure 4

12866_2007_426_MOESM6_ESM.pdf Authors’ original file for figure 5

12866_2007_426_MOESM7_ESM.doc Authors’ original file for figure 6

12866_2007_426_MOESM8_ESM.pdf Authors’ original file for figure 7

12866_2007_426_MOESM9_ESM.doc Authors’ original file for figure 8

Authors’ Affiliations

(1)

Department of Biological Sciences, Idaho State University, Pocatello, USA

References

Shiga K: Zentralblatt fur Bakteriologie. 1898, 24: 913-918.Google Scholar
Konowalchuk J, Speirs JI, Stavric S: Vero response to a cytotoxin of Escherichia coli. Infect Immun. 1977, 18: 775-779.PubMed CentralPubMedGoogle Scholar
Wade WG, Thom BT, Evans N: Cytotoxic enteropathogenic Escherichia coli. Lancet. 1979, 2: 1235-1236. 10.1016/S0140-6736(79)92349-3.View ArticlePubMedGoogle Scholar
Wilson MW, Bettelheim KA: Cytotoxic Escherichia coli serotypes. Lancet. 1980, 1: 201-10.1016/S0140-6736(80)90682-0.View ArticlePubMedGoogle Scholar
Bruce MG, Curtis MB, Payne MM, Gautom RK, Thompson EC, Bennett AL, Kobayashi JM: Lake-associated outbreak of Escherichia coli O157:H7 in Clark County, Washington, August 1999. Arch Pediatr Adolesc Med. 2003, 157: 1016-1021. 10.1001/archpedi.157.10.1016.View ArticlePubMedGoogle Scholar
Howie H, Mukerjee A, Cowden J, Leith J, Reid T: Investigation of an outbreak of Escherichia coli O157 infection caused by environmental exposure at a scout camp. Epidemiol Infect. 2003, 131: 1063-1069. 10.1017/S0950268803001250.PubMed CentralView ArticlePubMedGoogle Scholar
Kahali S, Sarkar B, Chakraborty S, Macaden R, Deokule JS, Ballal M, Nandy RK, Bhattacharya SK, Takeda Y, Ramamurthy T: Molecular epidemiology of diarrhoeagenic Escherichia coli associated with sporadic cases and outbreaks of diarrhoea between 2000 and 2001 in India. Eur J Epidemiol. 2004, 19: 473-479. 10.1023/B:EJEP.0000027353.70796.25.View ArticlePubMedGoogle Scholar
Bettelheim KA: Role of non-O157 VTEC. Symp Ser Soc Appl Microbiol. 2000, 38S-50S.Google Scholar
Schmidt H, Montag M, Bockemuhl J, Heesemann J, Karch H: Shiga-like toxin II-related cytotoxins in Citrobacter freundii strains from humans and beef samples. Infect Immun. 1993, 61: 534-543.PubMed CentralPubMedGoogle Scholar
Paton AW, Paton JC: Enterobacter cloacae producing a Shiga-like toxin II-related cytotoxin associated with a case of hemolytic-uremic syndrome. J Clin Microbiol. 1996, 34: 463-465.PubMed CentralPubMedGoogle Scholar
Grotiuz G, Sirok A, Gadea P, Varela G, Schelotto F: Shiga Toxin 2-Producing Acinetobacter haemolyticus Associated with a Case of Bloody Diarrhea10.1128/JCM.00407-06. J Clin Microbiol. 2006, 44: 3838-3841. 10.1128/JCM.00407-06.PubMed CentralView ArticlePubMedGoogle Scholar
Weinstein DL, Jackson MP, Samuel JE, Holmes RK, O'Brien AD: Cloning and sequencing of a Shiga-like toxin type II variant from Escherichia coli strain responsible for edema disease of swine. J Bacteriol. 1988, 170: 4223-4230.PubMed CentralPubMedGoogle Scholar
Jackson MP, Newland JW, Holmes RK, O'Brien AD: Nucleotide sequence analysis of the structural genes for Shiga-like toxin I encoded by bacteriophage 933J from Escherichia coli. Microb Pathog. 1987, 2: 147-153. 10.1016/0882-4010(87)90106-9.View ArticlePubMedGoogle Scholar
Burk C, Dietrich R, Acar G, Moravek M, Bulte M, Martlbauer E: Identification and characterization of a new variant of Shiga toxin 1 in Escherichia coli ONT:H19 of bovine origin. J Clin Microbiol. 2003, 41: 2106-2112. 10.1128/JCM.41.5.2106-2112.2003.PubMed CentralView ArticlePubMedGoogle Scholar
Friedrich AW, Bielaszewska M, Zhang WL, Pulz M, Kuczius T, Ammon A, Karch H: Escherichia coli harboring Shiga toxin 2 gene variants: frequency and association with clinical symptoms. J Infect Dis. 2002, 185: 74-84. 10.1086/338115.View ArticlePubMedGoogle Scholar
Leung PHM, Peiris JSM, Ng WWS, Robins-Browne RM, Bettelheim KA, Yam WC: A Newly Discovered Verotoxin Variant, VT2g, Produced by Bovine Verocytotoxigenic Escherichia coli. Appl Environ Microbiol. 2003, 69: 7549-7553. 10.1128/AEM.69.12.7549-7553.2003.PubMed CentralView ArticlePubMedGoogle Scholar
Schmidt H: Shiga-toxin-converting bacteriophages. Res Microbiol. 2001, 152: 687-695. 10.1016/S0923-2508(01)01249-9.View ArticlePubMedGoogle Scholar
Stein PE, Boodhoo A, Tyrrell GJ, Brunton JL, Read RJ: Crystal structure of the cell-binding B oligomer of verotoxin-1 from E. coli. Nature. 1992, 355: 748-750. 10.1038/355748a0.View ArticlePubMedGoogle Scholar
Fraser ME, Chernaia MM, Kozlov YV, James MN: Crystal structure of the holotoxin from Shigella dysenteriae at 2.5 A resolution. Nat Struct Biol. 1994, 1: 59-64. 10.1038/nsb0194-59.View ArticlePubMedGoogle Scholar
DeGrandis S, Law H, Brunton J, Gyles C, Lingwood CA: Globotetraosylceramide is recognized by the pig edema disease toxin. J Biol Chem. 1989, 264: 12520-12525.PubMedGoogle Scholar
Endo Y, Tsurugi K, Yutsudo T, Takeda Y, Ogasawara T, Igarashi K: Site of action of a Vero toxin (VT2) from Escherichia coli O157:H7 and of Shiga toxin on eukaryotic ribosomes. RNA N-glycosidase activity of the toxins. Eur J Biochem. 1988, 171: 45-50. 10.1111/j.1432-1033.1988.tb13756.x.View ArticlePubMedGoogle Scholar
Saxena SK, O'Brien AD, Ackerman EJ: Shiga toxin, Shiga-like toxin II variant, and ricin are all single-site RNA N-glycosidases of 28 S RNA when microinjected into Xenopus oocytes. J Biol Chem. 1989, 264: 596-601.PubMedGoogle Scholar
Endo Y, Mitsui K, Motizuki M, Tsurugi K: The mechanism of action of ricin and related toxic lectins on eukaryotic ribosomes. The site and the characteristics of the modification in 28 S ribosomal RNA caused by the toxins. J Biol Chem. 1987, 262: 5908-5912.PubMedGoogle Scholar
Fraser ME, Fujinaga M, Cherney MM, Melton-Celsa AR, Twiddy EM, O'Brien AD, James MN: Structure of shiga toxin type 2 (Stx2) from Escherichia coli O157:H7. J Biol Chem. 2004, 279: 27511-27517. 10.1074/jbc.M401939200.View ArticlePubMedGoogle Scholar
Barbieri L, Ciani M, Girbes T, Liu W, Van Damme EJM, Peumans WJ, Stirpe F: Enzymatic activity of toxic and non-toxic type 2 ribosome-inactivating proteins. FEBS Letters. 2004, 563: 219-222. 10.1016/S0014-5793(04)00286-8.View ArticlePubMedGoogle Scholar
Olsnes S, Stirpe F, Sandvig K, Pihl A: Isolation and characterization of viscumin, a toxic lectin from Viscum album L. (mistletoe). J Biol Chem. 1982, 257: 13263-13270.PubMedGoogle Scholar
Chambery A, Di Maro A, Monti MM, Stirpe F, Parente A: Volkensin from Adenia volkensii Harms (kilyambiti plant), a type 2 ribosome-inactivating protein: Gene cloning, expression and characterization of its A-chain. Eur J Biochem. 2004, 271: 108-117. 10.1046/j.1432-1033.2003.03909.x.View ArticlePubMedGoogle Scholar
Endo Y, Tsurugi K: Mechanism of action of ricin and related toxic lectins on eukaryotic ribosomes. Nucleic Acids Symp Ser. 1986, 187-190.Google Scholar
Siegler RL, Obrig TG, Pysher TJ, Tesh VL, Denkers ND, Taylor FB: Response to Shiga toxin 1 and 2 in a baboon model of hemolytic uremic syndrome. Pediatr Nephrol. 2003, 18: 92-96.PubMedGoogle Scholar
Whittam TS: Genetic variation and evolutionary processes in natural populations of Escherichia coli. Escherichia coli and Salmonella: Cellular and Molecular Biology. 1996, Washington D.C., ASM Press, 1: 2708-2720.Google Scholar
Lacher DW, Steinsland H, Blank TE, Donnenberg MS, Whittam TS: Molecular evolution of typical enteropathogenic Escherichia coli: clonal analysis by multilocus sequence typing and virulence gene allelic profiling. J Bacteriol. 2007, 189: 342-350. 10.1128/JB.01472-06.PubMed CentralView ArticlePubMedGoogle Scholar
Pupo GM, Lan R, Reeves PR: Multiple independent origins of Shigella clones of Escherichia coli and convergent evolution of many of their characteristics. Proc Natl Acad Sci U S A. 2000, 97: 10567-10572. 10.1073/pnas.180094797.PubMed CentralView ArticlePubMedGoogle Scholar
Wick LM, Qi W, Lacher DW, Whittam TS: Evolution of genomic content in the stepwise emergence of Escherichia coli O157:H7. J Bacteriol. 2005, 187: 1783-1791. 10.1128/JB.187.5.1783-1791.2005.PubMed CentralView ArticlePubMedGoogle Scholar
Zhang W, Qi W, Albert TJ, Motiwala AS, Alland D, Hyytia-Trees EK, Ribot EM, Fields PI, Whittam TS, Swaminathan B: Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms. Genome Res. 2006, 16: 757-767. 10.1101/gr.4759706.PubMed CentralView ArticlePubMedGoogle Scholar
Schmitt CK, McKee ML, O'Brien AD: Two copies of Shiga-like toxin II-related genes common in enterohemorrhagic Escherichia coli strains are responsible for the antigenic heterogeneity of the O157:H- strain E32511. Infect Immun. 1991, 59: 1065-1073.PubMed CentralPubMedGoogle Scholar
Teel LD, Melton-Celsa AR, Schmitt CK, O'Brien AD: One of two copies of the gene for the activatable shiga toxin type 2d in Escherichia coli O91:H21 strain B2F1 is associated with an inducible bacteriophage. Infect Immun. 2002, 70: 4282-4291. 10.1128/IAI.70.8.4282-4291.2002.PubMed CentralView ArticlePubMedGoogle Scholar
Doron-Faigenboim A, Stern A, Mayrose I, Bacharach E, Pupko T: Selecton: a server for detecting evolutionary forces at a single amino-acid site10.1093/bioinformatics/bti259. Bioinformatics. 2005, 21: 2101-2103. 10.1093/bioinformatics/bti259.View ArticlePubMedGoogle Scholar
Zhang W, Bielaszewska M, Friedrich AW, Kuczius T, Karch H: Transcriptional Analysis of Genes Encoding Shiga Toxin 2 and Its Variants in Escherichia coli. Appl Environ Microbiol. 2005, 71: 558-561. 10.1128/AEM.71.1.558-561.2005.PubMed CentralView ArticlePubMedGoogle Scholar
Melton-Celsa AR, Darnell SC, O'Brien AD: Activation of Shiga-like toxins by mouse and human intestinal mucus correlates with virulence of enterohemorrhagic Escherichia coli O91:H21 isolates in orally infected, streptomycin-treated mice. Infect Immun. 1996, 64: 1569-1576.PubMed CentralPubMedGoogle Scholar
Murray CJL, Lopez AD: Mortality by cause for eight regions of the world: Global Burden of Disease Study. The Lancet. 1997, 349: 1269-1276. 10.1016/S0140-6736(96)07493-4.View ArticleGoogle Scholar
Ferens WA, Cobbold R, Hovde CJ: Intestinal Shiga toxin-producing Escherichia coli bacteria mitigate bovine leukemia virus infection in experimentally infected sheep. Infect Immun. 2006, 74: 2906-2916. 10.1128/IAI.74.5.2906-2916.2006.PubMed CentralView ArticlePubMedGoogle Scholar
Steinberg KM, Levin BR: Grazing protozoa and the evolution of the Escherichia coli O157:H7 Shiga toxin-encoding prophage. Proc Biol Sci. 2007, 274 (1621): 1921-1929. 10.1098/rspb.2007.0245.View ArticlePubMedGoogle Scholar
Hall TA: BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser. 1999, 41: 95-98.Google Scholar
Swofford DL: Phylogenetic Analysis Using Parsimony (*and Other Methods). 2000, Sunderland, Massachusetts, Sinauer Associates, 4.0b10Google Scholar
Posada D, Crandall KA: MODELTEST: testing the model of DNA substitution10.1093/bioinformatics/14.9.817. Bioinformatics. 1998, 14: 817-818. 10.1093/bioinformatics/14.9.817.View ArticlePubMedGoogle Scholar
Yang Z, Nielsen R, Goldman N, Pedersen AM: Codon-substitution models for heterogeneous selection pressure at amino acid sites. Genetics. 2000, 155: 431-449.PubMed CentralPubMedGoogle Scholar

Copyright

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Phylogenetic analysis of Shiga toxin 1 and Shiga toxin 2 genes associated with disease outbreaks

Abstract

Background

Results

Conclusion

Keywords

Background

Results and Discussion

Similarity of Shiga Toxin 1 A and B subunit genes

Similarity of Shiga Toxin 2 A and B subunit genes

Conclusion

Methods

Culture and Colony Isolation

DNA Extraction

Amplification of Stx genes

Purification and Sequencing of Amplification Products

Sequence Alignment and Phylogenetic Analysis

Declarations

Acknowledgements

Authors’ Affiliations

References

Copyright

BMC Microbiology

Contact us