Skip to main content

Table 3 Primer sequences

From: Phylogenetic analysis of Shiga toxin 1 and Shiga toxin 2 genes associated with disease outbreaks

Primer Name Nucleotide Sequence 5'-3' Target PCR Conditionsa
  PCR Primers   Denature Anneal Extension
BGR1U TCAACGAAAAATAACTTCGCTGAATCCC Stx1 Base 1–28 95°C, 61°C, 72°C,
BGR1D CAGTTAATGTGGTTGCGAAGGAATTTACC Stx1 Base (1150–1178) 60 sec 60 sec 240 sec
BGR2U ATGAAGTGTATATTATTTAAATGGGTACTGTG Stx2 Base 1–32 95°C, 61°C, 72°C,
BGR2D TCAGTCATTATTAAACTGCACTTCAG Stx2 Base (1201–1226) 60 sec 60 sec 240 sec
  Sequencing Primers Target    
Stx1SeqF TGTAACCGCTGTTGTACCTGG Stx1 Base (367–387)    
Stx1SeqR TTAATACTGAATTGTCATCATCATGC Stx1 Base 778–803    
Stx2SeqF TTGCATTAGCTTCTGTTAATGCA Stx2 Base 1000–1022    
Stx2SeqR CATTCCGGAACGTTCCAG Stx2 Base (433–450)    
  1. a PCR was performed for 30 cycles followed by a final extension step of 10 min at 72°C.