Research article
Open Access
Serotypes, intimin variants and other virulence factors of eae positive Escherichia coli strains isolated from healthy cattle in Switzerland. Identification of a new intimin variant gene (eae-η2)
BMC Microbiology20055:23
https://doi.org/10.1186/1471-2180-5-23
© Blanco et al; licensee BioMed Central Ltd. 2005
Received: 21 February 2005
Accepted: 09 May 2005
Published: 09 May 2005
Abstract
Background
Enteropathogenic Escherichia coli (EPEC) and Shigatoxin-producing Escherichia coli (STEC) share the ability to introduce attaching-and-effacing (A/E) lesions on intestinal cells. The genetic determinants for the production of A/E lesions are located on the locus of enterocyte effacement (LEE), a pathogenicity island that also contains the genes encoding intimin (eae). This study reports information on the occurrence of eae positive E. coli carried by healthy cattle at the point of slaughter, and on serotypes, intimin variants, and further virulence factors of isolated EPEC and STEC strains.
Results
Of 51 eae positive bovine E. coli strains, 59% were classified as EPEC and 41% as STEC. EPEC strains belonged to 18 O:H serotypes, six strains to typical EPEC serogroups. EPEC strains harbored a variety of intimin variants with eae-β1 being most frequently found. Moreover, nine EPEC strains harbored ast A (EAST1), seven bfpA (bundlin), and only one strain was positive for the EAF plasmid. We have identified a new intimin gene (η2) in three bovine bfpA and astA-positive EPEC strains of serotype ONT:H45. STEC strains belonged to seven O:H serotypes with one serotype (O103:H2) accounting for 48% of the strains. The majority of bovine STEC strains (90%) belonged to five serotypes previously reported in association with hemolytic uremic syndrom (HUS), including one O157:H7 STEC strain. STEC strains harbored four intimin variants with eae-ε1 and eae-γ1 being most frequently found. Moreover, the majority of STEC strains carried only stx 1 genes (13 strains), and was positive for ehxA (18 strains) encoding for Enterohemolysin. Four STEC strains showed a virulence pattern characteristic of highly virulent human strains (stx 2 and eae positive).
Conclusion
Our data confirm that ruminants are an important source of serologically and genetically diverse intimin-harboring E. coli strains. Moreover, cattle have not only to be considered as important asymptomatic carriers of O157 STEC but can also be a reservoir of EPEC and eae positive non-O157 STEC, which are described in association with human diseases.
Background
Enteropathogenic Escherichia coli (EPEC) and Shiga toxin-producing Escherichia coli (STEC) represent two of the at least six different categories of diarrheagenic E. coli recognized at present [1]. Unlike other diarrheagenic E. coli, EPEC and STEC share the ability to introduce attaching-and-effacing (A/E) lesions on intestinal epithelial cells. A/E lesions are characterized by destruction of the microvillus brush border through restructuring of the underlying cytoskeleton by signal transduction between bacterial and host cells, intimate adherence of strains to the intestinal epithelium, pedestal formation and aggregation of polymerized actin at the sites of bacterial attachment [1, 2]. The genetic determinants for the production of A/E lesions are encoded in a pathogenicity island called the locus of enterocyte effacement (LEE) [3]. The LEE encodes the outer membrane protein intimin, which is encoded by the eae gene (for E. coli attachment effacement) localized in the central region of LEE, a type III secretion system, a number of secreted proteins (ESP), and Tir (for translocated intimin receptor), a protein encoded upstream of the eae gene, which is translocated into host cells [2]. Characterization of eae genes revealed the existence of different variants. At present, 17 genetic variants (α1, α2, β1, ξR/β2B, δ/κ/β2O, γ1, θ/γ2, ε1, νR/ε2, ζ, η, ι1, μR/ι2, λ, μB, νB, ξB) have been identified (Table 4) [4–9]. The heterogeneous C-terminal (3') end of intimin is responsible for receptor binding, and it is discussed that different intimin variants may be responsible for different host and tissue cell tropism [6, 10–12]. Adu-Bobie et al. [4] found that antigenic variation exists within the cell-binding domain of intimins expressed by different clinical human EPEC and STEC isolates and defined four intimin types (α, β, γ, δ) based on type-specific PCR assays that used oligonucleotide primers complementary to the 3'end of specific eae genes. Oswald et al. [5] described a type-specific PCR assay which identifies a fifth intimin variant (intimin ε; referred in the present study as ε1). They divided the intimin alleles α, β, and γ based on restriction fragment length polymorphism (RFLP) analysis of PCR products into α1, α2, β1, β2, γ1 and γ2 subtypes. Furthermore, Oswald et al. [5] reclassified the δ type of Adu-Bobie et al. [4] as a β2 subtype (referred in the present study as d/β2O). Tarr and Whitam [13] presented a paper on the molecular evolution of intimin genes in human STEC and EPEC O111 clones and found two new types (ζ and θ). The new ζ intimin type also was identified by Jores et al [11] in bovine STEC and Blanco et al. [7] in ovine STEC. Zhang et al. [6] observed that the sequences of eae-γ2 and eae-θ were almost identical (99%), and they believe that these two sequences should be considered one eae variant (γ2/θ), as is referred in the present study. Recently, Zhang et al. [6] determined the sequences of three new intimin variant genes (κ, η, and ι; intimin ι referred in the present study as ι1) found in human STEC strains. The sequence of the 3'variable region of eae gene of a new intimin (λ) has been submitted to GenBank by China (unpublished data) (Accession no. AF439538) and the whole intimin λ gene was sequenced by Blanco et al. (unpublished data) from a human strain (Accession no. AJ715409) and Ramachandran et al. [14] (Accession no. AF530557) from a bovine strain. Ramachandran et al. [14] identified three new intimin genes in ruminant E. coli strains belonging to serotypes ONT:H- (intimin μ, referred in the present study as μR/ι2), O2-related:H19 (intimin ν, referred in the present study as νR/ε2) and ONT:HNT (intimin ξ, referred in the present study as ξR/β2B) and they have also developed an intimin typing PCR-RFLP scheme that reliably differentiates 14 intimin variants. When Ramachandran et al. [14] submitted to GenBank the nucleotide sequences of μ, ν, and ξ genes these intimin types were designated ι2, ε2 and β2, respectively. Blanco et al. [8] have identified four new intimin variant genes that they originally designated as β2, μ, ν, and ξ when the sequences were submitted to EMBL Nucleotide Sequence Database, and before knowing the results obtained by Ramachandran et al. [14]. The intimin β2 found by Blanco et al. (unpublished data) in human typical EPEC strains of classical EPEC serotype O119:H6 is identical to intimin ξ described by Ramachandran et al. [14] in one bovine strain of serotype ONT:HNT. Thus, in this study our β2 intimin is referred as ξR/β2B. The other three intimins (μ, ν, and ξ) discovered by Blanco et al. [[8], unpublished data] are different to the existing intimin types and are referred to as μB, νB, and ξB in this study, respectively.
Table 4
Genetic relationship of the new intimin gene (η2) (AJ879898, AJ879899, AJ879900) detected in bovine EPEC strains of serotype ONT:H45 and the remaining eae variants: Pairwise alignments calculated with CLUSTAL W
Designation of intimins in this study | Designation of intimins in previous studies (References) | ORF length (bp) | Reference strain | Serotype | Origin | Accession number | Genetic relationship identities |
|---|---|---|---|---|---|---|---|
α1 | α (4) and α1 (5) | 2820 | E2348/69 | O127:H6 | Human | M58154 | 87% |
α2 | α (4) and α2 (5) | 2820 | E. coli | O125:H6 | Human | AF530555 | 87% |
β1 | β (4) and β1 (8) | 2820 | RDEC1 | O15:H- | Rabbit | AF200363 | 84% |
ξR/β2B | ξ (14) and β2 (8) | 2820 | KB411 | ONT:HNT | Bovine | AF530556 | 88% |
ξR/β2B | ξ (14) and β2 (8) | 2820 | FV359 | O119:H6 | Human | AJ715407 | 88% |
δ/β2O | δ (4) and β2 (5) | 2820 | BL152.1 | O86:H34 | Human | AJ875027 | 87% |
κ | κ (6) | 2820 | 6044/95 | O118:H5 | Human | AJ308552 | 87% |
γ1 | γ (4) and γ1(5) | 2805 | EDL933 | O157:H7 | Human | AF071034 | 86% |
γ2/θ | γ2 (5) and θ (13) | 2808 | CL-37 | O111:H8 | Human | AF449418 | 84% |
ε1 | ε(5) | 2847 | PMK5 | O103:H2 | Human | AF116899 | 92% |
νR/ε2 | ν (14) and ε2 (GenBank AF530554) | 2847 | VR64/4 | O2related:H19 | Ovine | AF530554 | 94% |
ζ | ζ (13) | 2817 | 4795/95 | O84:H4 | Human | AJ271407 | 86% |
η1 | η (6) | 2847 | CF11201 | O125:H- | Human | AJ308550 | 98% |
η2 | new (this study) | 2847 | H03/53199a | ONT:H45 | Human | AJ876652 | 100% |
ι1 | ι (6) | 2814 | 7476/96 | O145:H4 | Human | AJ308551 | 88% |
μR/ι2 | μ (14) and ι2 (GenBank AF530553) | 2814 | VR45 | OR:H- | Ovine | AF530553 | 83% |
λ | λ (8, 14) | 2817 | EPEC-68.4 | O34:H- | Human | AJ715409 | 86% |
μB | μ (8) | 2808 | EPEC-373 | O55:H51 | Human | AJ705049 | 87% |
νB | ν (8) | 2823 | IH1229a | O10:H- | Human | AJ705050 | 82% |
ξB | ξ (8) | 2847 | STEC-B49 | O80:H- | Bovine | AJ705051 | 91% |
EPEC strains are defined as eae-haboring diarrheagenic E. coli that possess the ability to form A/E lesions on intestinal cells and that do not possess Shiga toxin genes [15]. Most EPEC strains belong to a series of O antigenic groups known as EPEC serogroups: O26, O55, O86, O111, O114, O119, O125, O126, O127, O128, O142, and O158. EPEC are further classified as typical, when possessing the EAF (for EPEC adherence factor) plasmid that encodes localized adherence (LA) on cultured epithelial cells mediated by the Bundle Forming Pilus (BFP); whereas atypical EPEC strains do not possess the EAF plasmid [15, 16]. Typical EPEC, a major cause of infant diarrhea in developing countries, are rare in industrialized countries, where atypical EPEC seem to be a more important cause of diarrhea [1, 16]. Typical and atypical EPEC strains usually belong to certain serotype clusters, differ in their adherence patterns on cultured epithelial cells (typical: LA; atypical: diffuse adherence (DA); aggregative adherence (AA); localized adherence-like adherence (LAL)), are typically found in different hosts (typical EPEC strains have only been recovered from humans), and display differences in their intimin variants [16]. Atypical EPEC appear to be more closely related to STEC and as such are considered emerging pathogens [16, 17].
STEC are responsible for a number of human gastrointestinal diseases, including diarrhea, bloody diarrhea and hemorrhagic colitis (HC). In a proportion of individuals, particularly in children, these conditions may be complicated by neurological and renal sequelae, including hemolytic-uremic syndrome (HUS) [18–20]. Most outbreaks and sporadic cases of HC and HUS have been attributed to O157:H7 STEC strains [20–22]. In contrast, especially in continental Europe, infections by non-O157 STEC, such as O26:H11/H-, O91:H21/H-, O103:H2, O111:H-, O113:H21, O117:H7, O118:H16, O121:H19, O128:H2/H-, O145:H28/H-, and O146:H21, are more common and frequently associated with severe illness in humans [1, 23–27]. Probably, non-O157 STEC also play a more important role in disease in Argentina [28], Australia [29], Chile [1], and South Africa [1]. STEC are characterized by elaborating two groups of potent phage-encoded cytotoxins called Shiga toxins [18, 19]. Pathogenic STEC very often possess other putative virulence factors as intimin (eae) and Enterohemolysin (ehxA) [19, 30, 31].
Although a number of studies have determined the eae subtypes of STEC strains isolated from humans, only a limited number of studies have been undertaken to determine the intimin variants from a diverse collection of STEC and EPEC isolated from cattle. Ruminants, especially cattle, represent an important reservoir of atypical EPEC and STEC [16, 20, 32, 33]. This study reports information on the occurrence of eae positive E. coli carried by healthy cattle at the point of slaughter, and on serotypes, intimin variants, and further virulence factors of isolated EPEC and STEC strains.
Results
Detection and isolation of eae positive E. coli strains
Of the 330 fecal samples collected from cattle at slaughter, 132 (40%) tested positive for eae genes. From 51 randomly selected eae PCR-positive samples, 51 eae positive E. coli strains were isolated by colony dot blot hybridization, confirmed as E. coli by biochemical properties, and further characterized by phenotypic and genotypic traits. Thirty strains carried no stx genes and were therefore classified as EPEC, whereas the remaining 21 strains possessed at least one Shiga toxin gene, and were therefore considered as STEC.
Serotypes of bovine eae positive E. coli strains
The 51 eae positive E. coli strains belonged to 18 O serogroups, 9 H types, and 23 O:H serotypes. However, 46% of strains were of three serogroups, namely O26 (6 strains), O103 (12 strains), and O145 (5 strains), and 43% belonged to two H types, namely H2 (17 strains), and H45 (5 strains). Thirty-two percent of strains were of only three serotypes: O26:H- (3 strains), O103:H2 (11 strains), and O145:H- (5 strains). EPEC strains belonged to 18 O:H serotypes and eight strains were nontypeable (Table 1). STEC strains comprised seven O:H serotypes with one serotype (O103:H2) accounting for 48% of STEC strains (Table 2). Furthermore, all serotypes found in this study have been previously reported in human STEC. Five (O5:H-, O26:H-, O103:H2, O145:H-, and O157:H7) of the STEC serotypes comprising 19 (90%) strains have previously been associated with human STEC causing HUS. Serotypes O26:H- and O103:H2 were found in both EPEC and STEC strains.
Table 1
Serotypes and virulence factors of EPEC strains isolated from cattle in Switzerland (n = 30)
Serotype | No. of strains | eae | astA | bfpA |
|---|---|---|---|---|
O2:H45 | 1 | κ | - | - |
O8:H19 | 1 | β1 | + | - |
O10:H- | 1 | γ2/θ | - | - |
O15:H2 | 3 | β1 | - | - |
O26:H- | 1 | β1 | + | - |
O26:H- | 1 | β1 | - | - |
O26:H11 | 2 | β1 | - | - |
035:H2 | 1 | β1 | - | - |
O64:H25 | 1 | β1 | - | - |
O77:H19 | 1 | β1 | - | - |
O103:H2 | 1 | ε1 | - | - |
O103:H8 | 1 | ι1 | + | + |
O113:H6 | 2 | ξR/β2B | - | - |
O119:H8 | 1 | ι1 | - | + |
O128:H2 | 1 | β1 | - | - |
O156:H25 | 1 | ζ | - | - |
O157:H45 | 1 | α1 | + | + |
O177:H11 | 1 | β1 | + | + |
ONT:H- | 1 | ε1 | - | - |
ONT:H- | 1 | κ | - | - |
ONT:H19 | 1 | ε1 | + | - |
ONT:H25 | 2 | ζ | - | - |
ONT:H45 | 3 | η2 | + | + |
Table 2
Serotypes and virulence factors of eae positive STEC strains isolated from cattle in Switzerland (n = 21)
Serotype | No. of strains | stx | eae | ehxA |
|---|---|---|---|---|
O5:H- b | 1 | stx 1 | β1 | + |
O5:H- b | 1 | stx 1 | β1 | - |
O26:H- b | 1 | stx2 | β1 | + |
O26:H2 a,c | 1 | stx2 | β1 | - |
O103:H2 b | 9 | stx 1 | ε1 | + |
O103:H2 b | 1 | stx 1 | ε1 | - |
O111:H21 a | 1 | stx 1 | γ2/θ | + |
O145:H- b | 4 | stx 1, stx 2 | γ1 | + |
O145:H- b | 1 | stx2 | γ1 | + |
O157:H7 b | 1 | stx 2 | γ1 | + |
Typing of intimin (eae) genes
Overall, the 51 isolated eae positive bovine E. coli strains comprised a variety of 10 intimin variants, namely α1(1 strain), β1 (17 strains), ξR/β2B (2 strains), γ1 (6 strains), γ2/θ (2 strains), ε1 (13 strains), ζ (3 strains), η2 (3 strains), ι1 (2 strains), and κ (2 strains). Intimins α2, δ/β2O, γ1, θ/γ2, ν R/ε2, η1, μR/ι2, λ, μB, νB, and ξB were neither detected in bovine EPEC nor in bovine STEC. EPEC strains harbored a variety of nine intimin variants (α1, β1, ξR/β2B, κ, θ/γ2, ε1, ζ, η2, ι1). In 15 strains (52%) eae-β (twelve times β1, twice β2), which was associated with nine serotypes, in three strains eae-ε1, in three strains eae-ζ, in three strains eae-η2, in two strains eae-ι1, in two strains eae-κ, in one strain eae-α1, and in one strain eae-γ2/θ were detected (Table 1). In contrast, STEC strains harbored only four intimin variants (β1,γ1,γ2/θ, ε1) with eae-ε1 (10 strains, all of serotype O103:H2) and eae-γ1 (5 strains of serotype O145:H-, and one strain of serotype O157:H7) being most frequently found (Table 2). Intimins β1, ε1 and γ2/θ were present in both EPEC and STEC strains.
Identification of a new intimin variant gene (eae-η2). Sequence comparison
The complete nucleotide sequence of the new η2 variant gene in three bovine bfpA and astA-positive EPEC strains of serotype ONT:H45 was determined. Furthermore, a fragment (566 bp strain FV5126 to 1728 bp strain FV5114/2) of the 3'variable region of the eae gene of seven representative strains was amplified and sequenced. The eae sequences were deposited in the European Bioinformatics Institute (EMBL Nucleotide Sequence Database) and the accession numbers assigned are indicated in table 3.
Table 3
Accession numbers of sequenced eae genes of some EPEC strains
Strain | Origin | Serotype | Intimin | EMBL nucleotide sequence | bfpA | EAF plasmid | stx1 stx2 |
|---|---|---|---|---|---|---|---|
FV5109-4113/1 | healthy cattle1 | ONT:H45 | η2 | AJ879898 | + | - | - |
FV5113-4115/2 | healthy cattle1 | ONT:H45 | η2 | AJ879899 | + | - | - |
FV5114/1-3933/51 | healthy cattle1 | ONT:H45 | η2 | AJ879900 | + | - | - |
H03-53199a | patient with diarrhea2 | ONT:H45 | η2 | AJ876652 | nd | nd | - |
FV5114/2-3933/52 | healthy cattle1 | O156:H25 | ζ | AJ879901 | - | - | - |
FV5125-4125/1 | healthy cattle1 | O157:H45 | α1 | AJ879902 | + | - | - |
FV5123-4286/1 | healthy cattle1 | O2:H45 | κ | AJ879903 | - | - | - |
FV5133-3988/1 | healthy cattle1 | ONT:H- | κ | AJ879904 | - | - | - |
FV5126-3951/1 | healthy cattle1 | O119:H8 | ι1 | AJ879905 | + | - | - |
FV5120-4075/1 | healthy cattle1 | O103:H8 | ι1 | AJ879906 | + | - | - |
FV3854-1070/1 | healthy cattle3 | O157:H45 | α1 | AJ879907 | + | - | - |
By using CLUSTAL W for optimal sequence alignment, we determined the genetic relationship of the new intimin gene (η2) and the remaining eae variants (Table 4). Thus, the eae-η2 sequence is very similar to eae-η1 (identy of 98%). Phylogenetic analysis revealed six groups of the closely related intimin genes: (i) α1, α2, ζ, and νB; (ii) β1, δ/β2O, κ, ξR/β2B; (iii) ε1, ξB, η1, η2 and νR/ε2; (iv) γ1, μB, and γ2/θ; (v) λ ; and (vi) ι1 and μR/ι2.
Further characterization of EPEC and STEC strains
Nine EPEC strains harbored the ast A gene encoding for EAST1 (Table 1). Additionally, three ast A positive strains of serotype ONT:H45 harbored the bfpA gene encoding bundlin, whereas only one strain was positive for the EAF plasmid. Overall, 23 different associations of serotypes with virulence factors were identified in EPEC strains.
Of the 21 eae positive E. coli harboring genes encoding for Shiga toxins, the majority (13 strains) carried only stx 1 genes, 4 strains only stx 2 genes, and 4 strains both toxin genes (Table 2). The only stx 1 positive strains belonged to serotypes O5:H- (2 strains), O103:H2 (10 strains) and O111:H21 (1 strain), the only stx 2 positive strains to serotypes O26:H-, O26:H2, O145:H-, and O157:H7, and all the strains positive for both toxin genes to serotype O145:H-. Moreover, the majority of STEC strains (86%) tested positive for the ehxA gene encoding for Enterohemolysin. Overall, ten different associations of serotypes with virulence factors were identified.
Discussion
Of 51 eae positive E. coli strains, 59% were classified as EPEC and 41% as STEC. The serogroups O26, O103, and O145 and serotypes O26:H-, O103:H2, O145:H- were most frequently found. Comparable distributions of EPEC (57%) and STEC (43%) strains and serogroups (44% of strains serotyped as O26, O103, O145, or O156) were reported in strains isolated from healthy cattle in Japan [34]. Of the typical EPEC serogroups (O26, O55, O86, O111, O114, O119, O125, O126, O127, O128, O142, and O156), only six strains were found in the present study: four O26 strains, one O119 strain, and one O128 strain. In bovine STEC strains, only a restricted number of serotypes have been most commonly found [8, 20]: the predominant serotype in the majority of surveys realized in Europe was O113:H21, in America and Australia O26:H11, and in Japan O45:H8/H- and O145:H-. As in the present study, authors in Argentina, Canada, France, Germany, Spain, and the United States have found that many STEC recovered from cattle belonged to serotypes previously associated with human disease [8, 35–38].
Intimin mediates the intimate bacterial attachment to the host cell surface of EPEC and STEC, and is required for the formation of the characteristic A/E lesions. In EPEC and STEC strains isolated from human patients and from healthy infants from Germany and Australia, intimin variants α1, β1, γ1 and γ2/θ were most frequently detected [5, 6, 8, 17, 26]. Moreover, STEC serotypes commonly recovered from outbreaks of HUS and hemorrhagic colitis (O157:H7/H-; O111:H-; O26:H11/H-) typically possess intimin γ1, γ2/θ, and β1 [5, 6, 8, 14].
Overall, the 51 isolated eae positive bovine E. coli strains comprised a variety of 10 intimin variants, and most of them harbored eae-β1(33%), eae-ε1 (26%) and eae-γ1(16%). As it is known that different intimin variants are associated with distinctive phylogenetic lineages of LEE-positive E. coli [4, 39, 40], the identified variety of bovine eae positive strains further substantiates the reservoir function of cattle for infections of humans with LEE positive strains.
Intimin β1 appears to be the most widespread variant [7, 8, 14, 27, 39, 41, 42]. In that it has been found in both EPEC and STEC strains from humans and several animal species, and its presence is associated with multiple E. coli serotypes. Strains harboring eae-β1 include important human diarrheagenic serotypes such as EPEC O26:H11, O111:H2, O114:H2, O126:H2, O128:H2 and STEC O26:H11/H-, O118:H16 and O177:H- [5, 26, 27], serotypes partly also detected in this study.
Intimin ε1 was described for the first time in human and bovine STEC of serogroup O8, O11, O45, O103, O121, and O165 [5]. In this study, eae-ε1, was detected in three bovine EPEC strains including one O103:H2 strain, and in all 9 bovine STEC O103:H2 strains. Furthermore, in a recent study performed on sheep in Switzerland, intimin ε1 was detected in all STEC O103:H2 [43]. STEC O103:H2 strains have frequently been associated with HUS and hemorrhagic colitis [26, 27, 44, 45].
Intimin γ1 was restricted to STEC and associated with serotypes considered as highly pathogenic to humans: O145:H- (five strains) and, O157:H7 (one strain). In addition to these serotypes, eae-γ1 was previously described in association with STEC O145:H28, and with EPEC O55:H7/H-, from which STEC O157:H7 are believed to have evolved [8, 26, 27, 46].
Interestingly, one bovine EPEC O157:H45 strain harboring eae-α1 was detected. Moreover, eae-α1 was also recently detected in bovine EPEC O157:H45 [33], in two EPEC O142:H6 isolated from monkeys [47] and in a human STEC O177:H7 strain [25]. These findings disagree with the suggested restriction of intimin α1 to human EPEC strains of serotypes O55:H6, O127:H6, H34/H-, O142:H6 [4, 5].
We have identified a new intimin gene (η2) in three bovine bfpA and astA-positive EPEC strains of serotype ONT:H45. The complete nucleotide sequences of the new eae-η2 (AJ879898, AJ879899, AJ879900) variant genes of the three strains were determined. The new intimin η2 also was found in one EPEC ONT:H45 strain isolated from a patient with diarrhea in Spain by Blanco et al. (unpublished data, EMBL nucleotide sequence AJ876652). Recently, a food-borne outbreak of diarrhea involving 41 students (ages 12 to 15) was reported in Japan by Yatsuyanagi et al. [48]. The implicated organism was a EPEC ONT:H45, which hybridized with the probes for eaeA, astA and bfpA genes.
In our study, about one third of EPEC strains harbored ast A as further putative virulence factor; whereas only seven EPEC strains harbored bfpA encoding bundling, the structural subunit of the bundle-forming pilus in typical EPEC strains, and only one EPEC of serotype O157:H45 was positive for the EAF plasmid. Overall, bfpA seems to be isolated very rarely from bovine EPEC strains, since there are scarcely any reports of E. coli strains with bfpA isolated from cattle. However, in a recent study, we characterized 11 O157:H45 EPEC strains isolated from cattle in Switzerland and found 10 bfpA positive strains among them [33].
To assess the pathogenicity of STEC, further evaluation of virulence factors in addition to serotype is necessary. O157 and non-O157 STEC strains isolated from patients with severe symptoms such as bloody diarrhea, HC, and HUS frequently show a typical virulence spectrum, with such strains tending to be stx 2 and eae positive [49–51]. Moreover, it was previously shown that bovine and human strains harboring the eae gene were statistically more likely to be positive for the ehxA gene encoding for Enterohemolysin [7, 26, 52]. However, the impact of Enterohemolysin, which was found in the majority of STEC strains, is controversially discussed. Additionally, STEC commonly recovered from outbreaks of HUS and HC typically possessed eae-β1, eae-γ1 and γ2/θ [5–7, 39]. In consequence, apart of the stx 2 gene, which was previously reported to correlate with severe disease in humans, intimin subtyping may facilitate further understanding of associations among serotype, eae and stx subtype. In consequence, seven STEC strains (14% of all eae positive strains and 33% of STEC strains) showed a virulence pattern characteristic of highly virulent human strains: four O145:H- strains harboring stx 1, stx 2, eae-γ1, and ehxA, one O26:H- strain harboring stx 2, eae-β1, and ehxA, one O145:H- strain harboring stx 2, eae-γ1, and ehxA, and one O157:H7 strain harboring stx 2, eae-γ1, and ehxA.
Conclusion
Our data confirm that ruminants are an important source of serologically and genetically diverse intimin-harboring E. coli strains. Moreover, cattle have not only to be considered as important asymptomatic carriers of O157 STEC but can also be a reservoir of EPEC and eae positive non-O157 STEC, which are described in association with human diseases. The fecal carriage of foodborne pathogens among livestock animals at slaughter is strongly correlated with the hazard of carcasses contamination. In order to reduce the risk represented by STEC and EPEC, the maintenance of slaughter hygiene is consequently of central importance in meat production.
Methods
E. coli strains
From 330 fecal samples, collected from Swiss cattle at slaughter, 10 g were each enriched in 100 ml brilliant green bile broth (BBL, Cockeysville, Md.) at 37°C for 24 h. The enriched samples were streaked onto sheep blood agar (Difco Laboratories, Detroit, Mich.; 5% sheep blood Oxoid, Hampshire, UK), and after incubation at 37°C for another 24 h, the colonies were washed off with 2 ml of 0.85% saline solution. Two μl of each plate eluate were then evaluated by PCR with primers EAE-1 and EAE-2 (Table 5) targeting sequences at the 5' eae conserved region detecting all types of eae described at the moment. From the 132 eae PCR-positive samples, 51 eae PCR-positive samples were then randomly selected for strain isolation with an eae DNA probe and colony dot-blot hybridization.
Table 5
Sequences of oligonucleotide primers used for typing of eae intimin gene
Gene | Primer | Oligonucleotide sequence (5'-3')c | Fragment size (bp) | Annealing temperature | Primer coordinates | Accession number | Reference |
|---|---|---|---|---|---|---|---|
eae a | EAE-1 EAE-2 | GGAACGGCAGAGGTTAATCTGCAG GGCGCTCATCATAGTCTTTC | 775 | 55°C | 1441–1460 2193–2215 | AF022236 | 7 |
eae-α1 | EAE-FB EAE-A | AAAACCGCGGAGATGACTTC CACTCTTCGCATCTTGAGCT | 820 | 60°C | 1909–1928 2709–2728 | AF022236 | 8 |
eae-α2 | IH2498aF IH2498aR | AGACCTTAGGTACATTAAGTAAGC TCCTGAGAAGAGGGTAATC | 517 | 60°C | 2099–2122 2597–2615 | AF530555 | 8 |
eae-β1 | B1A B1B | ACTTCGCCACTTAATGCCAGC TTGCAGCACCCCATGTTGAAT | 730 | 66°C | 1924–1944 2633–2653 | AF453441 | 9 |
eae-ξR/β2Bb,e | B2A B2B | AAGGGGGGAACCCCTGTGTCA ATTTATTCGCAGCCCCCCACG | 604 | 66°C | 2056–2076 2639–2659 | AF530556 AJ715407 | 9 |
eae-δ/κ/β2Oc | EAE-FB EAE-D | AAAACCGCGGAGATGACTTC CTTGATACACCCGATGGTAAC | 833 | 60°C | 1909–1928 2721–2741 | U66102 | 8 |
eae-γ1 | EAE-FB EAE-C1 | AAAACCGCGGAGATGACTTC AGAACGCTGCTCACTAGATGTC | 804 | 60°C | 1909–1928 2691–2712 | AF071034 | 8 |
eae-θ/γ2d | EAE-FB EAE-C2 | AAAACCGCGGAGATGACTTC CTGATATTTTATCAGCTTCA | 808 | 58°C | 1909–1928 2697–2716 | AF025311 | 8 |
eae-ε1 | EAE-FB LP5 | AAAACCGCGGAGATGACTTC AGCTCACTCGTAGATGACGGCAAGCG | 722 | 66°C | 1909–1928 2605–2630 | AF116899 | 8 |
eae-νR/ε2e | EAE-E2F EAE-E2R | AATACAGAAGTTAAGGCAT ACGACCACTATTCATTTC | 378 | 58°C | 2230–2248 2590–2607 | AF530554 | 9 |
eae-ζ | Z1 Z2 | GGTAAGCCGTTATCTGCC ATAGCAAGTGGGGTGAAG | 206 | 62°C | 2062–2079 2250–2267 | AF449417 | 8 |
eae-η | EAE-FB ETA-B | AAAACCGCGGAGATGACTTC TAAGCGACCACTATTCGTG | 702 | 60°C | 1899–1918 2582–2600 | AJ308550 | 9 |
eae-ι1 | EAE-FB IOTA-B | AAAACCGCGGAGATGACTTC GTCATATTTAACTTTTACACTA | 651 | 55°C | 1909–1928 2538–2559 | AJ308551 | 9 |
eae-μR/ι2e | Iota2-F Iota2-R | CTGGTAAAGCGATAGTCAAAC GCGTTTTTGAAGAAACATTTTGC | 936 | 58°C | 1850–1870 2763–2785 | AF530553 | 9 |
eae-λ | 68.4F 68.4R | CGGTCAGCCTGTGAAGGGC ATAGATGCCTCTTCCGGTATT | 466 | 64°C | 2061–2079 2506–2526 | AJ715409 | 8 |
eae-μBf | EAE-FB FV373R | AAAACCGCGGAGATGACTTC ACTCATCATAATAAGCTTTTTGG | 665 | 60°C | 1909–1928 2541–2563 | AJ705049 | 9 |
eae-νBf | IH1229aF IH1229aR | CACAGCTTACAATTGATAACA CTCACTATAAGTCATACGACT | 311 | 60°C | 269–289 559–579 | AJ705050 | 8 |
eae-ξBf | EAE-FB B49R | AAAACCGCGGAGATGACTTC ACCACCTTTAGCAGTCAATTTG | 468 | 66°C | 1909–1928 363–384 | AF116899 AJ705051 | 8 |
The eae probes were prepared by labeling eae-PCR amplicons from E. coli O157:H7 strain 857/03 with DIG High Prime kit (Roche, Mannheim, Germany). Briefly, for colony hybridization, the 51 eae positive samples were plated onto sheep blood agar and incubated overnight at 37°C. Colonies were transferred to a nylon membrane (Roche), and lysed following standard methods. After washing, crosslinking, and prehybridization in DIG-Easy-Hyb buffer (Roche) at 37°C for about 30 min, hybridization of membranes with eae DNA probes was performed overnight at 42°C. After washing in pre-heated primary and secondary wash buffers, the presence of labeled probe was detected with in alkaline phosphatase-conjugated antibody detection kit and NBT/BCIP stock solution according to the instructions of the manufacturer (Roche). Positive colonies were picked from the original sheep blood agar and confirmed as E. coli by biochemical properties (acid production from mannitol, the o-nitrophenyl-β-D-galactopyranoside (ONPG) test, H2S and indole production, and proof of urease and lysine decarboxylase activities) and by PCR to be eae positive [7]. One randomly chosen colony per sample was used for further strain characterization.
Further strain characterization
Determination of O and H antigens was performed by the method described by Guinée et al. [53] with all available O (O1 to O185) and H (H1 to H56) antisera. E. coli isolates that are nonmotile are described as having an H- flagellum type. Antisera were obtained and absorbed with corresponding cross-reaction antigens to remove nonspecific agglutinins. O antisera were produced in the Laboratorio de Referencia E. coli (LREC) http://www.lugo.usc.es/ecoli, and H antisera were obtained from the Statens Serum Institut (Copenhagen, Denmark). E. coli strains representing the new O groups O182 to O185 [unpublished data] were kindly provided by Flemming Scheutz (International Escherichia Centre, Statens Serum Institut, Copenhagen, Denmark).
All PCR assays applied in this study for characterization of eae positive E. coli strains were performed in a T3 thermocycler (Biometra, Göttingen, Germany). PCR reagents were purchased from PROMEGA (Madison, Wis.), and primers were synthesized by MICROSYNTH (Balgach, Switzerland). The 50-μl PCR mixtures normally consisted of 2 μl of bacterial suspension boiled at 100°C for 5 min in 42 μl of double-distilled water, 5 μl of 10-fold-concentrated polymerase synthesis buffer containing 2.0 mM MgCl2, 200 μM (each) desoxynucleosid triphosphate (dNTP), 30 pmol of each primer, and 2.5 U of Taq DNA polymerase. The PCR primers, target sequences, product sizes and references are listed in Tables 5 and 6. Differences in the normal PCR mixture and cycling conditions for each PCR were previously described in the cited literature. To identify eae variants, intimin type specific PCR assays using primers complementary to the heterogeneous 3' end of intimin genes were performed [8, 9]. For detection of further putative virulence genes all strains were examined for the presence of stx genes with primers VT1 and VT2 [54]. Stx positive strains were examined for the presence of stx 1 and stx 2 genes [55, 56]. Stx negative strains were further examined for the presence of the EAF plasmid [57], the bfpA gene on the EAF plasmid [58], and the astA gene encoding EAST1 [59].
Table 6
Sequences of oligonucleotide primers used for detection other virulence genes
Target | Primer | Oligonucleotide sequence (5'-3') Sequence | Product size | Reference |
|---|---|---|---|---|
stx | VT1 VT2 | ATTGAGCAAAATAATTTATAT GTG TGATGATGGCAATTCAGTAT | 523 bp 520 bp | 54 |
stx 1 | KS7 KS8 | CCCGGATCCATGAAAAAAACATTATTAATAGC CCCGAATTCAGCTATTCTGAGTCAACG | 285 bp | 55 |
stx 2 | VT2-e VT2-f | AATACATTATGGGAAAGTAATA TAAACTGCACTTCAGCAAAT | 348 bp | 56 |
ehxA | HlyA1 HlyA2 | GGTGCAGCAGAAAAAGTTGTAG TCTCGCCTGATAGTGTTTGGTA | 311 bp | 31 |
astA | EAST11a EAST11b | CCATCAACACAGTATATCCGA GGTCGCGAGTGACGGCTTTGT | 111 bp | 59 |
EAF | EAF1 EAF25 | CAGGGTAAAAGAAAGATGATAA TATGGGGACCATGTATTATCA | 397 bp | 57 |
bfpA | EP1 EP2 | AATGGTGCTTGCGCTTGCTGC GCCGCTTTATCCAACCTGGTA | 326 bp | 58 |
Sequencing of the intimin (eae) genes
The nucleotide sequence of the amplification products purified with a QIAquick DNA purification kit (Qiagen) was determined by the dideoxynucleotide triphosphate chain termination method of Sanger, with the BigDye Terminator v3.1 Cycle Sequencing Kit and an ABI 3100 Genetic Analyzer (Applied Bio-Systems).
Phylogenetic analyses
Genetic distances and phylogenetic trees of eae sequences were calculated and constructed with the CLUSTAL W program [60]included in the EMBL sofware http://www.ebi.ac.uk/clustalw/.
Nucleotide sequence accession numbers
The eae sequences of strains analyzed were deposited in the European Bioinformatics Institute (EMBL Nucleotide Sequence Database) and the accession numbers assigned are indicated in Table 3.
Declarations
Acknowledgements
This work was partly supported by grant from the Fondo de Investigación Sanitaria (FIS G03-025-COLIRED-O157), and the Xunta de Galicia (grants PGIDIT02BTF26101PR and PGIDIT04RAG261014PR).
Authors’ Affiliations
(1)
Laboratorio de Referencia de E. coli (LREC), Departamento de Microbioloxía e Parasitoloxía, Facultade de Veterinaria, Universidade de Santiago de Compostela (USC)
(2)
Institute for Food Safety and Hygiene, Vetsuisse Faculty, University of Zurich
References
- Nataro JP, Kaper JB: Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998, 11: 142-201.PubMed CentralPubMedGoogle Scholar
- Frankel G, Phillips AD, Rosenshine I, Dougan G, Kaper JB, Knutton S: Enteropathogenic and enterohemorrhagic Escherichia coli : more subversive elements. Mol Microbiol. 1998, 30: 911-921. 10.1046/j.1365-2958.1998.01144.x.View ArticlePubMedGoogle Scholar
- McDaniel TK, Kaper JB: A cloned pathogenicity island from enteropathogenic Escherichia coli confers the attaching and effacing phenotype on E. coli K-12. Mol Microbiol. 1997, 23: 399-407. 10.1046/j.1365-2958.1997.2311591.x.View ArticlePubMedGoogle Scholar
- Adu-Bobie J, Frankel G, Bain C, Goncalves AG, Trabulsi LR, Douce G, Knutton S, Dougan G: Detection of intimins alpha, beta, gamma, and delta, four intimin derivatives expressed by attaching and effacing microbial pathogens. J Clin Microbiol. 1998, 36: 662-668.PubMed CentralPubMedGoogle Scholar
- Oswald E, Schmidt H, Morabito S, Karch H, Marches O, Caprioli A: Typing of intimin genes in human and animal enterohemorrhagic and enteropathogenic Escherichia coli :characterization of a new intimin variant. Infect Immun. 2000, 68: 64-71.PubMed CentralView ArticlePubMedGoogle Scholar
- Zhang WL, Köhler B, Oswald E, Beutin L, Karch H, Morabito S, Caprioli A, Suerbaum S, Schmidt H: Genetic diversity of intimin genes of attaching and effacing Escherichia coli strains. J Clin Microbiol. 2002, 40: 4486-4492. 10.1128/JCM.40.12.4486-4492.2002.PubMed CentralView ArticlePubMedGoogle Scholar
- Blanco M, Blanco JE, Mora A, Rey J, Alonso JM, Hermoso M, Hermoso J, Alonso MP, Dahbi G, González EA, Bernárdez MI, Blanco J: Serotypes, virulence genes and intimin types of Shiga toxin (Verotoxin)-producing Escherichia coli isolates from healthy sheep in Spain. J Clin Microbiol. 2003, 41: 1351-1356. 10.1128/JCM.41.4.1351-1356.2003.PubMed CentralView ArticlePubMedGoogle Scholar
- Blanco M, Blanco JE, Mora A, Dahbi G, Alonso MP, González EA, Bernárdez MI, Blanco J: Serotypes, virulence genes and intimin types of Shiga toxin (Verotoxin)-producing Escherichia coli isolates from cattle in Spain: identification of a new intimin variant gene (eae-ξ). J Clin Microbiol. 2004, 42: 645-651. 10.1128/JCM.42.2.645-651.2004.PubMed CentralView ArticlePubMedGoogle Scholar
- Blanco M, Podola NL, Krüger A, Sanz ME, Blanco JE, González EA, Dahbi G, Mora A, Bernárdez MI, Etcheverría AI, Arroyo GH, Lucchesi PMA, Parma AE, Blanco J: Virulence genes and intimin types of Shiga-toxin-producing Escherichia coli isolated from cattle and beef products in Argentina. Int Microbiol. 2004, 7: 269-276.PubMedGoogle Scholar
- Fitzhenry RJ, Pickard DJ, Hartland EL, Reece S, Dougan G, Phillips AD, Frankel G: Intimin type influences the site of human intestinal mucosal colonisation by enterohemorrhagic Escherichia coli O157:H7. Gut. 2002, 50: 180-185. 10.1136/gut.50.2.180.PubMed CentralView ArticlePubMedGoogle Scholar
- Jores J, Zehmke K, Eichberg J, Rumer L, Wieler LH: Description of a novel intimin variant (type zeta) in the bovine O84:NM verotoxin-producing Escherichia coli strain 537/89 and the diagnostic value of intimin typing. Exp Biol Med. 2003, 228: 370-376.Google Scholar
- Torres AG, Zhou X, Kaper JB: Adherence of diarrheagenic Escherichia coli strains to epithelial cells. Infect Immun. 2005, 73: 18-29. 10.1128/IAI.73.1.18-29.2005.PubMed CentralView ArticlePubMedGoogle Scholar
- Tarr CL, Whittam S: Molecular evolution of the intimin gene in O111 clones of pathogenic Escherichia coli. J Bacteriol. J Bacteriol. 2002, 184: 479-487. 10.1128/JB.184.2.479-487.2002.PubMed CentralView ArticlePubMedGoogle Scholar
- Ramachandran V, Brett K, Hornitzky MA, Dowton M, Beltelheim KA, Walker MJ, Djordjevic SP: Distribution of intimin subtypes among Eschericha coli isolates from ruminant and human sources. J Clin Microbiol. 2003, 41: 5022-5032. 10.1128/JCM.41.11.5022-5032.2003.PubMed CentralView ArticlePubMedGoogle Scholar
- Kaper JB: Defining EPEC. Rev Microbiol. 1996, 27: 130-133.Google Scholar
- Trabulsi LR, Keller R, Tardelli Gomes TA: Typical and atypical enteropathogenic Escherichia coli. Emerg Infect Dis. 2002, 8: 508-513.PubMed CentralView ArticlePubMedGoogle Scholar
- Beutin L, Marchés O, Bettelheim KA, Gleier K, Zimmermann S, Schmidt H, Oswald E: HEp-2 cell adherence, actin aggregation, and intimin types of attaching and effacing Escherichia coli strains isolated from healthy infants in Germany and Australia. Infect Immun. 2003, 71: 3995-4002. 10.1128/IAI.71.7.3995-4002.2003.PubMed CentralView ArticlePubMedGoogle Scholar
- Karmali MA: Infection by verocytotoxin-producing Escherichia coli. Clin Microbiol Rev. 1985, 2: 5-38.Google Scholar
- Paton JC, Paton AW: Pathogenesis and diagnosis of Shiga toxin-producing E. coli infections. Clin Microbiol Rev. 1998, 11: 450-479.PubMed CentralPubMedGoogle Scholar
- Blanco J, Blanco M, Blanco JE, Mora A, Alonso MP, González EA, Bernárdez MI: Epidemiology of verocytotoxigenic Escherichia coli (VTEC) in ruminants. Edited by: Duffy G, Garvey P, McDowell D. 2001, Vercytotoxigenic Escherichia coli, Food and Nutrition Press, Inc., Trumbull, Conn, 113-148.Google Scholar
- Banatvala N, Griffin PM, Greene KD, Barrett TJ, Bibb WF, Green JH, Wells JG, (Hemolytic Uremic SyndromeStudy Collaborators): The United States National Prospective Hemolytic Uremic Syndrome Study: microbiologic, serologic, clinical, and epidemiologic findings. J Infect Dis. 2001, 183: 1063-1070. 10.1086/319269.View ArticlePubMedGoogle Scholar
- Chapman PA, Cerdan Malo AT, Ellin M, Ashton R, Harkin MA: Escherichia coli O157 in cattle and sheep at slaughter, on beef and lamb carcasses and in raw beef and lamb products in South Yorkshire, UK. Int J Food Microbiol. 2001, 64: 139-150. 10.1016/S0168-1605(00)00453-0.View ArticlePubMedGoogle Scholar
- Eklund M, Scheutz F, Siitonen A: Clinical isolates of non-O157 Shiga toxin-producing Escherichia coli : serotypes, virulence characteristics, and molecular profiles of strains of the same serotype. J Clin Microbiol. 2001, 39: 2829-2834. 10.1128/JCM.39.8.2829-2834.2001.PubMed CentralView ArticlePubMedGoogle Scholar
- Park CH, Kim HJ, Dixon DL: Importance of testing stool specimens for Shiga toxins. J Clin Microbiol. 2002, 40: 3542-3543. 10.1128/JCM.40.9.3542-3543.2002.PubMed CentralView ArticlePubMedGoogle Scholar
- Welinder-Olsson C, Badenfors M, Cheasty T, Kjellin E, Kaijser B: Genetic profiling of enterohemorrhagic Escherichia coli strains in relation to clonality and clinical signs of infection. J Clin Microbiol. 2002, 40: 959-964. 10.1128/JCM.40.3.959-954.2002.PubMed CentralView ArticlePubMedGoogle Scholar
- Beutin L, Krause G, Zimmermann S, Kaulfuss S, Gleier K: Characterization of Shiga toxin-producing Escherichia coli strains isolated from human patients in Germany over a 3-year period. J Clin Microbiol. 2004, 42: 1099-1108. 10.1128/JCM.42.3.1099-1108.2004.PubMed CentralView ArticlePubMedGoogle Scholar
- Blanco JE, Blanco M, Alonso MP, Mora A, Dahbi G, Coira MA, Blanco J: Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin-) producing Escherichia coli isolates from human patients: Prevalence in Lugo, Spain, from 1992 through 1999. J Clin Microbiol. 2004, 42: 311-319. 10.1128/JCM.42.1.311-319.2004.PubMed CentralView ArticlePubMedGoogle Scholar
- Lopez EI, Contrini MM, De Rosa MF: Epidemiology of Shiga toxin-producing Escherichia coli in South America. Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. Edited by: Kaper JB, O'Brien AD. 1998, Asm Press, Washington D.C, 30-37.Google Scholar
- Elliott EJ, Robins-Browne RM, O'Loughlin EV, Bennett-Wood V, Bourke J, Henning P, Hogg GG, Knight J, Powell H, Redmond D, (Contributors to the Australian Paediatric Surveillance Unit): Nationwide study of hemolytic uremic syndrome: clinical, microbiological, and epidemiological features. Arch Dis Child. 2001, 85: 125-131. 10.1136/adc.85.2.125.PubMed CentralView ArticlePubMedGoogle Scholar
- Beutin L, Geier D, Zimmermann S, Scheutz F: Virulence markers of Shiga-like toxin-producing Escherichia coli strains originating from healthy domestic animals of different species. J Clin Microbiol. 1995, 33: 631-635.PubMed CentralPubMedGoogle Scholar
- Schmidt H, Beutin L, Karch H: Molecular analysis of the plasmid-encoded hemolysin of Escherichia coli O157:H7 strain EDL 933. Infect Immun. 1995, 63: 1055-1061.PubMed CentralPubMedGoogle Scholar
- Rey J, Blanco JE, Blanco M, Mora A, Dhabi G, Alonso JM, Hermoso M, Hermoso J, Alonso MP, Usera MA, González EA, Bernárdez MI, Blanco J: Serotypes, phage types and virulence genes of Shiga-producing Escherichia coli isolated from sheep in Spain. Vet Microbiol. 2003, 94: 47-56. 10.1016/S0378-1135(03)00064-6.View ArticlePubMedGoogle Scholar
- Stephan R, Borel N, Zweifel C, Blanco M, Blanco JE: First isolation and further characterization of enteropathogenic Escherichia coli (EPEC) O157:H45 strains from cattle. BMC Microbiol. 2004, 4: 10-10.1186/1471-2180-4-10.PubMed CentralView ArticlePubMedGoogle Scholar
- Kobayashi H, Miura A, Hayashi H, Ogawa T, Endo T, Hata E, Eguchi M, Yamamoto K: Prevalence and characteristics of eae -positive Escherichia coli from healthy cattle in Japan. Appl Environ Microbiol. 2003, 69: 5690-5692. 10.1128/AEM.69.9.5690-5692.2003.PubMed CentralView ArticlePubMedGoogle Scholar
- Johnson RP, Clarke RC, Wilson JB, Read S, Rahn K, Renwick SA, Sandhu KA, Alves D, Karmali MA, Lior H, Mcewen SA, Spika JS, Gyles CL: Growing concerns and recent outbreaks involving non-O157 serotypes of verotoxigenic Escherichia coli. J Food Prot. 1996, 59: 1112-1122.Google Scholar
- Parma AE, Sanz ME, Blanco JE, Blanco J, Vinas MR, Blanco M, Padola NL, Etcheverria AI: Virulence genotypes and serotypes of verotoxigenic Escherichia coli isolated from cattle and foods in Argentina. Importance in public health. Eur J Epidemiol. 2000, 16: 757-762. 10.1023/A:1026746016896.View ArticlePubMedGoogle Scholar
- Pradel N, Livrelli V, De Champs C, Palcoux JB, Reynaud A, Scheutz F, Sirot J, Joly B, Forestier C: Prevalence and characterization of Shiga toxin-producing Escherichia coli isolated from cattle, food, and children during a one-year prospective study in France. J Clin Microbiol. 2000, 38: 1023-1031.PubMed CentralPubMedGoogle Scholar
- Padola NL, Sanz ME, Blanco JE, Blanco M, Blanco J, Etcheverría AI, Arroyo GH, Usera MA, Parma AE: Serotypes and virulence genes of bovine Shigatoxigenic Escherichia coli (STEC) isolated from a feedlot in Argentina. Vet Microbiol. 2004, 100: 3-9. 10.1016/S0378-1135(03)00127-5.View ArticlePubMedGoogle Scholar
- McGraw EA, Li J, Selander RK, Whittam TS: Molecular evolution and mosaic structure of alpha, beta, and gamma intimins of pathogenic Escherichia coli. Mol Biol Evol. 1999, 16: 12-22.View ArticlePubMedGoogle Scholar
- Reid SD, Betting DJ, Whittam TS: Molecular detection and identification of intimin alleles in pathogenic Escherichia coli by multiplex PCR. J Clin Microbiol. 1999, 37: 2719-2722.PubMed CentralPubMedGoogle Scholar
- Orden JA, Yuste M, Cid D, Piacesi T, Martinez S, Ruiz-Santa-Quiteria JA, De la Fuente R: Typing of the eae and espB genes of attaching and effacing Escherichia coli isolates from ruminants. Vet Microbiol. 2003, 96: 203-215. 10.1016/S0378-1135(03)00238-4.View ArticlePubMedGoogle Scholar
- Aktan I, Sprigings KA, La Ragione RM, Faulkner LM, Paiba GA, Woodward MJ: Characterization of attaching-effacing Escherichia coli isolated from animals at slaughter in England and Wales. Vet Microbiol. 2004, 102: 43-53. 10.1016/j.vetmic.2004.04.013.View ArticlePubMedGoogle Scholar
- Zweifel C, Blanco JE, Blanco M, Blanco J, Stephan R: Serotypes and virulence genes of ovine non-O157 Shiga toxin-producing Escherichia coli in Switzerland. Int J Food Microbiol. 2004, 95: 19-27. 10.1016/j.ijfoodmicro.2004.01.015.View ArticlePubMedGoogle Scholar
- China B, Jacquemin E, Dervin A-C, Pirson V, Mainil J: Heterogeneity of the eae genes in attaching and effacing Escherichia coli from cattle: comparison with human strains. Res Microbiol. 1999, 150: 232-332. 10.1016/S0923-2508(99)80058-8.View ArticleGoogle Scholar
- Tarr PI, Fouser LS, Stapleton AE, Wilson RA, Kim HH, Vary JC, Clausen CR: Hemolytic-uremic syndrome in a six-year-old girl after a urinary tract infection with Shiga-toxin-producing Escherichia coli O103:H2. N Engl J Med. 1996, 335: 635-638. 10.1056/NEJM199608293350905.View ArticlePubMedGoogle Scholar
- Feng P, Lampel KA, Karch H, Whittam TS: Genotypic and phenotypic changes in the emergence of Escherichia coli O157:H7. J Infect Dis. 1998, 177: 1750-1753.View ArticlePubMedGoogle Scholar
- Blanco M, Blanco JE, Blanco J, Carvalho VM, Lopes Onuma D, Pestana de Castro AF: Typing of intimin (eae) genes in attaching and effacing Escherichia coli strains from Monkeys. J Clin Microbiol. 2004, 42: 1382-1383. 10.1128/JCM.42.3.1382-1383.2004.PubMed CentralView ArticlePubMedGoogle Scholar
- Yatsuyanagi J, Saito S, Miyajima Y, Amano KI, Enomoto K: Characterization of atypical enteropathogenic Escherichia coli strains harboring the gene astA that were associated with a waterborne outbreak of diarrhes in Japan. J Clin Microbiol. 2003, 41: 2033-2039. 10.1128/JCM.41.5.2033-2039.2003.PubMed CentralView ArticlePubMedGoogle Scholar
- Piérard D, Stevens D, Moriau L, Lior H, Lauwers S: Isolation and virulence factors of verotoxin-producing E. coli in human stool samples. Clin Microbiol Infect. 1997, 3: 531-540.View ArticlePubMedGoogle Scholar
- Boerlin P, McEwen SA, Boerlin-Petzold F, Wilson JB, Johnson RP, Gyles CL: Association between virulence factors of Shiga toxin-producing Escherichia coli and disease in humans. J Clin Microbiol. 1999, 37: 497-503.PubMed CentralPubMedGoogle Scholar
- Friedrich AW, Bielaszewska M, Zhang WL, Pulz M, Kuczius T, Ammon A, Karch H: Escherichia coli harboring Shiga toxin 2 gene variants: frequency and association with clinical symptoms. J Infect Dis. 2002, 185: 74-84. 10.1086/338115.View ArticlePubMedGoogle Scholar
- Zweifel C, Schumacher S, Blanco M, Blanco JE, Tasara T, Blanco J, Stephan R: Phenotypic and genotypic characteristics of non-O157 Shiga toxin-producing Escherichia coli (STEC) from Swiss cattle. Vet Microbiol. 2005, 105: 37-45. 10.1016/j.vetmic.2004.10.007.View ArticlePubMedGoogle Scholar
- Guinée PA, Jansen WH, Wadström T, Sellwood R: Escherichia coli associated with neonatal diarrhea in piglets and calves. Curr Top Vet Anim Sci. 1981, 13: 126-162.Google Scholar
- Burnens AP, Frey A, Lior H, Nicolet J: Prevalence and clinical significance of vero-cytotoxin-producing Escherichia coli (VTEC) isolated from cattle in herds with and without calf diarrhea. J Vet Med B. 1995, 42: 311-318.View ArticleGoogle Scholar
- Rüssmann H, Kothe E, Schmidt H, Franke S, Harmsen D, Caprioli A, Karch H: Genotyping of Shiga-like toxin genes in non-O157 Escherichia coli strains associated with hemolytic uremic syndrome. J Med Microbiol. 1995, 42: 404-410.View ArticlePubMedGoogle Scholar
- Piérard D, Muyldermans G, Moriau L, Stevens D, Lauwers S: Identification of new verocytotoxin type 2 variant B-subunit genes in human and animal Escherichia coli isolates. J Clin Microbiol. 1998, 36: 3317-3322.PubMed CentralPubMedGoogle Scholar
- Franke J, Granke S, Schmidt H, Schwarzkopf A, Wieler LH, Baljer G, Beutin L, Karch H: Nucleotide sequence analysis of enteropathogenic Escherichia coli (EPEC) adherence factor probe and development of PCR for rapid detection of EPEC harboring virulence plasmids. J Clin Microbiol. 1994, 32: 2460-2463.PubMed CentralPubMedGoogle Scholar
- Gunzburg ST, Tornieporth NG, Riley LW: Identification of enteropathogenic Escherichia coli by PCR-based detection of the bundle-forming pilus gene. J Clin Microbiol. 1995, 33: 1375-1379.PubMed CentralPubMedGoogle Scholar
- Yamamoto T, Nakazawa M: Detection and sequences of the enteroaggregative Escherichia coli heat-stable enterotoxin 1 gene in enterotoxigenic E. coli strains isolated from piglets and calves with diarrhea. J Clin Microbiol. 1997, 35: 223-227.PubMed CentralPubMedGoogle Scholar
- Thompson JD, Higgins DG, Gibson TJ: CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22: 4673-4680.PubMed CentralView ArticlePubMedGoogle Scholar
Copyright
© Blanco et al; licensee BioMed Central Ltd. 2005
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
