Genotyping analysis of Helicobacter pylori using multiple-locus variable-number tandem-repeats analysis in five regions of China and Japan

  • Chunliang Guo1, 2, 3Email author,

    Affiliated with

    • Yaling Liao1Email author,

      Affiliated with

      • Yan Li4,

        Affiliated with

        • Jun Duan5,

          Affiliated with

          • Ying Guo1,

            Affiliated with

            • Yuqian Wu5,

              Affiliated with

              • Yujun Cui6,

                Affiliated with

                • Hongwu Sun1,

                  Affiliated with

                  • Jinyong Zhang1,

                    Affiliated with

                    • Bing Chen2Email author,

                      Affiliated with

                      • Quanming Zou7Email author and

                        Affiliated with

                        • Gang Guo1Email author

                          Affiliated with

                          BMC Microbiology201111:197

                          DOI: 10.1186/1471-2180-11-197

                          Received: 20 March 2011

                          Accepted: 3 September 2011

                          Published: 3 September 2011

                          Abstract

                          Background

                          H. pylori (Helicobacter pylori) is the major causative agent of chronic active gastritis. The population of H. pylori shows a high genomic variability among isolates. And the polymorphism of repeat-units of genomics had participated the important process of evolution. Its long term colonization of the stomach caused different clinical outcomes, which may relate to the high degree of genetic variation of H. pylori. A variety of molecular typing tools have been developed to access genetic relatedness in H. pylori isolates. However, there is still no standard genotyping system of this bacterium. The MLVA (Multi-locus of variable number of tandem repeat analysis) method is useful for performing phylogenetic analysis and is widely used in bacteria genotyping; however, there's little application in H. pylori analysis. This article is the first application of the MLVA method to investigate H. pylori from different districts and ethnic groups of China.

                          Results

                          MLVA of 12 VNTR loci with high discrimination power based on 30 candidates were performed on a collection of 202 strains of H. pylori which originated from five regions of China and Japan. Phylogenetic tree was constructed using MLVA profiles. 12 VNTR loci presented with high various polymorphisms, and the results demonstrated very close relationships between genotypes and ethnic groups.

                          Conclusions

                          This study used MLVA methodology providing a new perspective on the ethnic groups and distribution characteristics of H. pylori.

                          Background

                          Helicobacter pylori (H. pylori) is a spiral-shaped, Gram-negative bacterium that infects half the world's population and is the major cause of chronic gastritis, peptic ulcers and gastric malignancies, including gastric non-cardia adenocarcinoma and mucosal-associated lymphoid tissue lymphoma [1, 2]. Most infected individuals present with no clinical symptoms, but approximately 10~20% will develop peptic ulcers and 1% will develop gastric cancer [3, 4], which could be associated with the diversity of H. pylori.

                          H. pylori exhibits exceptionally high rates of DNA point mutations and intra- and inter-genomic recombination. Recently, many molecular typing tools have been developed to investigate genetic relatedness among H. pylori isolates. However, these methods have limitations including lower discrimination power, or preventing results from different labs being compared [5, 6].

                          In 1999, MLVA analysis was proposed as a general approach to providing accurate, portable data that were appropriate for the epidemiological investigation of bacterial pathogens [711]. However, there's little information concerning populations of H. pylori species using MLVA. Whether this method is available for the H. pylori population is still uncertain.

                          H. pylori infections in China are common and extensively distributed, with an average infection rate of about 58%. In this study, 12 VNTR loci of the H. pylori genome were identified and used to analyze 202 strains of H. pylori which originated from different regions of China and Japan.

                          Results

                          Multi-VNTR loci for H. pylori genome

                          PCR products amplified from the reference strains 26695, HPAG1 and J99 were identical to the published sequences sizes. Of the locus VNTR-2576 and VNTR-614, the PCR products sequencing were consistence with our electrophoresis results. The exact number of tandem repeats at each locus could be determined from the sizes of the PCR products.

                          In this study, 30 VNTR loci were candidated from the H. pylori database. And we finally identified 12 VNTR loci using analysis, which were also distributed throughout the H. pylori genome (Table 1). There's no variation in the other 18 loci, which were removed in the following study. The variation in repeat numbers is divergence at the 12 VNTR loci. The main characteristics of the 12 VNTR loci are listed in Table 2, including the diversity index of each locus.
                          Table 1

                          Characteristics of the 12 VNTR loci in the reference H.pylori strains

                          Locus name

                          Position in the reference strains (bp)

                          Number of repeat times

                          Repeat unit size (bp)

                          Related gene in 26695

                           

                          26695

                          HPAG1

                          J99

                          26695

                          HPAG1

                          J 99

                            

                          VNTR-180

                          16605. . 16643

                          17912. . 17932

                          16761. . 16778

                          2

                          1

                          1

                          20

                          -

                          VNTR-263

                          42061. . 42115

                          43125. . 43167

                          42199. . 42252

                          4

                          3

                          4

                          14

                          rfbD

                          VNTR-614

                          129983. . 130389

                          125875. . 126119

                          1238315. . 1238474

                          9

                          5

                          3

                          53

                          dld

                          VNTR-557

                          120659. . 120675

                          118007. . 118023

                          116640. . 116673

                          1

                          1

                          2

                          17

                          -

                          VNTR-606

                          129957. . 130396

                          1189474. . 1189690

                          1238289. . 1238481

                          3

                          1

                          1

                          138

                          dld

                          VNTR-1801

                          485276. . 485316

                          452649. . 452673

                          448197. . 448261

                          1

                          1

                          2

                          27

                          hsdR

                          VNTR-2181

                          580530. . 580546

                          546643. . 546659

                          544199. . 544227

                          1

                          1

                          2

                          12

                          -

                          VNTR-2457

                          665196. . 665241

                          628875. . 628996

                          625968. . 626121

                          1

                          3

                          3

                          54

                          ppa

                          VNTR-2576

                          696789. . 697001

                          1067559. . 1067708

                          1112077. . 1112164

                          10

                          7

                          4

                          21

                          galU

                          VNTR-5062

                          1382502. . 1382594

                          1314612. . 1314776

                          1360215. . 1360348

                          8

                          14

                          11

                          12

                          -

                          VNTR-5282

                          1439274. . 1439284

                          1368268. . 1368279

                          1412390. . 1412413

                          1

                          1

                          2

                          12

                          clpX

                          VNTR-5581

                          1512724. . 1512751

                          1419518. . 1419531

                          1464638. . 1464651

                          2

                          1

                          1

                          14

                          -

                          Table 2

                          Description of 12 VNTR loci analyzing with 202 H.pylori clinical isolates

                          Locus

                          Forward and Reverse primer (F/R)

                          Annealing temperature (°C)

                          Expected product length in 26695 (bp)

                          Product size range

                          Allele size range(unites)

                          Total number

                          of alleles

                          Nei's diversity index

                          VNTR-180

                          F:TAAAGTGAAAGCGTTACAAAAAGAC R:CTTCAGGGTAGGAATACAGCAGAGT

                          53

                          185

                          165-225

                          1-4

                          4

                          55. 7

                          VNTR-263

                          F:TTGAATTGCAAGCTAATGAGTC R:AGAAGTGTTGATGCTAGAAGAG

                          52

                          352

                          310-366

                          1-5

                          5

                          63. 0

                          VNTR-614

                          F:ATTGATTATGATTTTCTTGGCAATTTTG R:GCTTATGAATGTGTGTTTTGCTGATGAC

                          54

                          758

                          334-864

                          1-7, 11

                          9

                          80. 7

                          VNTR-557

                          F:ATGGAAGTTTTTGATTTGATTG R:GGTGTAATGGGTGTTGATGGTC

                          50

                          152

                          152-202

                          1-3,

                          3

                          12. 3

                          VNTR-607

                          F:GAATTGATTATGATTTTCTTGGCAAT R: GCTGAAAACGCTAGGGATAGAGC

                          52

                          668

                          233-673

                          1, 2, 5-21, 23

                          20

                          92. 8

                          VNTR-1801

                          F:GCCGTATTTTAGGATAAAGCAAAG R:CGCGTTTTATAGCGCTTCTTATT

                          52

                          280

                          280-604

                          1-5, 12

                          5

                          57. 3

                          VNTR-2181

                          F:TTATGGAAAATATCATACAACCCCCTAT R:ATTTAGAAAAATTACCCCTTTCATCAAG

                          52

                          378

                          378-426

                          1-3, 5

                          4

                          20. 9

                          VNTR-2457

                          F:TAGAAGATTGCTTGAAAAGCCCTTT R:GCTCTATGATTTTAAAACGCTCCGT

                          52

                          650

                          650-812

                          1-4

                          4

                          73. 6

                          VNTR-2576

                          F:GATTTTTGATARGCTTTGCGATAG R:TAAAACGATTTTAGAAAACGACAC

                          51

                          371

                          182-371

                          1-7, 10

                          8

                          46. 2

                          VNTR-5062

                          F:AAGCTCGCCCTCATCGCC R:TAAAAAATATTAAATAATCAATT

                          50

                          307

                          223-259

                          1-4

                          4

                          40. 9

                          VNTR-5282

                          F:CCTTAAGCTCTTTAGGGGCTGG R:GAGAGTTCTAGGGGCGTGGC

                          56

                          335

                          335-371

                          1-4

                          4

                          36. 2

                          VNTR-5581

                          F:CGTTCACTCTGAGCCAGGATC R:GCTCTTTCTGTTTTGTTGTTGTAAT

                          52

                          202

                          190-218

                          1-3

                          3

                          34. 3

                          Clustering trend of the strains from different regions and ethnic groups

                          A MLVA system to the molecular typing of H. pylori strains has been developed. On the basis of the 12 VNTR loci, the profiles of each isolate were obtained (Figure 1). The clinical H. pylori strains were divided into 127 MTs, which has not been described previously. According to cluster analysis, most strains from the same focus presented with the same or similar MTs (Figure 1). In addition, strains from the same focus were dispersed in the cluster tree. As shown in Figure 1, the 86.7% (13/15) of the Tokyo isolates had very similar MTs and could be clustered into Group A. One of the remaining Tokyo isolates belonged to the Group C, and the others were scattered distribution. Of the Southern and Eastern Chinese isolates, 74.4% (43/32) were clustered into group B, including B1, B2 and B3 subgroups, and the rest strains were related to Group A, C and D. Of the isolates from Northern China, 60.7% were clustered into two major branches, groups C1 (37.5%, 21/56) and C2 (23.2%, 13/56), and other strains were scattered. Of the Western China isolates, 86.0% (37/43) were clustered into group D. The strains Tibet 1, 14, 23 and 43 were related to Group A, Tibet 37 and Tibet 35 were related to Group B2 and C2.
                          http://static-content.springer.com/image/art%3A10.1186%2F1471-2180-11-197/MediaObjects/12866_2011_1479_Fig1_HTML.jpg
                          Figure 1

                          Dendrogram analysis based on 12 VNTR loci for the 202H. pyloriisolates. Clustering analysis of Neighbor-joining tree (N-J) was using the categorical distance coefficient and the wards method. From left to right, the columns designated to the 12 VNTR loci, the strain ID, geographic origin (location) and H. pylori related disease. NC, SC, EC and WC under the column of 'Region' stand for the Southern, Northern, Eastern and Western of China respectively. Disease NUD and G represents the non-ulcer dyspepsia (NUD) and gastritis. And diseases PU (peptic ulcer) comprise duodenal and gastric ulcer as well as disease GC is with the gastric cancer. The branches color code reflects the focus of origin, the same color of the columns stand for origin from the same geographic origin (location). Isolates from different regions showed a certain cluster tendency, as Tokyo isolates were clustered into Group A, Southern and Eastern China isolates were clustered into group B, Northern China were clustered into two major branches, groups C1 and C2. Western China isolates were clustered into group D. While there's no significant relationship between MTs and H. pylori related diseases.

                          A minimum spanning tree was constructed on the basis of strains from different ethnic groups: 43 Tibetan, 33 Mongolian, 15 Yamato as well as 27 Han (Figure 2). There was a tendency to cluster into four main subgroups. However, there're still some exceptions, such as the Hangzhou-12 and 21, of Han strains (associated with gastritis and peptic ulcer), were related to the Tibetan strains group. Tibetan strains 1 and 43 (gastritis), were related to the Mongolian group, and Mongolian 16, (gastric cancer), was related to the Japanese group.
                          http://static-content.springer.com/image/art%3A10.1186%2F1471-2180-11-197/MediaObjects/12866_2011_1479_Fig2_HTML.jpg
                          Figure 2

                          Minimum spanning tree analysis. Minimum spanning tree analysis of MTs on the 118 strains from four ethnic groups was constructed. There're 3 kinds of lines, solid, thin and dotted, which represented single, double and triple or more loci variation respectively. The circles stand for strains, and different colors represent different ethnic groups. Strains from different ethic group could group together, esp. of strains from Tibetan.

                          Correlation between H. pylori MTs and the related diseases

                          Among the 202 samples, 14.9%, 55.9%, 25.2% and 4.0% of patients presented with non-ulcer dyspepsia (NUD), gastritis (G), peptic ulcer (PU) and gastric cancer (GC), respectively. And in our study there's no significant relationship between the H. pylori MTs and the related diseases.

                          Discussion

                          Recently, many bacterial genomes have been fully sequenced, and analysis of the sequenced genomes has revealed the presence of variable proportions of repeats, including tandem repeats. Short repeat motifs undergo frequent variation in the number of repeated units. MLVA is an appropriate method for bacterial typing and identification, for determining genetic diversity, and for the tracing-back of highly mono-morphological species [1214]. The MLVA typing was reported to have a high-quality species identification capability and a high discriminatory power. The method has been used in the analysis of many bacteria [1518], but little research has been carried out in H. pylori. Therefore, this study established the H. pylori MLVA system and applied to type clinical strains.

                          The H. pylori genome has a number of repeat sequences, and their repeat number results in divergence. The 12 loci identified were distributed throughout the genome. These loci had different variations in different isolates and were able to typing H. pylori successfully.

                          The H. pylori MTs were clustered with ethnic groups, consistent with the previous reports [19, 20]. The Han strains were selected from Southern China and had little relationship to Mongolian strains from Northern China or Tibetan strains from Western China. It may demonstrate an apparent cluster tendency in different regions and ethnic groups, but there were some exceptions, which may because, unlike other Asian countries with relatively homogeneous populations, China has a heterogeneous population from various ethnic groups. Therefore, there may be more opportunity for DNA transfer between strains of different genotypes in China than other countries. While Tibet is a relatively closed region, H. pylori strains from this area have a good cluster.

                          The H. pylori genome shows a high degree of genetic diversity among strains [21, 22], but weakly clonal groupings of different diseases were detected, and these could be superimposed on a pattern of free recombination. And the relationship between particular H. pylori genotype and related disease has not been sure.

                          MLVA is a useful molecular tool for epidemiological investigations and recognition of laboratory cross-contamination [2325]. VNTR analysis thus provides multiple independent characteristics for phylogenetic analysis. Studies have indicated that MLVA is sufficient to resolve closely related isolates. In contrast, combining loci with lower variability values is suitable for establishing clear phylogenetic patterns among strains that have evolved over a longer time period. Theoretically, the greater the number of loci used, the higher the discriminatory power that can be achieved, and subtler phylogenetic relationships among bacterial strains can be established.

                          At the present time, the MLVA was established and applied to examine the clonal relationships between H. pylori isolates from China and Japan. The loci used in this study provided high discriminatory power and successfully separated isolates of different strains from different geographical areas. And there was a particularly evident of H. pylori from Tibet, a relatively closed region, which showed better cluster than other ethnic groups. The data will aid in the development of a genomic polymorphism database of H. pylori. We have established a preliminary profile of MLVA but more information is required for a comprehensive profile.

                          China is a large country containing 56 ethnic groups and a large population. Therefore, further studies are required including isolates from more regions and over several more time-frames.

                          Conclusions

                          The studies indicated that MLVA method, based on 12 VNTR loci, is sufficient to resolve closely related isolates for the purpose of H. pylori genotyping analysis. This study used MLVA methodology provided a new perspective on the ethnic groups distribution characteristics of H. pylori.

                          Methods

                          H. pylori strains and DNA preparation

                          A total of 202 H. pylori strains were included in this study and the background information of the strains is listed in Table 3. The 187 clinical strains were isolated from various regions of China during 1998 and 2010; an additional 15 strains were presented as a gift by Institute of Medical Science University of Tokyo Japan in 2008. Patients ranged from 12 to 75 years old (mean age 44 years). All the patients reporting the symptoms of gastritis (G), peptic ulcer (PU) or gastric cancer (GC) underwent upper gastroendoscopy for both visual examination and biopsy collection. The strains were isolated from gastric biopsy gastrointestinal endoscopy of selected patients, who had not received non-steroidal anti-inflammatory drugs, proton pump inhibitors or other antibiotics during the last 2 months, revealed that out of 202 patients, 172 had either G, DU or GC and 30 had non-ulcer dyspepsia (NUD). Written consent was taken from all the patients before collection of the biopsy. The study was approved by the ethics review board at Third Military Medical University, and informed consent was obtained from all patients before participation.
                          Table 3

                          Background information of the 202 H. pylori clinical strains

                          City

                          Region

                          Ethnic group

                          Isolated year

                          No. of isolates

                          Chongqing

                          Southern China

                          Han

                          2004-2009

                          40

                          Guangzhou

                          Southern China

                          Han

                          2004-2010

                          12

                          Inner Mongolia

                          Northern China

                          Mongolian

                          2008

                          34

                          Shijiazhuang

                          Northern China

                          Han

                          2002-2003

                          12

                          Beijing

                          Northern China

                          Han

                          2004-2009

                          10

                          Hangzhou

                          Eastern China

                          Han

                          1998-2004

                          26

                          Shanghai

                          Eastern China

                          Han

                          2001-2007

                          10

                          Tibet

                          Western China

                          Tibetan

                          2008-2009

                          43

                          Tokyo

                          Japan

                          Yamato

                          2007

                          15

                          Bacteria were separated and cultured in Skirrow medium with 5% fresh sheep blood at 37°C for 24 h~72 h in a micro-aerobic environment. H. pylori genomes were extracted using genomic DNA isolation kits (Omega Biotek Inc). Culture and identification of H. pylori were done by appropriate biochemical tests and amplification of 16S rDNA using species-specific primers

                          Selection and identification the VNTR loci of H. pylori

                          VNTR loci were selected from the MLVA database http://​minisatellites.​u-psud.​fr/​ASPSamp/​base_​ms/​bact.​php by estimating the size of PCR products on agarose gels. The repeat sequence of loci ≥ 10 bp, consistency of repeat unit ≥ 90% and a minimum of two alleles in three reference strains of H. pylori (26695, HPAG1, J99) were selected for this research. The locations, copy numbers, sizes of the loci and the gene(s) involved are also listed in Table 1.

                          PCR amplification

                          A PCR reaction mixture (30 ml) containing 10 ng of DNA template, 0.5 mM of each primer, 1 unit of Taq DNA polymerase, 200 mM of dNTPs and 10 × PCR buffer (500 mM KCl, 100 mM TrisHCl (pH 8.3) 25 mM MgCl2) was utilized. Amplification was carried out in a DNA thermocycler (MJ Research PTC-225) with denaturation at 94°C for 8 min, followed by 30 cycles of denaturation at 94°C for 45 s, annealing at 52°C for 45 s and elongation at 72°C for 1 min [26]. A 10-min elongation at 72°C was performed after the last cycle to ensure complete extension of the amplicons.

                          Five μl of the PCR products were run on standard 3% agarose gels in 0.56TBE buffer at 8-10 V/cm. Gel lengths of 10 to 40 cm were used according to PCR product size and repeat unit size. Strains in which alleles had been precisely measured by re-sequencing or by direct comparison with a sequenced reference strain were used (In this study DNA from 26695, HPAG1 and J99 were used for this purpose). Multiple interspersed negative controls containing no DNA were included each time PCR was performed.

                          PCR products of 202 strains on VNTR-2576 and VNTR-614 sites were sequenced directly with a Taq Dye Deoxy Terminator Cycle Sequencing Kit on an ABI 377 sequencer (Applied Biosystems).

                          Data analysis

                          The number of repeat units in 12 VNTR loci were analyzed and inputted into BioNumerics version 5.1 software (Applied-Maths, Sint-Martens-Latem, Belgium), and gel images were obtained using the BioNumerics software package version 6.0 (Applied-Maths, Sint-Martens-Latem, Belgium) or using UVB gel image analysis. The number of repeat units in each locus was deduced by the amplicon size, flanking sequence length and repeat unit size. Data from agarose gel electrophoresis and UVB gel image analysis, obtained by capillary electrophoresis machines, were imported into BioNumerics by creating a virtual gel image. Gel image data were converted into characteristics data sets. Cluster analysis of Neighbor-joining tree (N-J) was carried out using the categorical similarity coefficient and the Ward method. A minimum spanning tree was inferred using characteristic data from cluster analysis. The polymorphism of each locus was represented by Nei's diversity index [27], calculated as DI = 1-∑(allelic frequency)2.

                          Reproducibility and stability of 12 VNTR loci via in-vitro passage

                          Twenty clinical strain genomes from China and Japan were amplified and multiple DNA samples from each strain yielded PCR products with identical sizes at all loci. Chongqing26 and Tibet36 each yielded no product at one locus, possibly because of mutations or poor quality DNA samples.

                          The stabilities of the VNTR loci were investigated in a long-term experiment in which the 20 test H. pylori isolates used were sub-cultured into fresh Skirrow medium 30 times by serial passages at two or three day intervals. The DNA from the strains cultivated in each passage was extracted and subjected to MLVA analysis. The results of the VNTR analysis demonstrated no difference in tandem repeat numbers (data not shown).

                          List of abbreviations

                          VNTR: 

                          variable-number tandem repeat

                          MLVA: 

                          multiple-locus VNTR analysis

                          MT: 

                          MLVA type

                          G: 

                          gastritis

                          NUD: 

                          non-ulcer dyspepsia

                          PU: 

                          peptic ulcer

                          GC: 

                          gastric cancer

                          SC: 

                          Southern China

                          WC: 

                          Western China

                          NC: 

                          Northern China

                          EC: 

                          Eastern China

                          CQ: 

                          Chongqing

                          GZ: 

                          Guangzhou

                          IM: 

                          Inner Mongolia

                          SJZ: 

                          Shijiazhuang

                          BJ: 

                          Beijing

                          HZ: 

                          Hangzhou

                          SH: 

                          Shanghai

                          TB: 

                          Tibet

                          TK: 

                          Tokyo.

                          Declarations

                          Acknowledgements

                          We thank Prof Chihiro Sasakawa of Institute of Medical Science University for providing 15 H. pylori strains of Tokyo. This work was supported by the fund of Chinese National Natural Science Foundation project (No. 31070445); Major State Basic Research Development Program of China (973 Program) (No. 2009CB522606).

                          Authors’ Affiliations

                          (1)
                          Department of Clinical Microbiology and Immunology, College of Medical Laboratory, Third Military Medical University
                          (2)
                          Department of Endocrinology, Southwest Hospital, Third Military Medical University
                          (3)
                          Department of clinical laboratory, 155 Central Hospital of PLA
                          (4)
                          Medical Research Center, Southwest Hospital, Third Military Medical University
                          (5)
                          Institute of Agriculture and Life Science, Chongqing University
                          (6)
                          Laboratory of Analytical Microbiology, State Key Laboratory of Pathogen and Biosecurity, Institute of Microbiology and Epidemiology
                          (7)
                          National Engineer Research Center for Immunization Products, Third Military Medical University

                          References

                          1. Ouakaa-Kchaou A, Elloumi H, Gargouri D, Kharrat J, Ghorbel A: Helicobacter pylori and gastric cancer. Tunis Med 2010,88(7):459–461.PubMed
                          2. Shin CM, Kim N, Yang HJ, Cho SI, Lee HS, Kim JS, Jung HC, Song IS: Stomach cancer risk in gastric cancer relatives: interaction between Helicobacter pylori infection and family history of gastric cancer for the risk of stomach cancer. J Clin Gastroenterol 2010,44(2):e34–39.PubMedView Article
                          3. Abdullah M, Ohtsuka H, Rani AA, Sato T, Syam AF, Fujino MA: Helicobacter pylori infection and gastropathy: A comparison between Indonesian and Japanese patients. World J Gastroentero 2009,15(39):4928–4931.View Article
                          4. Ernst PB, Peura DA, Crowe SE: The translation of Helicobacter pylori basic research to patient care. Gastroenterology 2006,130(1):188–206. quiz 212–183PubMedView Article
                          5. Ben-Darif E, De Pinna E, Threlfall EJ, Bolton FJ, Upton M, Fox AJ: Comparison of a semi-automated rep-PCR system and multilocus sequence typing for differentiation of Salmonella enterica isolates. J Microbiol Methods 2010,81(1):11–16.PubMedView Article
                          6. Do T, Gilbert SC, Clark D, Ali F, Fatturi Parolo CC, Maltz M, Russell RR, Holbrook P, Wade WG, Beighton D: Generation of diversity in Streptococcus mutans genes demonstrated by MLST. PLoS One 2010,5(2):e9073.PubMedView Article
                          7. de Haan CP, Kivisto RI, Hakkinen M, Corander J, Hanninen ML: Multilocus sequence types of Finnish bovine Campylobacter jejuni isolates and their attribution to human infections. BMC Microbiol 2010, 10:200.PubMedView Article
                          8. Olsen JS, Aarskaug T, Skogan G, Fykse EM, Ellingsen AB, Blatny JM: Evaluation of a highly discriminating multiplex multi-locus variable-number of tandem-repeats (MLVA) analysis for Vibrio cholerae. J Microbiol Methods 2009,78(3):271–285.PubMedView Article
                          9. Pourcel C, Andre-Mazeaud F, Neubauer H, Ramisse F, Vergnaud G: Tandem repeats analysis for the high resolution phylogenetic analysis of Yersinia pestis. BMC Microbiol 2004, 4:22.PubMedView Article
                          10. Smith KL, De Vos V, Bryden HB, Hugh-Jones ME, Klevytska A, Price LB, Keim P, Scholl DT: Meso-scale ecology of anthrax in southern Africa: a pilot study of diversity and clustering. J Appl Microbiol 1999,87(2):204–207.PubMedView Article
                          11. Swaminathan B, Gerner-Smidt P, Ng LK, Lukinmaa S, Kam KM, Rolando S, Gutierrez EP, Binsztein N: Building PulseNet International: an interconnected system of laboratory networks to facilitate timely public health recognition and response to foodborne disease outbreaks and emerging foodborne diseases. Foodborne Pathog Dis 2006,3(1):36–50.PubMedView Article
                          12. Her M, Kang SI, Cho DH, Cho YS, Hwang IY, Heo YR, Jung SC, Yoo HS: Application and evaluation of the MLVA typing assay for the Brucella abortus strains isolated in Korea. BMC Microbiol 2009, 9:230.PubMedView Article
                          13. Wang YW, Watanabe H, Phung DC, Tung SK, Lee YS, Terajima J, Liang SY, Chiou CS: Multilocus variable-number tandem repeat analysis for molecular typing and phylogenetic analysis of Shigella flexneri. BMC Microbiol 2009, 9:278.PubMedView Article
                          14. Zhang X, Hai R, Wei J, Cui Z, Zhang E, Song Z, Yu D: MLVA distribution characteristics of Yersinia pestis in China and the correlation analysis. BMC Microbiol 2009, 9:205.PubMedView Article
                          15. Beranek A, Mikula C, Rabold P, Arnhold D, Berghold C, Lederer I, Allerberger F, Kornschober C: Multiple-locus variable-number tandem repeat analysis for subtyping of Salmonella enterica subsp. enterica serovar Enteritidis. Int J Med Microbiol 2009,299(1):43–51.PubMedView Article
                          16. Ghebremichael S, Groenheit R, Pennhag A, Koivula T, Andersson E, Bruchfeld J, Hoffner S, Romanus V, Kallenius G: Drug resistant Mycobacterium tuberculosis of the Beijing genotype does not spread in Sweden. PLoS One 2010,5(5):e10893.PubMedView Article
                          17. Klevytska AM, Price LB, Schupp JM, Worsham PL, Wong J, Keim P: Identification and characterization of variable-number tandem repeats in the Yersinia pestis genome. J Clin Microbiol 2001,39(9):3179–3185.PubMedView Article
                          18. Schouls LM, Spalburg EC, van Luit M, Huijsdens XW, Pluister GN, van Santen-Verheuvel MG, van der Heide HG, Grundmann H, Heck ME, de Neeling AJ: Multiple-locus variable number tandem repeat analysis of Staphylococcus aureus: comparison with pulsed-field gel electrophoresis and spa-typing. PLoS One 2009,4(4):e5082.PubMedView Article
                          19. Falush D, Wirth T, Linz B, Pritchard JK, Stephens M, Kidd M, Blaser MJ, Graham DY, Vacher S, Perez-Perez GI, et al.: Traces of human migrations in Helicobacter pylori populations. Science 2003,299(5612):1582–1585.PubMedView Article
                          20. Linz B, Balloux F, Moodley Y, Manica A, Liu H, Roumagnac P, Falush D, Stamer C, Prugnolle F, van der Merwe SW, et al.: An African origin for the intimate association between humans and Helicobacter pylori. Nature 2007,445(7130):915–918.PubMedView Article
                          21. Hovey JG, Watson EL, Langford ML, Hildebrandt E, Bathala S, Bolland JR, Spadafora D, Mendz GL, McGee DJ: Genetic microheterogeneity and phenotypic variation of Helicobacter pylori arginase in clinical isolates. Bmc Microbiology 2007., 7:
                          22. Suerbaum S, Kraft C, Dewhirst FE, Fox JG: Helicobacter nemestrinae ATCC 49396T is a strain of Helicobacter pylori (Marshall et al. 1985) Goodwin et al. 1989, and Helicobacter nemestrinae Bronsdon et al. 1991 is therefore a junior heterotypic synonym of Helicobacter pylori. Int J Syst Evol Microbiol 2002,52(Pt 2):437–439.PubMed
                          23. Hidalgo A, Carvajal A, La T, Naharro G, Rubio P, Phillips ND, Hampson DJ: Multiple-locus variable-number tandem-repeat analysis of the swine dysentery pathogen, Brachyspira hyodysenteriae. J Clin Microbiol 2010,48(8):2859–2865.PubMedView Article
                          24. Litrup E, Christensen H, Nordentoft S, Nielsen EM, Davies RH, Helmuth R, Bisgaard M: Use of multiple-locus variable-number tandem-repeats analysis (MLVA) typing to characterize Salmonella Typhimurium DT41 broiler breeder infections. J Appl Microbiol 2010.
                          25. Weniger T, Krawczyk J, Supply P, Niemann S, Harmsen D: MIRU-VNTRplus: a web tool for polyphasic genotyping of Mycobacterium tuberculosis complex bacteria. Nucleic Acids Res 2010,38(Suppl):W326–331.PubMedView Article
                          26. Li Y, Cui Y, Hauck Y, Platonov ME, Dai E, Song Y, Guo Z, Pourcel C, Dentovskaya SV, Anisimov AP, et al.: Genotyping and phylogenetic analysis of Yersinia pestis by MLVA: insights into the worldwide expansion of Central Asia plague foci. PLoS One 2009,4(6):e6000.PubMedView Article
                          27. Hunter PR, Gaston MA: Numerical index of the discriminatory ability of typing systems: an application of Simpson's index of diversity. J Clin Microbiol 1988,26(11):2465–2466.PubMed

                          Copyright

                          © Guo et al; licensee BioMed Central Ltd. 2011

                          This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                          Advertisement