Skip to main content
Download PDF

Microbial and transcriptional response of Acropora valida and Turbinaria peltata to Vibrio coralliilyticus challenge: insights into corals disease resistance

BMC Microbiology volume 24, Article number: 288 (2024) Cite this article

Abstract

Background

Coral diseases are significant drivers of global coral reef degradation, with pathogens dominated by Vibrio coralliilyticus playing a prominent role in the development of coral diseases. Coral phenotype, symbiotic microbial communities, and host transcriptional regulation have been well-established as factors involved in determining coral disease resistance, but the underlying mechanisms remain incompletely understood.

Methods

This study employs high-throughput sequencing to analyse the symbiotic microbial and transcriptional response of the hosts in order to evaluate the disease resistance of Acropora valida and Turbinaria peltata exposed to Vibrio coralliilyticus.

Results

A. valida exhibited pronounced bleaching and tissue loss within 7 h of pathogen infection, whereas T. peltata showed no signs of disease throughout the experiment. Microbial diversity analyses revealed that T. peltata had a more flexible microbial community and a higher relative abundance of potential beneficial bacteria compared to A. valida. Although Vibrio inoculation resulted in a more significant decrease in the Symbiodiniaceae density of A. valida compared to that of T. peltata, it did not lead to recombination of the coral host and Symbiodiniaceae in either coral species. RNA-seq analysis revealed that the interspecific differences in the transcriptional regulation of hosts after Vibrio inoculation. Differentially expressed genes in A. valida were mainly enriched in the pathways associated with energy supply and immune response, such as G protein-coupled receptor signaling, toll-like receptor signaling, regulation of TOR signaling, while these genes in T. peltata were mainly involved in the pathway related to immune homeostasis and ion transport, such as JAK-STAT signaling pathway and regulation of ion transport.

Conclusions

Pathogenic challenges elicit different microbial and transcriptional shifts across coral species. This study offers novel insights into molecular mechanisms of coral resistance to disease.

Peer Review reports

Background

Coral reefs are essential constituents of marine ecosystems with high biodiversity and primary productivity, however, they confront numerous survival pressures [1]. Coral diseases have emerged as a pivotal driver of global coral reef degradation [2], which have caused large-scale and severe degradation of many coral reefs [3]. The threat of disease-induced extinction looms over numerous coral species [4]. Over the last three decades, coral reefs worldwide have experienced a substantial decline of approximately 30% due to new coral diseases, which is anticipated to intensify with ongoing deterioration of the marine environment [5]. Bacterial pathogens, especially Vibrio-related members, significantly contribute to a diverse spectrum of coral diseases [6], encompassing white band disease, yellow band disease, white syndrome, etc. [7]. V. coralliilyticus was initially identified in diseased and bleached Pocillopora damicornis in the Indian Ocean, which has the potential to induce disease in various corals, such as P. damicornis [8], Montipora capitata [9], and soft corals [8]. Moreover, it has been linked to outbreaks of white syndrome in several coral reef [10]. Vibrio targets the host through signaling compounds, such as dimethylsulfoniopropionate (DMSP) released by the host, subsequently disrupts the symbiotic relationship between the host and Symbiodiniaceae, resulting in a substantial loss of Symbiodiniaceae over a short time [7]. Additionally, V. coralliilyticus produces zinc-metalloprotease, which contributes to coral tissue lesions and coral bleaching. The pathogenesis and genetic information of V. coralliilyticus have been elucidated [8], establishing it as a model pathogen of coral diseases research. Nevertheless, it is important to note that interspecific variations in disease resistance exist among diverse coral species. Generally, corals with faster growth rates and thinner tissues seem more susceptible [11]. Previous studies have frequently reported the susceptibility of branching corals such as Pocillopora, Acropora, and Montipora to pathogenic Vibrio, whereas this characteristic has rarely been reported in massive corals such as Favites and Turbinaria [7, 12, 13]. The pathogen of white band disease is considered to be exclusively pathogenic for Acropora [14], while white plague disease type II can affect dozens of coral species [15]. Furthermore, Montastraea cavernosa, Porites porites, and Porites astreoides have generally exhibit high disease resistance to white plague, but their resistance did not seem to be effective against stony coral tissue loss disease [16]. While interspecific differences in disease susceptibility among corals have been mentioned in numerous studies, the mechanism underlying interspecific differences in coral disease resistance remains unclear.

The coral holobiont constitutes a complex and diverse system wherein homeostasis is preserved through the collaboration of the host and its associated symbiotic microorganisms, encompassing Symbiodiniaceae, bacteria, fungi, archaea, endophytic algae, protists and viruses. Collectively, they establish a stable mutualistic symbiotic relationship and facilitate crucial material cycle processes, thereby providing a standfast foundation for the homeostasis and vitality of coral holobiont [1, 17]. Furthermore, specific symbiotic bacteria act as natural protective barrier by synthesizing antimicrobial agents [17,18,19]. Therefore, the equilibrium of microbial communities emerges as pivotal for the homeostasis and functional integrity of coral holobiont. Nevertheless, coral symbiotic microbial communities are highly sensitive to environmental changes, especially disease and potential pathogens. A considerable number of studies have reported the community dynamics exposed to the disease stress [20,21,22,23,24,25], but the differential patterns of community variation have gradually attracted attention recently. Certain studies identify an increase in bacterial α-diversity as a result of disease stress [20, 24, 25], while the opposite pattern of change in α-diversity has been found in other studies [22, 23], and the differential pattern of change in β-diversity was also observed [23, 26]. It has been hypothesized that microbial community stability could confer greater resistance to environmental challenges [27, 28], but recent research has found that corals that exhibit strong bacterial community dynamics appear to possess higher disease resistance [29]. According to the Coral Probiotic Hypothesis [30], such dynamics may empower corals to selectively shape microbial community assemblages that favour the coral holobiont in various environmental conditions, thus enhance the resilience and adaptability [5]. While dissecting the details of coral disease resistance through the dynamics of bacterial communities is essential, it is not sufficient to explain the underlying mechanisms of coral disease resistance, as Symbiodiniaceae with high abundance and diversity inhabit in the holobiont, which drive the energy transfer of the holobiont [17]. Although the association between the availability of organic nutrients and holobiont resistance and resilience has been emphasized [31, 32], little attention has been focused on the association between the Symbiodiniaceae dynamics and host disease resistance. We propose that different symbiotic microorganisms play different roles in holobiont responses to disease stress, and that exploring their dynamics could enrich our understanding of coral disease resistance.

Coral innate immune process involves the recognition of pathogens through mannose-binding lectin, toll-like receptors, and the elimination of pathogens through the complement system, apoptosis, and autophagy [33]. Research on corals exposed to lipopolysaccharides revealed that disease-susceptible corals demonstrated a more pronounced up-regulation of apoptosis, while disease-resistant corals uniquely activated autophagy [34]. Additionally, transcriptomic studies have identified the primary pathways associated with innate immunity in corals, encompassing cellular immunity, the prophenoloxidase-activated melanization response, and basic oxidative pathways [35]. It was observed that V. coralliilyticus stimulates the immune response of corals at ambient temperature (25℃), leading to the up-regulation of genes related to prophenoloxidase activating enzyme and laccase [35]. However, at high temperature (26–32℃), V. coralliilyticus infection significant suppressed host immune activity due to the temperature dependence of V. coralliilyticus, leading a significant down-regulation of immune-related genes such P-selection-like protein and antimicrobial peptide gene [36, 37]. Despite the distinct roles played by the coral symbiotic microbes and host innate immunity in shaping coral disease resistance, there is limited knowledge concerning the interconnections among microbial taxa and between microbes and hosts under disease challenges.

Acropora valida and Turbinaria peltata are two morphologically distinct species of reef-building corals that are widespread in tropical and subtropical seas of the Indo-Pacific Ocean [38]. They are the dominant species of coral reefs-building corals in coral communities of Weizhou Island in Beibu Gulf, South China Sea [39, 40]. While prior research has indicated that massive corals demonstrate greater adaptability or resistance to environmental changes compared to branching corals, it is more compelling to investigate the mechanisms underlying differences in coral disease resistance or tolerance from the standpoint of the coral holobiont. This study utilized A. valida and T. peltata to conduct research on the stress response to V. coralliilyticus. The phenotypic, microbiome and transcriptional response of A. valida and T. peltata under V. coralliilyticus stress were investigated using high-throughput sequencing of 16S rRNA gene, ITS sequencing and RNA-seq to elucidate the mechanisms underlying interspecific differences in disease resistance. Our study provides novel insights into the coral disease resistance and establishes a theoretical foundation for tackling the crisis of global coral reef degradation.

Methods

Coral samples collection

A. valida and T. peltata in good growth conditions were collected from coral communities in Weizhou Island (Guangxi, China) in September 2021. Divers utilized hammers to knock out original coral samples from healthy coral communities. The specimens were expeditiously stored in sample bags containing seawater from the sampling site and promptly transported to Guangxi Laboratory on the Study of Coral Reef in the South China Sea. The raw coral specimens were accurately sectioned into pieces of approximately 4 cm in length and width and placed in experimental tanks under similar conditions for a recovery period of 14 days.

V. coralliilyticus challenge experiment

V. coralliilyticus was cultured in MA medium (MacConkey agar medium) at 29℃ and 160 rpm for 24 h. The concentration of V. coralliilyticus was determined according to the methodology outlined by Okwadha [41]. V. coralliilyticus was collected by centrifugation at 8000 g and resuspended twice in 0.22 μm-filtered sterile seawater to remove residual medium. We used 12 tanks containing 1000 mL of fresh seawater as inoculation pools, each with one coral sample. Experimental and control groups were set up for each coral species, with each group consisting of three biological replicates. The experimental groups (AVE for A. valida and TPE for T. peltata) were inoculated with V. coralliilyticus at a final concentration of 1 × 105 CFU mL−1 (Colony forming unit per mL), while the control groups (AVC for A. valida and TPC for T. peltata) received an equivalent volume of 0.22 μm-filtered sterile seawater. The inoculation procedure in present study followed the method described by Rosado et al. [42]. Corals were removed from the tanks, placed on sterile petri dishes and inoculated with prepared V. coralliilyticus liquid or an equal volume of 0.22μm-filtered sterile seawater using a pipette gun according to the groups. This process required repeated infiltration of the corals with the pipette gun, and the pipette tip was changed between corals for each inoculation. The inoculation process was maintained for 10 min, and corals were placed back into the tanks after inoculation. The temperature was set to 29 ± 0.5°C, and the water quality conditions were consistent throughout the entire experimental period, with salinity maintained at 34‰, KH at 7.2, pH at 8.1, Ca2+ at around 420 ppm, Mg2+ at around 1290 ppm, PO43− at less than 0.03 ppm, NH3+ at less than 0.15 ppm, and NO3− at approximately 0 ppm. Salinity was measured using a salinometer (Ousu, Hebei, China), and the remaining indicators were measured using the water test kit (Salifert, Netherlands) in accordance with their instructions. Maximum quantum yield (Fv/Fm) of corals were measured using pulse-amplitude-modulated (PAM) (Walz GmbH, Effeltrich, Germany) according to the method of described by Rosado et al. [42]. This procedure was performed after dark adaption about 40 min each day. 20% of the tank seawater was replaced daily with fresh seawater. Phenotypic responses were systematically recorded post-inoculation, and samples were collected for data analysis upon the manifestation of notable polyp retraction and tissue lesions in corals. Coral tissues underwent thorough rinsing and collection with 0.22 μm-filtered sterile seawater. The enumeration of Symbiodiniaceae was conducted under a microscope. The coral surface area was determined using the aluminum foil method [43], thereby enabling the calculation of Symbiodiniaceae density. Subsequently, the coral specimens were meticulously preserved in liquid nitrogen for the extraction of DNA and RNA.

DNA extraction, amplification and sequencing of 16S rRNA gene and ITS

Total DNA was extracted using Magnetic Soil and Stool DNA Kit (Tiangen Biotech Co., Ltd., Beijing, China). PCR amplification of the V3-V4 variable region of bacterial 16S rRNA was performed using primer 338F (5'-ACTCCTACGGGAGGCAGCA-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') [44]. The ITS region of the fungus was amplified using primers ITS2F (5'-GCATCGATGAAGAACGCAGC-3') and ITS2R (5'-TCCTCCGCTTATTGATATGC-3') [45]. The 16S rRNA amplification procedure involved denaturation at 95°C for 5 min, annealing at 55°C for 30 s, extension at 72°C for 40 s, final extension at 72℃ for 7 min in a cyclic fashion over 25 cycles, followed by storage at 4°C. Following amplification, purification of the product was performed using the Monarch DNA Gel Extraction Kit (Hongyue Innovation Technology Co., Ltd, Beijing, China) and quantification with Qsep-400.

Illumina NovaSeq platform (novaseq6000, Illumina, San Diego, USA) was employed for sequencing the purified amplicons at the BioMarker Technology Co. Ltd. (Beijing, China). Raw reads were filtered using Trimmonatic (Version 1.2.11) [46], and primer sequences were identified and removed using Cutadapt (Version 1.9.1) [47] to obtain high-quality reads. FLASH (Version 1.2.7) [48] was employed to merge them, yielding clean reads devoid of primer sequences. Finally, UCHIME ( Version 4.2) [49] was utilized to identify and remove chimeric sequences to obtain final effective reads.

Diversity analysis of bacteria, fungi and Symbiodiniaceae

Sequences were clustered using USEARCH (Version 10.0) [50] with a similarity threshold set at 97%, and filtered at a threshold of 0.005% to derive operational taxonomic units (OTUs) [51]. Silva (Release128, http://www.arb-silva.de) [52] and Unite (Release7.2, http://unite.ut.ee/index.php) [53] were utilized for aligning and annotating bacterial and fungal sequences, respectively. QIIME2 (Version 2020.6) [54] was employed for conducting α-diversity analysis of microbial communities. The Chao 1 index quantified bacterial and fungal communities richness, while the Shannon index measured community diversity, with higher values indicating greater community richness and diversity, respectively. QIIME was utilized for the β-diversity of bacterial and fungal communities. Principal co-ordinates analysis (PCoA, based on Bray–Curtis) was utilized to visualize the microbial communities β-diversity, while permutational multivariate analysis of variance (PERMANOVA) was employed to test the significance of differences between groups. Line discriminant analysis (LDA) Effect Size (LEfSe) [55] was applied to identify species with significant intergroup differences. The difference threshold was set at LDA = 3.5, and the larger the LDA indicated that the taxon contributed more significantly to the intergroup differences. We screened for OTUs present in over 80% of the samples as core bacterial microbiome to determine changes in the coral microbial community.

DADA2 was utilized to obtain the amplicon sequence variants (ASVs) from reads processed by QIIME2 (Version 2020.6) [54]. The filtering threshold was set at 0.005%. Subsequently, ASVs sequences were aligned with the ITS2 database using BLASTN [56, 57] to determine the types and composition of the Symbiodiniaceae subclades.

RNA-seq analyses

Total RNA of coral samples was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA). Quantification and quality control of the extracted RNA were conducted using the Nanodrop 2000 (Thermo Scientific) and agent 2100, LabChip GX (Agilent Technologies). Subsequently, the qualified RNA was used to prepare the transcriptome library. The adapter sequences for the primer were as follows: adapter3 = AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC; adapter5 = AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT. The quality of the obtained library was assessed using Agilent Bioanalyzer 2100. The library was sequenced using Illumina Novasaq 6000 to obtain paired-end reads.

Trinity [58] was employed to assemble the clean data to generate the unigene library of this species. DIAMOND [59] was utilized to compare unigene sequences with six databases, including non-redundant protein sequence database (NR), Swiss-Prot, clusterof orthologous group (COG), clusters of orthologous groups from 66 complete genomes (KOG), evolutionary genealogy of genes: non-supervised orthologous groups (eggNOG4.5), kyoto encyclopedia of genes and genomes (KEGG). Gene expression analysis was conducted using RSEM [60], and FPKM [61] was utilized to represent the expression abundance of the corresponding unigene. DESeq2 [62] was employed for identifying differentially expressed genes (DEGs) with a fold change ≥ 2 and a false discovery rate (FDR) < 0.01). Using "experimental group vs control group" to name differentially expressed gene sets such as AVE vs AVC. The DEGs was subjected to GO enrichment analysis using the topGO R package based on the Kolmogorov-Smirnova test method, with a focus on the biological process.

Statistical analysis

The data in this study are expressed as mean ± standard deviation. The significance of the difference between two groups of data was tested using Student's t-test and Wilcoxon rank-sum test. The significance of the difference between the data between multiple groups was tested using analysis of variance (ANOVA) for parametric and Kruskal–Wallis rank-sum test for non-parametric testing. P < 0.05 indicates significant difference between data.

Results

Phenotypic response of corals to the V. coralliilyticus stress

A. valida exhibited significant lesion symptoms approximately 7 h after Vibrio inoculation, with sever polyp retraction, bleaching and tissue loss. In contrast, T. peltata did not exhibit lesions throughout the experiment, with normal polyp activity and no tissue lesions or bleaching (Fig. 1A). Additionally, the Fv/Fm results indicated a significant reduction in the photosynthetic efficiency of A. valida following Vibrio inoculation (Student's t-test, p = 0.002), while the photosynthesis of T. peltata was not significantly affected (Student's t-test, p = 0.882), consistent with the observed phenotypic response (Table S1). The differential response suggests that T. peltata may exhibit greater disease resistance compared to A. valida.

Fig. 1
figure 1

Phenotypic variation, α-diversity and β-diversity of symbiotic bacterial communities and composition of dominant bacterial taxa in corals. A Phenotypic variation charts of the experimental group and the control group of corals. B Chao1 index box plots of symbiotic bacterial communities in four groups of corals. C Shannon index box plots of symbiotic bacterial communities in four groups of corals. D PCoA plots of symbiotic bacterial communities in four groups of corals. E The composition and RA changes of dominant bacterial taxa in four groups of corals at the phylum level. F The composition and RA changes of dominant bacterial taxa in four groups of corals at the family level

Full size image

Response of bacteria in corals to the V. coralliilyticus stress

A total of 1902 OTUs were obtained after clustering, 1618 OTUs for A. valida and 1852 OTUs for T. peltata (Table S2). α-diversity analyses indicated that A. valida exhibited higher bacterial α-diversity compared to T. peltata (AVC: TPC, Student's t-test, p = 0.022; AVE: TPE, Student's t-test, p = 0.001) (Fig. 1B and C; Table S2), highlighting the interspecific differences in the α-diversity of the bacterial communities between the coral species. Throughout the Vibrio stress, neither the Chao 1 index nor Shannon index of A. valida changed significantly, indicating that bacterial richness and diversity were not significantly affected (Chao1, Student's t-test, p = 0.463; Shannon, Student's t-test, p = 0.590). Simultaneously, there was a non-significant decrease in the Chao1 index of T. peltata (Student's t-test, p = 0.513), while the Shannon index exhibited a significant reduction, indicating a significant decrease in bacterial diversity in T. peltata (Student's t-test, p = 0.033). These results suggest that Vibrio inoculation exerted a more substantial effect on the α-diversity of the bacterial community in T. peltata.

PCoA revealed statistically significant differences in microbial β-diversity among the four groups (PERMANOVA, R2 = 0.759, p = 0.001) (Fig. 1D). Vibrio stress did not have a significant impact on the microbial community structure of A. valida (PERMANOVA, R2 = 0.283, p = 0.2), but it resulted in greater similarity in community structure across samples within the AVE compared to AVC (Fig. S1A). For T. peltata, PCoA demonstrated that Vibrio inoculation significantly affected the bacterial community, leading to notable differences between TPC and TPE (PERMANOVA, R2 = 0.274, p = 0.001) (Fig. S1B). These results suggest that the bacterial community of T. peltata exhibits a more significant and flexible response to Vibrio stress compared to A. valida.

A total of 30 phyla and 332 families of bacteria were identified in the 12 samples (Table S3). At the phylum level, the predominant bacterial phyla Firmicutes and Proteobacteria exhibited the highest relative abundance (RA) in A. valida and T. peltata, respectively (Fig. 1E; Table S4). Vibrio inoculation resulted in a significant increase in the RA of Bacteroidetes, Actinobacteria, and Verrucomicrobia in A. valida (Student's t-test, p = 0.028, 0.03, and 0.001, respectively), while the RA of Firmicutes, Proteobacteria, and Cyanobacteria decreased (Student's t-test, p = 0.113, 0.143, and 0.944, respectively) (Fig. 1E; Table S4). However, Vibrio inoculation resulted in an increase in Proteobacteria, Firmicutes, Acidobacteria, Epsilonbacteraeota, and Verrucomicrobia in T. peltata (Student's t-test, p = 0.076, 0.726, 0.786, 0.160, and 0.538, respectively), while a significant decrease in Bacteroidetes (Student's t-test, p = 0.004) (Fig. 1E; Table S4).

Differences in the composition of the dominant bacterial taxa of the two coral species were more pronounced at the family level compare to phylum level. The predominant bacterial families in A. valida mainly included Lachnospiraceae, Lactobacillaceae, Ruminococcaceae, and Muribaculaceae, with Lachnospiraceae having the highest RA, Vibrio inoculation resulted a significantly increase in the RA of Akkermansiaceae and Muribaculaceae (Student's t-test, p = 0.003 and p = 0.008, respectively) (Fig. 1F; Table S5). The predominant bacterial families in T. peltata include Rhodobacteraceae, Enterobacteriaceae, Vibrionaceae and Flavobacteriaceae, with Rhodobacteraceae exhibiting the highest RA (Fig. 1F; Table S5). Vibrio inoculation resulted in a significant decrease in the RA of Flavobacteriaceae (Student's t-test, p = 0.021) and an increase in Vibrionaceae, Rhodobacteraceae, Pseudoalteromonadaceae, and Ruegeria (Student's t-test, p = 0.349, 0.159, 0.298, and 0.464, respectively) (Fig. 2A, B, C and D; Table S5).

Fig. 2
figure 2

RA of associated bacterial taxa and composition of core bacterial microbiome in four groups of corals. A RA variation of Flavobacteriaceae in four groups of corals. B RA variation of Vibronaceae in four groups of corals. C RA variation of Rhodobacteraceae in four groups of corals. D RA variation of Ruegeria in four groups of corals. E Statistical charts of RA for core bacterial microbiome in four groups of corals

Full size image

The RA of Lachnospiraceae in A. valida was significantly higher than that in T. peltata (AVC: TPC, Student's t-test, p = 0.001; AVE: TPE, Student's t-test, p = 1.20E-5), whereas Rhodobacteraceae, Flavobacteriaceae, and Vibrionaceae exhibited significantly lower levels than that in T. peltata (AVC: TPC, Student's t-test, p = 0.003, 0.006, and 0.063, respectively; AVE: TPE, Student's t-test, p = 0.002, 5.90E-5, and 0.250, respectively) (Table S6). Additionally, at the genus level, the RA of Ruegeria was significantly higher in T. peltata compared to A. valida (AVC: TPC, Student's t-test, p = 0.027; AVE: TPE, Student's t-test, p = 0.033) (Fig. 2D). The high RA of Proteobacteria-related members (e.g., Rhodobacteraceae and Flavobacteriaceae) in T. peltata constitutes a notable feature of the bacterial community of this species (Fig. 1E and F). Notably, while the dominant bacterial phyla composition was consistent in both coral species, Proteobacteria were significantly more dominant in T. peltata than in A. valida, and thus the dominance of the dominant bacterial taxa appeared to be more homogeneous in A. valida compared to T. peltata (Fig. 1E; Table S7). This pattern was particularly pronounced at the family level (Fig. 1F; Table S6), where family Rhodobacteraceae within the phylum Proteobacteria significantly contributed to the homogeneity of T. peltata communities. Furthermore, the homogeneity of the community structure was further exacerbated by the significant increase in RA of taxa such as Rhodobacteraceae as well as Vibrionaceae under Vibrio stress.

The proportion of the core bacterial microbiome in AVC and AVE was 83.74% and 82.54%, respectively, which were significantly higher than 57.61% and 56.01% in TPC and TPE, respectively (Fig. 2E). It is worth mentioning that Vibrio inoculation resulted in more significant changes in the composition of core bacteria in T. peltata compared to A. valida (Fig. 2E). These results indicate that the bacterial community of T. peltata demonstrates greater flexibility and inclusivity compared to that of A. valida.

LEfSe (LDA = 3.5) revealed that the related members of Gammaproteobacteria, Enterobacteriaceae, and Bacilli were significantly enriched in AVC, while the related members of Bacteroidia, Akkermansiaceae, Actinobacteria, Verrucomicrobia, and Muribaculaceae were significantly enriched in AVE (Fig. 3; Table S8). In T. peltata, LEfSe revealed that the related members of Bacteroidetes (Bacteroidia), Flavobacteriaceae, Oscillatoria-coralinae, and Nostocales-Incertae were significantly enriched in the TPC, while the related members of Proteobacteria, Aliterella_CENA595, Massiliprevotella-massiliensis and Pseudoalteromonadaceae were significantly enriched in the TPE (Fig. 3; Table S9).

Fig. 3
figure 3

Cladogram of bacterial taxa significantly enriched in four groups of corals identified by LEfSe

Full size image

Response of fungus in corals to the V. coralliilyticus stress

A total of 202 and 213 OTUs were obtained for the A. valida and T. peltata, respectively (Table S10). The Chao1 index and Shannon index of the fungal communities in A. valida and T. peltata exhibited no significant change under Vibrio stress (AVC; AVE, Chao1, Student's t-test, p = 0.427; AVC; AVE, Shannon, Student's t-test, p = 0.176; TPC: TPE, Chao1, Student's t-test, p = 0.182; TPC: TPE, Shannon, Student's t-test, p = 0.315) (Fig. S2A and B; Table S10), suggesting that A. valida and T. peltata maintained the relative stability of fungal communities richness and diversity under Vibrio stress. PCoA revealed significant intergroup differences in the fungal communities of corals (PERMANOVA, R2 = 0.84, p = 0.001) (Fig. S2C), Vibrio inoculation significantly increase the heterogeneity of the fungal community in A. valida but did not affect the fungal communities in T. peltata (PERMANOVA, R2 = 0.193, p = 0.401) (Fig. S1C and D). A total of 6 phyla and 11 families were identified in A. valida and T. peltata (Table S11), these taxa exhibited similar RA across the four groups, suggesting that Vibrio inoculation did not result in significant changes in the RA of dominant fungi taxa (Figure S3A and B; Table S12 and S13). These results indicated that the diversity and composition of the fungal communities in both A. valida and T. peltata were not significantly affected by Vibrio.

Response of Symbiodiniaceae in corals to the V. coralliilyticus stress

Interspecific differences in Symbiodiniaceae density were detected between A. valida and T. peltata. Symbiodiniaceae density was significantly higher in A. valida than in T. peltata in the control groups (Student’s t-test, p = 3.5508E-7), with 1.01 ± 0.0014 × 106 cells cm−2and 2.53 ± 1.59 × 104 cells cm−2, respectively. Additionally, the variation of Symbiodiniaceae density in A. valida and T. peltata exhibited interspecific differences under Vibrio stress, with a significant decrease in A. valida to 3.24 ± 1.78 × 104 cells cm−2 (Student’s t-test, p = 4.7433E-7) and T. peltata decreased slightly to 6.47 ± 0.83 × 103 cells cm−2 (Student’s t-test, p = 0.170) (Fig. 4A; Table S14).

Fig. 4
figure 4

Variations in symbiotic Symbiodiniaceae density, subclade composition, and RA in four groups of corals.A Statistical chart of symbiotic Symbiodiniaceae density in four groups of corals. B Composition and RA statistical chart of Symbiodiniaceae subclades in four groups of corals

Full size image

Interspecific differences were observed in the compositional diversity of Symbiodiniaceae between A. valida and T. peltata. At the clade level, A. valida only contained Cladocopium, whereas T. peltata contained Cladocopium, Breviolum, and Symbiodinium (Table S15). At the subclade level, C1 exhibited the highest RA in A. valida and T. peltata, followed by C1p. The subclades C#, Cspc, C44, and C1m.type2 were exclusively observed in A. valida, whereas B1, C1a, C1f, C1.v1b, C41, C1.v1a, and A6 were present only in T. peltata (Fig. 4B; Table S15). Notably, the RA of the C1 in A. valida was significantly higher than that in T. peltata (AVC: TPC, Student's t-test, p = 2.25E-4; AVE: TPE, Student's t-test, p = 0.001), whereas the RA of the C1p in T. peltata was significantly higher than that in A. valida (AVC: TPC, Student's t-test, p = 2.00E-4; AVE: TPE, Student's t-test, p = 0.001) (Fig. S4A).

Vibrio inoculation resulted in a significant decrease in the RA of subclade Cspc (Student's t-test, p = 9.3924E-7), accompanied by a significant increase in subclades C1, C1j and C42.type1 in A. valida (Student's t-test, p = 0.007, 0.002, and 0.037, respectively). Notably, C1m.type2 disappears following Vibrio stress (Figure S4B; Table S15). However, for T. peltata, Vibrio inoculation did not cause significant changes in the composition and RA of subclades. It is noteworthy that the subclades C1a and A6 disappearing following Vibrio stress. Additionally, C18, C1ca, C36, and C15 were exclusively present in the TPE (Figure S4C; Table S15). These results suggest that Vibrio stress did not induce a significant reshuffle of the Symbiodiniaceae communities, but it resulted in a decrease in Symbiodiniaceae density.

Transcriptional response of coral hosts to the V. coralliilyticus stress

A total of 70,539 unigenes were obtained, constituting approximately 70.5% of the total unigenes (Table S16). A total of 8788 up-regulated genes and 3456 down-regulated genes were identified in A. valida (Fig. 5A; Table S17). A total of 763 up-regulated genes and 173 down-regulated genes were identified in T. peltata (Fig. 5B; Table S17). GO enrichment analyses revealed the differentially up-regulated genes in A. valida were mainly predominantly enriched in the pathways related to energy metabolism and cell differentiation, such as G protein-coupled receptor signaling pathway (GO: 0007186) and hypothalamus cell differentiation (GO: 0021979). Additionally, the differentially up-regulated genes showed a high level of enrichment in immune-related pathway and cell differentiation-related pathways, notably the toll-like receptor signaling pathway (GO: 0002224) and negative regulation of cell differentiation (GO: 0045596) (Fig. 5C; Table 1, Table S18). The differentially down-regulated genes were mainly enriched in the GO terms include DNA integration (GO: 0015074), DNA recombination (GO: 0006310), positive regulation of TOR signaling (GO: 0032008), which are associated with gene expression and immunomodulation. Additionally, certain differentially down-regulated genes were enriched in nitrogen-related cyclic metabolic pathways such as response to amine (GO: 0014075), nitrogen cycle metabolic process (GO: 0071941), urea metabolic process (GO: 0019627) (Fig. 5D; Table 1, Table S18). These results suggest that A. valida responds to Vibrio stress through the up-regulation of energy metabolism and innate immunity, while Vibrio stress inhibits processes such as gene expression and cell regeneration.

Fig. 5
figure 5

Differentially expressed genes and GO terms in A. valida and T. peltata. A Volcano plot of differentially expressed genes in A. valida after Vibrio stress. B Volcano plot of differentially expressed genes in T. peltata after Vibrio stress. C Enriched GO terms for differentially up-regulated genes in A. valida. D Enriched GO terms for differentially down-regulated genes in A. valida. E Enriched GO terms for differentially up-regulated genes in T. peltata. F Enriched GO terms for differentially down-regulated genes in T. peltata

Full size image
Table 1 Certain enrichment pathways of DEGs in A. valida and T. peltata
Full size table

The differentially up-regulated genes in T. peltata were predominantly enriched in the pathway related to immune regulation and energy metabolism, including negative regulation of receptor signaling pathway via JAK-STAT (GO: 0046426), polysaccharide catabolic process (GO: 0000272), negative regulation of membrane protein ectodomain proteolysis (GO: 0051045), cellular response to potassium ion (GO: 0035865), and D-amino acid metabolic process (GO: 0046416) (Fig. 5E; Table 1, Table S19). The differentially down-regulated genes of T. peltata were significantly enriched in the pathway related to ion transport, encompassing regulation of ion transport (GO: 0043269), positive regulation of ion transport (GO: 0043270), anion homeostasis (GO: 0055081), and positive regulation of cellular component organization (GO: 0051130), with the enrichment of regulation of ion transport being the most significant (Fig. 5F; Table 1, Table S19). These results suggest that while T. peltata up-regulated the regulation of immune activity, cellular processes such as ion transport are inhibited.

Discussion

The flexibility of bacterial community and potential beneficial bacteria confer higher disease resistance

Coral symbiotic bacteria play a pivotal role in maintaining host health [63] and are influenced by environmental fluctuations [23]. In this study, A. valida harbored higher bacterial α-diversity and exhibited no significant change under Vibrio stress, whereas bacteria in T. peltata displayed greater flexibility. This is similar to the findings of Tracy et al. [64], who fund that coral bleaching was not necessarily accompanied by changes in α-diversity. Differential variation in α-diversity has been documented in previous studies. It has been shown that bacterial α-diversity decreases under environmental stresses such as tourist activities, high temperatures, and ocean acidification [23, 64,65,66,67]. Bacterial communities respond to environmental stresses through dynamics, with bacterial diversity and flexibility serving as a mechanism to buffer the effects of environmental stresses by ensuring complementarity and redundancy of community functions [23]. The reduction in bacterial diversity may represent a strategy employed by communities for mitigating environmental impact. Conversely, infection by pathogen has been recognized as a factor contributing to an increase in bacterial diversity in some studies [20, 24, 25]. Coral symbiotic bacterial communities exhibit characteristics of open systems, wherein the augmentation of bacterial diversity can be ascribed to the host's diminished capacity to regulate the microbial community. Consequently, certain opportunistic bacteria or pathogens may colonize and propagate within the community [5, 63]. Variability of bacterial diversity strongly depends on the underlying community composition of different coral species [68], changes in bacterial diversity may be the result of a combination of coral host, location, and stressors [30]. The differential response of A. valida and T. peltata to Vibrio stress may be closely linked to the inherent composition of the coral symbiotic bacteria. The decrease of bacterial α-diversity in T. peltata suggests that its symbiotic bacterial community can respond rapidly to Vibrio inoculation, which may represent a process of buffering Vibrio stress, whereas bacterial community of A. valida responds with a hysteresis, suggesting that the bacterial community in T. peltata exhibits a more flexibility compared to that of A. valida.

β-diversity analyses revealed that Vibrio stress induced a shift in the structure of coral symbiotic bacterial communities, transitioning from a state of higher heterogeneity to relative homogeneity in composition and comparable structural patterns. This is consistent with two recent studies, both of which found increased bacterial community similarity in diseased corals compared to their healthy counterparts [26, 69]. Although certain studies have suggested that environmental stresses may result in heightened heterogeneity and subsequently increased β-diversity in bacterial communities [19, 67], this could signify a down-regulation of the host's regulatory capacity and the disruption of microbial community homeostasis [63]. Changes in the structure of the microbial community may serve as an adaptive response for corals in the face of a fluctuating environment. The observed homogenization of community under the disease stress suggests the prevalence of influential factors, such as pathogens, opportunistic organisms, or coral probiotics [70]. Bacterial communities categorized as healthy or pathogenic exhibit two distinct yet highly competitive community structures. Specific microorganisms effectively resist competitive pressures, resulting in more homogeneous microbial communities [26]. The homogenization of microbial communities may arise from self-regulation. Therefore, T. peltata exhibited more pronounced changes in community structure compared to A. valida, indicating a more positive response to pathogen stress, which could contribute to swift response and defense against pathogens.

A. valida and T. peltata maintained a consistently stable composition and ratios within the core bacterial microbiome. Approximately 50% of non-core bacterial microbiome (Sporadic symbionts) was present in T. peltata. While certain studies have proposed that sporadic symbionts may arise from environmental stochastic event or stress [71], similar proportions of sporadic symbionts were observed in both TPC and TPE. Sporadic symbionts exhibit variability across species, habitat, season, and life stage [71], and they may play a crucial role in maintaining the functional integrity of coral symbiont and adapting to specific environmental stresses [17]. The abundant presence of sporadic symbionts in T. peltata implies that its bacterial community is more flexible than that of A. valida, demonstrating greater inclusiveness within the bacterial community, which endows the host with a higher bacterial community plasticity and a faster response to Vibrio stress.

Analyses of diversity and core bacterial microbiome revealed the host specificity and dynamics of coral symbiotic microbes. T. peltata exhibited more pronounced bacterial dynamics in terms of diversity and community structure, enabling it to withstand the Vibrio stress. In contrast, A. valida showed less fluctuation in bacterial communities but failed to resist Vibrio. This finding aligns with the recent research conducted by Pogoreutz et al. [29], which observed coral bleaching and mortality despite the stability of bacterial communities in Pocillopora verrucosa exposed to excessive organic nutrients. They suggested that more flexible bacterial communities may help the holobiont to respond or acclimatize to rapid environment changes [29]. This observation was highly similar to findings of Nicholas et al. [72], who found that corals with smaller microbial community dynamics under disease stress exhibited higher susceptibility, while those with more pronounced dynamics in bacterial community demonstrated greater disease resistance. Alterations in coral symbiotic microbial communities may lead to microbial dysbiosis [17]. Nonetheless, the dynamics of microbial communities serve as a crucial mechanism empowering corals to not only withstand environmental stresses but also adapt adeptly to changes in their surroundings [30]. Attributed to the greater dynamism of the bacterial community, T. peltata emerges as inherently more flexible in its response to pathogenic challenges, demonstrating a capacity to withstand pronounced fluctuations within the microbial community. Conversely, the relative stability of the bacterial community in A. valida may suggest a delayed responsiveness, indicating at a lower threshold for microbial dysbiosis and a rapid die-off in response to pathogens infection.

Alterations in the abundance of associated bacterial taxa reflect the dynamic nature of the microbial community and carry significant implications for host disease resistance. The high abundance of Rhodobacteraceae, Flavobacteriaceae in T. peltata suggests that their status as resident members within the bacterial community, which is consistent with previous studies [7, 15, 73]. Related members of Rhodobacteraceae play critical roles in nitrogen fixation and pathogen defense [17, 74]. Related members of the Flavobacteriaceae reduce the production of reactive oxygen species by Symbiodiniaceae to protect the photosynthetic mechanism [75], and they also produce antimicrobial substances like tropodithitic acid through the metabolization of DMSP, thereby inhibiting the proliferation of pathogens [76, 77]. Furthermore, Ruegeria has been recognized as a coral probiotic that produces antimicrobial compounds to inhibit pathogenic bacteria, playing an important role in defense against pathogens [77,78,79], and similar antimicrobial properties were found in related members of Pseudoalteromonadaceae [77, 80]. The significant change the RA of these dominant bacterial taxa in T. peltata potentially reflects the competition between potential beneficial bacteria and pathogenic bacteria. The proliferation of these taxa may reduce the competitiveness of the pathogenic Vibrio within the community, potentially reshaping the microbial community into a more beneficial state. However, these potential pathogen-resistant bacterial are present in A. valida bacterial community with an extremely low abundance and sluggish response, which is not conducive to resist pathogenic infection. Therefore, greater bacterial community flexibility, dysbiosis thresholds, and the abundance of potential beneficial bacteria contribute to T. peltata showing better resistance to V. coralliilyticus.

Coral disease resistance is influenced by the availability of energy driven by Symbiodiniaceae

Statistical analyses of Symbiodiniaceae densities and photosynthetic efficiencies consistently demonstrated that Vibrio inoculation severely disrupted the symbiotic relationship between Symbiodiniaceae and A. valida. Symbiodiniaceae transfer approximately 60–80% of the energy to the host through photosynthesis, supporting vital physiological processes such as reproduction, respiration and calcification [17]. Furthermore, numerous studies indicated that the availability of the organic nutrients potentially contributed to shaping coral resistance and resilience, with stable transportation of those nutrients benefiting coral tolerance and resilience [11, 81]. The severe disruption of this symbiotic relationship in A. valida undoubtedly interrupts energy transfer and potentially exacerbates host mortality. Conversely, T. peltata sustained a relatively constant Symbiodiniaceae density and photosynthetic efficiency under Vibrio stress, indicating that the energy transfer driven by Symbiodiniaceae was not significantly affected. Its robust polyps confer stronger heterotrophic feeding capability, which benefits T. peltata by supplementing the energy deficiency caused by the slight loss of Symbiodiniaceae as well as improves tolerance to environmental stress [11, 81]. Furthermore, the thicker tissues of T. peltata may store more substantial energy reserves, contributing to coral disease resistance and resilience [82]. It is noteworthy that the popularity of the aluminium foil method for measuring coral surface area in many studies is undeniably less accurate than the 3D modelling method, and therefore there is an unavoidable and objective inaccuracy in the calculation of the Symbiodiniaceae density based on this method [83,84,85]. The application of the 3D modelling method for surface area measurements in further studies may contribute to revealing more details of the variation in Symbiodiniaceae density.

The composition of Symbiodiniaceae subclades was not significantly alter by Vibrio inoculation. Although previous studies have found that some corals were able to shuffle, switch and recombine Symbiodiniaceae subclades to improve host resistance and resilience to withstand environmental stress [57, 66, 84], no recombination of dominant Symbiodiniaceae subclades was observed in present study, suggesting that short term pathogen stress may not exert sufficient influence to alter the Symbiodiniaceae community structure. Additionally, a plausible explanation is coral hosts usually establish symbiotic relationships with a single genetic clone of Symbiodiniaceae [67, 86], it will occupy an advantage once the clonal Symbiodiniaceae lineage is established in the host, which may represent a crucial mechanism to the coral’s environmental adaptation over a long-time evolution [87]. However, certain Symbiodiniaceae subclades disappeared after Vibrio stress, including C1m.type2, C1a, and A6. Coral host may selectively expel redundant or harmful Symbiodiniaceae to maintain a stable symbiotic relationship in response to environmental pressure [88].

The present study offers a novel perspective on investigating interspecific differences within Symbiodiniaceae communities and their responses to pathogen pressure through the ASV method. Nevertheless, numerous challenges persist in the utilization of ITS2, encompassing intragenomic variation (IGV), pseudogenes, and PCR artifacts, albeit these limitations have been notably mitigated through the utilization of next-generation sequencing and the data processing method for Symbiodiniaceae ITS2 NGS data established by Arif et al. [89]. Consequently, relying solely on the ASV method for assessing Symbiodiniaceae diversity may introduce some uncertainties. In future research, the adoption of Symportal developed by Hume et al. [90] may facilitate a more comprehensive exploration of the nuanced alterations within the Symbiodiniaceae community under disease pressure.

Coral disease resistance is shaped by the host's energy availability and immune activity

The differentially up-regulated genes of A. valida showed the most significant enrichment in G protein-coupled receptor signaling pathway. G protein-coupled receptor (GPCR) represent the largest and most diverse membrane receptor in eukaryotic organisms, closely tied to the perception and health of organisms to the external environment [91]. The pathway was activated by Vibrio stress to regulate cellular metabolism through downstream pathways such as cyclic adenosine monophosphate (cAMP) and protein kinase A (PKA) signaling pathways, involving the degradation of glycogen into glucose for various cell biological processes [91]. The significant up-regulation of the GPCR signaling pathway is likely to correlate with the massive loss of the symbiotic Symbiodiniaceae. The loss of Symbiodiniaceae leads to a reduction in energy availability, with the host released stored energy through accelerating the degradation of glycogen to compensate for the energy shortfall. Notably, the GPCR signaling pathway will further activates apoptosis. Previous studies have identified a significant correlation between the disease-related mortality of susceptible corals and the excessive activation of apoptosis [34]. Therefore, the significant up-regulation of this pathway could exacerbate immune dysregulation and mortality. Furthermore, a considerable number of differentially up-regulated genes were enriched in the toll-like receptor signaling pathway. Toll-like receptors (TLR) serve as pattern recognition receptors and are essential components of the biological innate immune system, identifying exogenous pathogens to initiate an immune response [92]. The up-regulation of this pathway suggest that Vibrio stress stimulates the innate immune response in A. valida. These findings were consistent with the perspective that heightened immune activity correlates with increased energy demands, the coral holobiont sustains elevated immunity levels by augmenting the energy supply from Symbiodiniaceae [93]. The maintenance of homeostasis in the coral holobiont through immunity may be intricately linked to its energy supply, suggesting that this correlative mechanism could enhance the host's resilience amidst environmental fluctuations. However, the massive loss of symbiotic Symbiodiniaceae renders A. valida unable to meet the high energy demands of the immune response. Moreover, TOR is involved not only in regulating cell growth and metabolism but also in influencing coral innate immune activities through the regulation of autophagy [34]. Consequently, the down-regulation of the TOR-related pathways in A. valida result in the dysregulation of metabolic processes and immune homeostasis. Furthermore, the inhibition of pathways related to DNA integration and nitrogen metabolism reduced the disease resistance of A. valida.

The differentially up-regulated genes of T. peltata were predominantly enriched in GO terms related to immune regulation and metabolism of organic substances. The JAK-STAT pathway plays an essential role in cell proliferation, differentiation, and immunomodulation [94]. Abnormal activation of this pathway disrupts immune regulation in the organism, resulting in immune disorders, inflammation, and the development of cancer [94,95,96]. The negative regulatory mechanism of JAK-STAT pathway represents a crucial mechanism involved in the regulation of immune homeostasis, which contributes to the prevention of immune disorders of the organism. Numerous studies have demonstrated that the JAK inhibitors effectively suppress the abnormal expression of the JAK-STAT pathway to prevent immune diseases [97, 98]. The excessive immune stress in coral host under disease conditions may trigger apoptosis, which may induce further mortality [34]. Therefore, the up-regulation of negative regulation of receptor signaling pathway via JAK-STAT in T. peltata under Vibrio stress likely contributes to host maintenance of immune homeostasis for disease prevention. Additionally, the up-regulation of pathways related to polysaccharide and protein metabolism suggests that T. peltata may enhance energy supply for the coral holobiont by accelerating nutrient metabolism under pathogen stress. This process helps alleviate energy deprivation caused by the minor loss of Symbiodiniaceae, maintaining the stability of carbon and nitrogen cycles in the coral holobiont, thereby enhancing coral disease resistance and resilience. Conversely, pathways related to ion transport were particularly prominent among down-regulated pathways. Cells maintain intracellular ion homeostasis by regulating the transmembrane transport of ions through ion channels and transport carriers [99], which is essential for coral physiological processes such as photosynthesis and calcification. The up-regulation of genes related to ion transport may enhance coral resistance to ocean acidification, entailing a trade-off with the regulation metabolic processes [100]. Certain corals either up-regulate metabolic pathways to acquire sufficient energy for resisting environmental stress (e.g., ocean acidification) or slow down their metabolic activities for awaiting environmental improvement [101]. However, the reduction of metabolic activities is accompanied by the up-regulation of ion transport pathways to minimize energy loss by slowing down other metabolic activities, given the significant energy demands of cellular ion transport during certain environmental stress [100]. This trade-off mechanism was observed in our study, wherein T. peltata maintains the expression of vital pathways crucial for coral resistance to pathogens and improves resilience by selectively down-regulating less useful pathways for resisting environmental stresses.

Although the up-regulation of pathways related to polysaccharide metabolism in A. valida, it inadequately compensates for the energy deficit caused by the substantial loss of Symbiodiniaceae, which is detrimental to the host's innate immune activity and defense against pathogens. Furthermore, the simultaneous suppression of cellular regeneration and synthesis of antimicrobial substances, along with the dysregulation of metabolic and immune processes, hinders the organism's ability to resist pathogens. While T. peltata exhibited a greater ability to regulate the immune system, averting immune dysregulation induced by Vibrio stress, and it obtained energy replenishment by up-regulating specific organic metabolic pathways, which involve a trade-off with regulation of certain pathways such as ion transport.

Conclusions

In summary, the present study highlights that the heightened dynamics and flexibility of the symbiotic bacterial community and the antimicrobial activity of coral potential beneficial bacteria contribute to a swift response and defense against pathogens. The substantial depletion of symbiotic Symbiodiniaceae leads to an insufficient energy supply, which poses a challenge for the host to compensate for by accelerating nutrient metabolism and is detrimental to innate immune activity. Maintaining the homeostasis in both symbiotic Symbiodiniaceae density and immune activity bestows upon corals enhanced disease resistance and resilience (Fig. 6). Our findings provide valuable insights into the mechanisms linking alterations in the coral microbiome, transcriptional regulation and disease resistance amid disease stress, and provide a molecular theoretical foundation for the study of coral disease resistance.

Fig. 6
figure 6

Response mechanisms in coral holobionts under V. coralliilyticus stress. GPCR, G protein-coupled receptor; TLR, Toll-like receptor; cAMP, Cyclic adenosine monophosphate; PKA, protein kinase A; AMPs, antimicrobial peptides; JAK, Janus Kinase; STAT, signal transducer and activator of transcription; DMSP, Dimethylsulfoniopropionate

Full size image

Availability of data and materials

The datasets generated during the current study have been deposited and are publicly available in the Sequence Read Archive repository under BioProject ID PRJNA1044715, PRJNA1044737, and PRJNA1044533.

Abbreviations

DMSP:

Dimethylsulfoniopropionate

MA medium:

MacConkey agar medium

CFU:

Colony forming unit

AVC:

Control group of A. valida

AVE:

Experimental group of A. valida

TPC:

Control group of T. peltata

TPE:

Experimental group of T. peltata

Fv/Fm:

Maximum quantum yield

OTU:

Operational taxonomic unit

RA:

Relative abundance

PCoA:

Principal co-ordinates analysis

PERMANOVA:

Permutational multivariate analysis of variance

LDA:

Line discriminant analysis

LEfSe:

Line discriminant analysis Effect Size

ASV:

Amplicon sequence variant

NR:

Non-redundant protein sequence database

COG:

Clusterof orthologous group

KOG:

Clusters of orthologous groups from 66 complete genomes

eggNOG4.5:

Evolutionary genealogy of genesnon-supervised orthologous groups

KEGG:

Kyoto encyclopedia of genes and genomes

DEG:

Differentially expressed gene

FDR:

False discovery rate

ANOVA:

Analysis of variance

GPCR:

G protein-coupled receptor

cAMP:

Cyclic adenosine monophosphate

PKA:

Protein kinase A

TLR:

Toll-like receptor

AMPs:

Antimicrobial peptides

JAK:

Janus Kinase

STAT:

Signal transducer and activator of transcription

References

  1. Bourne DG, Morrow KM, Webster NS. Insights into the Coral microbiome: underpinning the health and resilience of reef ecosystems. Annu Rev Microbiol. 2016;70(1):317–40. https://doi.org/10.1146/annurev-micro-102215-095440.

    Article  CAS  PubMed  Google Scholar 

  2. Moriarty T, Leggat W, Huggett MJ, et al. Coral disease causes, consequences, and risk within coral restoration. Trends Microbiol. 2020;28(10):793–807. https://doi.org/10.1016/j.tim.2020.06.002.

    Article  CAS  PubMed  Google Scholar 

  3. De’ath G. The 27-year decline of coral cover on the great barrier reef and its causes. Proc Natl Acad Sci USA. 2012;109(44):17995–9. https://doi.org/10.1073/pnas.1208909109.

    Article  PubMed  PubMed Central  Google Scholar 

  4. Hogarth WT. Endangered and threatened species: final listing determinations for Elkhorn coral and staghorn coral. Fed Reg. 2006;71(89):26852–61.

    Google Scholar 

  5. Eugene R, Omry K, Leah R, et al. The role of microorganisms in coral health, disease and evolution. Nat Rev Microbiol. 2007;5(5):355–62. https://doi.org/10.1038/nrmicro1635. Epub 2007 Mar 26.

    Article  CAS  Google Scholar 

  6. Munn C B. The role of vibrios in diseases of corals. Microbiol Spectr. 2015; 3(4). https://doi.org/10.1128/microbiolspec.VE-0006-2014.

  7. Etout J, Esiboni N, Messer LF, et al. Increased seawater temperature increases the abundance and alters the structure of natural Vibrio populations associated with the coral Pocillopora damicornis. Front Microbiol. 2015;6:432. https://doi.org/10.3389/fmicb.2015.00432.

    Article  Google Scholar 

  8. Cohen Y, Pollock FJ, Rosenberg E, et al. Phage therapy treatment of the coral pathogen Vibrio coralliilyticus. MicrobiologyOpen. 2013;2(1):64–74. https://doi.org/10.1002/mbo3.52.

    Article  CAS  PubMed  Google Scholar 

  9. Blake U, Patrick V, Burger AH, et al. Vibrio coralliilyticus strain OCN008 is an etiological agent of acute Montipora white syndrome. Appl Environ Microbiol. 2014;80(7):2102–9. https://doi.org/10.1128/AEM.03463-13.

    Article  CAS  Google Scholar 

  10. Meir S, Willis BL, Steven V, et al. Coral pathogens identified for White Syndrome (WS) epizootics in the Indo-Pacific. PLoS ONE. 2008;3(6):e2393. https://doi.org/10.1371/journal.pone.0002393.

    Article  CAS  Google Scholar 

  11. Mydlarz LD, Mcginty ES, Harvell CD. What are the physiological and immunological responses of coral to climate warming and disease? J Exp Biol. 2010;213(6):934–45. https://doi.org/10.1242/jeb.037580.

    Article  PubMed  Google Scholar 

  12. Sweet MJ, Croquer A, Bythell JC. Experimental antibiotic treatment identifies potential pathogens of white band disease in the endangered Caribbean coral Acropora cervicornis. Proc Biol Sci. 2014;281(1788):20140094. https://doi.org/10.1098/rspb.2014.0094.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Ushijima B, Smith A, Aeby GS, et al. Vibrio owensii induces the tissue loss disease Montipora white syndrome in the Hawaiian reef coral Montipora capitata. PLoS ONE. 2012;7(10):e46717. https://doi.org/10.1371/journal.pone.0046717.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Vollmer SV, Kline DI. Natural disease resistance in threatened staghorn corals. PloS one. 2008;3(11):e3718. https://doi.org/10.1371/journal.pone.0003718.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  15. Sunagawa S, Desantis TZ, Piceno YM, et al. Bacterial diversity and White Plague Disease-associated community changes in the Caribbean coral Montastraea faveolata. ISME J. 2009;3(5):512–21. https://doi.org/10.1038/ismej.2008.131.

    Article  CAS  PubMed  Google Scholar 

  16. MacKnight NJ, Dimos BA, Beavers KM, et al. Disease resistance in coral is mediated by distinct adaptive and plastic gene expression profiles. Sci Adv. 2022;8(39):eabo6153–eabo6153. https://doi.org/10.1126/SCIADV.ABO6153.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. Peixoto RS, Rosado PM, Leite DC, et al. Beneficial Microorganisms for Corals (BMC): Proposed Mechanisms for Coral Health and Resilience. Front Microbiol. 2017;8:341. https://doi.org/10.3389/fmicb.2017.00341.

    Article  PubMed  PubMed Central  Google Scholar 

  18. Ritchie KB. Regulation of microbial populations by coral surface mucus and mucus-associated bacteria. Mar Ecol Progr Ser. 2006;322:1–14. https://doi.org/10.3354/MEPS322001.

    Article  CAS  Google Scholar 

  19. Mcdevitt-Irwin JM, Baum JK, Garren M, et al. Responses of coral-associated bacterial communities to local and global stressors. Front Mar Sci. 2017;4:262. https://doi.org/10.3389/fmars.2017.00262.

    Article  Google Scholar 

  20. Tanya B, Dylan S, Zaneveld JR, et al. Characterization of the microbiome and immune response in corals with chronic Montipora white syndrome. Mol Ecol. 2021;30(11):2591–606. https://doi.org/10.1111/mec.15899.

    Article  CAS  Google Scholar 

  21. Closek CJ, Sunagawa S, DeSalvo MK, et al. Coral transcriptome and bacterial community profiles reveal distinct Yellow Band Disease states in Orbicella faveolata. ISME J. 2014;8(12):2411–22. https://doi.org/10.1038/ismej.2014.85.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Silvia B, Blake U, Patrick V, et al. Dynamics of acute Montipora white syndrome: bacterial communities of healthy and diseased M. capitata colonies during and after a disease outbreak. Microbiology (Reading, England). 2018;164(10):1240–53. https://doi.org/10.1099/mic.0.000699.

    Article  CAS  Google Scholar 

  23. Pollock FJ, Lamb JB, van de Water JA, Smith HA, et al. Reduced diversity and stability of coral associated bacterial communities and suppressed immune function precedes disease onset in corals. Royal Soc Open Sci. 2019;6(6):190355. https://doi.org/10.1098/rsos.190355.

  24. Godwin S, Bent E, Borneman J, et al. The role of coral-associated bacterial communities in Australian subtropical white syndrome of Turbinaria mesenterina. PLoS ONE. 2018;7(9):e44243. https://doi.org/10.1371/journal.pone.0044243.

    Article  CAS  Google Scholar 

  25. Pollock FJ, Wada N, Torda G, et al. White syndrome-affected corals have a distinct microbiome at disease lesion fronts. Appl Environ Microbiol. 2017;83(2):e02799-e2816. https://doi.org/10.1128/AEM.02799-16.

    Article  PubMed  Google Scholar 

  26. Sweet M, Burian A, Fifer J, et al. Compositional homogeneity in the pathobiome of a new, slow-spreading coral disease. Microbiome. 2019;7(1):139. https://doi.org/10.1186/s40168-019-0759-6.

    Article  PubMed  PubMed Central  Google Scholar 

  27. Grottoli AG, Dalcin Martins P, Wilkins MJ, et al. Coral physiology and microbiome dynamics under combined warming and ocean acidification. PloS one. 2018;13(1):e0191156. https://doi.org/10.1371/journal.pone.0191156.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Epstein HE, Torda G, Oppen MJH. Relative stability of the Pocillopora acuta microbiome throughout a thermal stress event. Coral Reefs. 2019;38(2):373–86. https://doi.org/10.1007/s00338-019-01783-y.

    Article  Google Scholar 

  29. Pogoreutz C, Rdecker N, Cárdenas A, et al. Dominance of Endozoicomonas bacteria throughout coral bleaching and mortality suggests structural inflexibility of the Pocillopora verrucosa microbiome. Ecol Evol. 2018;8(4):2240–52. https://doi.org/10.1002/ece3.3830.

    Article  PubMed  PubMed Central  Google Scholar 

  30. Reshef L, Koren O, Loya Y, et al. The Coral Probiotic Hypothesis. Blackwell Publishing Ltd. 2006;8(12):2068–73. https://doi.org/10.1111/J.1462-2920.2006.01148.X.

    Article  CAS  Google Scholar 

  31. Aichelman HE, Townsend JE, Courtney TA, et al. Heterotrophy mitigates the response of the temperate coral Oculina arbuscula to temperature stress. Ecol Evol. 2016;6(18):6758–69. https://doi.org/10.1002/ece3.2399.

    Article  PubMed  PubMed Central  Google Scholar 

  32. Talisa D, Marlene W, Lalita P, et al. Towards enhancing coral heat tolerance: a “microbiome transplantation” treatment using inoculations of homogenized coral tissues. Microbiome. 2021;9(1):102–102. https://doi.org/10.1186/S40168-021-01053-6.

    Article  Google Scholar 

  33. Kvennefors ECE, Leggat W, Hoegh-Guldberg O, et al. An ancient and variable mannose-binding lectin from the coral Acropora millepora binds both pathogens and symbionts. Dev Comp Immunol. 2008;32(12):1582–92. https://doi.org/10.1016/j.dci.2008.05.010.

    Article  CAS  PubMed  Google Scholar 

  34. Fuess LE, Pinzón CJH, Weil E, et al. Life or death: disease-tolerant coral species activate autophagy following immune challenge. Proc Biol Sci. 1856;2017(284):20170771–20170771. https://doi.org/10.1098/rspb.2017.0771.

    Article  CAS  Google Scholar 

  35. Bourne DG, Garren M, Work TM, et al. Microbial disease and the coral holobiont. Trends Microbiol. 2009;17(12):554–62. https://doi.org/10.1016/j.tim.2009.09.004.

    Article  CAS  PubMed  Google Scholar 

  36. Vidal-Dupiol J, Ladriere O, Meistertzheim AL, et al. Physiological responses of the scleractinian coral Pocillopora damicornis to bacterial stress from Vibrio coralliilyticus. J Exp Biol. 2011;214(Pt 9):1533–45. https://doi.org/10.1242/jeb.053165.

    Article  CAS  PubMed  Google Scholar 

  37. Vidal-Dupiol J, Dheilly NM, Rondon R, et al. Thermal stress triggers broad pocillopora damicornis transcriptomic remodeling, while vibrio coralliilyticus infection induces a more targeted immuno-suppression response. PLoS ONE. 2014;9(9):e107672. https://doi.org/10.1371/journal.pone.0107672.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  38. Veron NJE. Corals of the world. 2001.

  39. Chen B, Yu K, Liao Z, et al. Microbiome community and complexity indicate environmental gradient acclimatisation and potential microbial interaction of endemic coral holobionts in the South China Sea. Sci Total Environ. 2020;765(prepublish):142690. https://doi.org/10.1016/j.scitotenv.2020.142690.

    Article  CAS  PubMed  Google Scholar 

  40. Ruiqi G, Jiayuan L, Kefu Y, et al. Regulation of the coral-associated bacteria and symbiodiniaceae in acropora valida under ocean acidification. Front Microbiol. 2021;12:767174–767174. https://doi.org/10.3389/FMICB.2021.767174.

    Article  Google Scholar 

  41. Okwadha GDO, Li J. Optimum conditions for microbial carbonate precipitation. Chemosphere. 2010;81(9):1143–8. https://doi.org/10.1016/j.chemosphere.2010.09.066.

    Article  CAS  PubMed  Google Scholar 

  42. Rosado PM, Leite DC, Duarte GA, et al. Marine probiotics: increasing coral resistance to bleaching through microbiome manipulation. ISME J. 2019;13(4):921–36. https://doi.org/10.1038/s41396-018-0323-6.

    Article  CAS  PubMed  Google Scholar 

  43. Premarathna AD, Letchuman S, Jayasooriya AP, et al. A review on pathogenic diseases on corals associated risk factors and possible devastations in future in the globe. J Mar Sci Technol. 2019;9(2):1–5. https://doi.org/10.4172/2155-9910.1000269.

    Article  Google Scholar 

  44. Wang J, Hu J, Di L, et al. Effects of straw returning and nitrogen management on soil microbial community structure at different rice growth stages. Jiangsu J Agric Sci. 2021;37(06):1460–70. https://doi.org/10.3969/j.issn.1000-4440.2021.06.013.

    Article  Google Scholar 

  45. Ziming H, Xiao L, Haodi F, et al. Metagenomic insights into microorganisms and antibiotic resistance genes of waste antibiotic fermentation residues along production, storage and treatment processes. J Environ Sci. 2024;136:45–55. https://doi.org/10.1016/J.JES.2022.10.035.

    Article  Google Scholar 

  46. Bolger AM, Marc L, Bjoern U. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30(15):2114–20. https://doi.org/10.1093/bioinformatics/btu170.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  47. Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. Embnet J. 2011; 17(1). https://doi.org/10.14806/ej.17.1.200.

  48. Magoc T, Salzberg SL. FLASH: Fast Length Adjustment of Short reads to improve genome assemblies. Bioinformatics (Oxford, England). 2011;27(21):2957–63. https://doi.org/10.1093/bioinformatics/btr507.

    Article  CAS  PubMed  Google Scholar 

  49. Knight R. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics. 2011;27(16):2194. https://doi.org/10.1093/bioinformatics/btr381.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  50. Edgar RC. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nat Methods. 2013;10(10):996–8. https://doi.org/10.1038/nmeth.2604.

    Article  CAS  PubMed  Google Scholar 

  51. Bokulich NA, Subramanian S, Faith JJ, et al. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nat Methods. 2013;10(1):57–9. https://doi.org/10.1038/nmeth.2276.

    Article  CAS  PubMed  Google Scholar 

  52. Christian Q, Elmar P, Pelin Y, et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucl Acids Res. 2013;41(Database issue):D590-6. https://doi.org/10.1093/nar/gks1219.

    Article  CAS  Google Scholar 

  53. Kõljalg U, Nilsson RH, Abarenkov K, et al. Towards a unified paradigm for sequence-based identification of fungi. Mol Ecol. 2013;22(21):5271–7. https://doi.org/10.1111/mec.12481.

    Article  CAS  PubMed  Google Scholar 

  54. Bolyen E, Rideout JR, Dillon MR, et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat Biotechnol. 2019;37(8):852–7. https://doi.org/10.1038/s41587-019-0209-9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  55. Segata N, Izard J, Waldron L, et al. Metagenomic biomarker discovery and explanation. Genome Biol. 2011;12(6):R60. https://doi.org/10.1186/gb-2011-12-6-r60.

    Article  PubMed  PubMed Central  Google Scholar 

  56. Ziegler M, Arif C, Burt JA, et al. Biogeography and molecular diversity of coral symbionts in the genus Symbiodinium around the Arabian Peninsula. J Biogeogr. 2017;44(3):674–86. https://doi.org/10.1111/jbi.12913.

    Article  PubMed  PubMed Central  Google Scholar 

  57. Chen B, Yu K, Liang J, et al. Latitudinal variation in the molecular diversity and community composition of symbiodiniaceae in coral from the South China Sea. Front Microbiol. 2019;10:1278. https://doi.org/10.3389/fmicb.2019.01278.

    Article  PubMed  PubMed Central  Google Scholar 

  58. Grabherr MG, Haas BJ, Yassour M, et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol. 2011;29(7):644–52. https://doi.org/10.1038/nbt.1883.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  59. Huson DH, Buchfink B. Fast and sensitive protein alignment using DIAMOND. Nat Methods. 2015;12:59–60. https://doi.org/10.1038/nmeth.3176.

    Article  CAS  PubMed  Google Scholar 

  60. Dewey CN, Bo L. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics. 2011;12(1):323–323. https://doi.org/10.1186/1471-2105-12-323.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  61. Trapnell C, Williams BA, Pertea G, et al. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol. 2010;28(5):511–5. https://doi.org/10.1038/nbt.1621.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  62. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550. https://doi.org/10.1186/s13059-014-0550-8.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  63. Zaneveld JR, Mcminds R, Vega TR. Stress and stability: applying the Anna Karenina principle to animal microbiomes. Nat Microbiol. 2017;2(9):17121. https://doi.org/10.1038/nmicrobiol.2017.121.

    Article  CAS  PubMed  Google Scholar 

  64. Tracy AM, Koren O, Douglas N, et al. Persistent shifts in Caribbean coral microbiota are linked to the 2010 warm thermal anomaly. Environ Microbiol Rep. 2015;7(3):471. https://doi.org/10.1111/1758-2229.12274.

    Article  PubMed  Google Scholar 

  65. Morrow KM, et al. Allelochemicals produced by the brown macroalga, Lobophora sp., are active against coral larvae and associated bacteria, supporting pathogenic shifts to Vibrio -dominance. Appl Environ Microbiol. 2016;83:e02391-16. https://doi.org/10.1128/AEM.02391-16.

    Article  PubMed  PubMed Central  Google Scholar 

  66. Silverstein RN, Cunning R, Baker AC. Change in algal symbiont communities after bleaching, not prior heat exposure, increases heat tolerance of reef corals. Glob Change Biol. 2015;21(1):236–49. https://doi.org/10.1111/gcb.12706.

    Article  Google Scholar 

  67. Xiaopeng Y, Kefu Y, Biao C, et al. Different responses of scleractinian coral Acropora pruinosa from Weizhou Island during extreme high temperature events. Coral Reefs. 2021;40(6):1697–711. https://doi.org/10.1007/S00338-021-02182-Y.

    Article  Google Scholar 

  68. Cárdenas A, Rodriguez-R LM, Pizarro V, et al. Shifts in bacterial communities of two caribbean reef-building coral species affected by white plague disease. ISME J. 2012;6(3):502. https://doi.org/10.1038/ismej.2011.123.

    Article  CAS  PubMed  Google Scholar 

  69. Rubio-Portillo E, Kersting DK, Linares C, et al. Biogeographic differences in the microbiome and pathobiome of the coral cladocora caespitosa in the Western Mediterranean sea. Front Microbiol. 2018;9:22. https://doi.org/10.3389/fmicb.2018.00022.

    Article  PubMed  PubMed Central  Google Scholar 

  70. Wright RM, Kenkel CD, Dunn CE, et al. Intraspecific differences in molecular stress responses and coral pathobiome contribute to mortality under bacterial challenge in Acropora millepora. Sci Rep. 2017;7(1):2609. https://doi.org/10.1038/s41598-017-02685-1.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  71. Hester ER, Barott KL, Nulton J, et al. Stable and sporadic symbiotic communities of coral and algal holobionts. ISME J. 2016;10(5):1157–69. https://doi.org/10.1038/ismej.2015.190.

    Article  CAS  PubMed  Google Scholar 

  72. MacKnight NJ, Cobleigh K, Lasseigne D, et al. Microbial dysbiosis reflects disease resistance in diverse coral species. Commun Biol. 2021;4(1):679–679. https://doi.org/10.1038/S42003-021-02163-5.

    Article  PubMed  PubMed Central  Google Scholar 

  73. Meyer JL, Castellanos-Gell J, Aeby GS, et al. Microbial community shifts associated with the ongoing stony coral tissue loss disease outbreak on the Florida reef tract. Cold Spring Harbor Lab. 2019;10:2244. https://doi.org/10.3389/fmicb.2019.02244.

    Article  Google Scholar 

  74. Gignoux-Wolfsohn SA, Aronson FM, Vollmer SV. Complex interactions between potentially pathogenic, opportunistic, and resident bacteria emerge during infection on a reef-building coral. FEMS Microbiol Ecol. 2017; 93(7). https://doi.org/10.1093/femsec/fix080.

  75. Keisuke M, Toshiyuki T, Shunsuke A, et al. A Zeaxanthin-producing bacterium isolated from the algal phycosphere protects coral endosymbionts from environmental stress. mBio. 2020; 11(1). https://doi.org/10.1128/mBio.01019-19.

  76. Howard EC, Sun S, Reisch CR, et al. Changes in dimethylsulfoniopropionate demethylase gene assemblages in response to an induced phytoplankton bloom. Appl Environ Microbiol. 2011;77(2):524–31. https://doi.org/10.1128/AEM.01457-10.

    Article  CAS  PubMed  Google Scholar 

  77. Raina JB, Tapiolas D, Motti CA, et al. Isolation of an antimicrobial compound produced by bacteria associated with reef-building corals. PeerJ. 2016;4:e2275. https://doi.org/10.7717/peerj.2275.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  78. Miura N, Motone K, Takagi T, et al. Ruegeria sp strains isolated from the reef-building coral galaxea fascicularis inhibit growth of the temperature-dependent pathogen vibrio coralliilyticus. Mar Biotechnol (NY). 2019;21(1):1–8. https://doi.org/10.1007/s10126-018-9853-1.

    Article  CAS  PubMed  Google Scholar 

  79. Kitamura R, Miura N, Ito M, et al. Specific detection of coral-associated ruegeria, a potential probiotic bacterium, in corals and subtropical seawater. Marine Biotechnol. 2021;23(4):1–14. https://doi.org/10.1007/S10126-021-10047-2.

    Article  Google Scholar 

  80. Maya S-O, Alex S, Ariel K. Antibacterial activity of Pseudoalteromonas in the coral holobiont. Microb Ecol. 2012;64(4):851–9. https://doi.org/10.1007/s00248-012-0086-y.

    Article  CAS  Google Scholar 

  81. Rodrigues LJ, Grottoli AG. Energy reserves and metabolism as indicators of coral recovery from bleaching. Limnol Oceanogr. 2007;52(5):1874–82. https://doi.org/10.2307/4502342.

    Article  Google Scholar 

  82. Qin Z, Yu K, Liang Y, et al. Latitudinal variation in reef coral tissue thickness in the South China Sea: Potential linkage with coral tolerance to environmental stress. Sci Total Environ. 2020;711: 134610. https://doi.org/10.1016/j.scitotenv.2019.134610.

    Article  CAS  PubMed  Google Scholar 

  83. Liang Y, Yu X, Guo Y, et al. Applicability and calibration methods of three traditional surface area measurement methods for different coral species—based on 3D scanning technology. J Trop Oceanogr. 2020;39(01):85–93. https://doi.org/10.11978/2019039.

    Article  Google Scholar 

  84. Zhenjun Q, Kefu Y, Biao C, et al. Diversity of symbiodiniaceae in 15 coral species from the Southern South China Sea: potential relationship with coral thermal adaptability. Front Microbiol. 2019;10:2343. https://doi.org/10.3389/fmicb.2019.02343.

    Article  Google Scholar 

  85. Li S, Yu K, Shi Q, et al. Interspecies and spatial diversity in the symbiotic zooxanthellae density in corals from northern South China Sea and its relationship to coral reef bleaching. Chin Sci Bull. 2008;53(2):295–303. https://doi.org/10.1007/s11434-007-0514-4.

    Article  Google Scholar 

  86. Yu X, Yu K, Huang W, et al. Thermal acclimation increases heat tolerance of the scleractinian coral Acropora pruinosa. Sci Total Environ. 2020;733(1):139319. https://doi.org/10.1016/j.scitotenv.2020.139319.

    Article  CAS  PubMed  Google Scholar 

  87. Thornhill DJ, Howells EJ, Wham DC, et al. Population genetics of reef coral endosymbionts (Symbiodinium, Dinophyceae). Mol Ecol. 2017;26(10):2640–59. https://doi.org/10.1111/mec.14055.

    Article  CAS  PubMed  Google Scholar 

  88. Palmer CV. Immunity and the coral crisis. Commun Biol. 2018;1(1):91. https://doi.org/10.1038/s42003-018-0097-4.

    Article  PubMed  PubMed Central  Google Scholar 

  89. Chatchanit A, Camille D, Till B, et al. Assessing Symbiodinium diversity in scleractinian corals via next-generation sequencing-based genotyping of the ITS2 rDNA region. Mol Ecol. 2014;23(17):4418–33. https://doi.org/10.1111/mec.12869.

    Article  CAS  Google Scholar 

  90. Hume BC, Smith EG, Ziegler M, Warrington HJ, Burt JA, LaJeunesse TC, Wiedenmann J, Voolstra CR. SymPortal: A novel analytical framework and platform for coral algal symbiont next-generation sequencing ITS2 profiling. Mol Ecol Resour. 2019;19(4):1063–80. https://doi.org/10.1111/1755-0998.13004.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  91. Gavi S, Shumay E, Wang H-Y, et al. G-protein-coupled receptors and tyrosine kinases: crossroads in cell signaling and regulation. Trends Endocrinol Metab. 2006;17(2):48–54. https://doi.org/10.1016/j.tem.2006.01.006.

    Article  CAS  PubMed  Google Scholar 

  92. Pengpeng X, Yunping W, Siqi L, et al. Research progress on Toll-like receptor signal transduction and its roles in antimicrobial immune responses. Appl Microbiol Biotechnol. 2021;105(13):5341–55. https://doi.org/10.1007/S00253-021-11406-8.

    Article  Google Scholar 

  93. Xiaopeng Y, Kefu Y, Zhiheng L, et al. Adaptation strategies of relatively high-latitude marginal reef corals in response to severe temperature fluctuations. Sci Total Environ. 2023;903:1666439–1666439. https://doi.org/10.1016/J.SCITOTENV.2023.166439.

    Article  Google Scholar 

  94. Amoyel M, Anderson AM, Bach EA. JAK/STAT pathway dysregulation in tumors: A Drosophila perspective. Semin Cell Dev Biol. 2014;28:96–103. https://doi.org/10.1016/j.semcdb.2014.03.023.

    Article  CAS  PubMed  Google Scholar 

  95. Levine RL, Wadleigh M, Cools J, et al. Activating mutation in the tyrosine kinase JAK2 in polycythemia vera, essential thrombocythemia, and myeloid metaplasia with myelofibrosis. Cancer Cell. 2005;7(4):387–97. https://doi.org/10.1016/j.ccr.2005.03.023.

    Article  CAS  PubMed  Google Scholar 

  96. Moriggl R, Sexl V, Kenner L, et al. Stat5 tetramer formation is associated with leukemogenesis. Cancer Cell. 2004;7(1):87–99. https://doi.org/10.1016/j.ccr.2004.12.010.

    Article  CAS  Google Scholar 

  97. Shingo N, Yoshiya T. Pathological relevance and treatment perspective of JAK targeting in systemic lupus erythematosus. Expert Rev Clin Immunol. 2022;18(3):245–52. https://doi.org/10.1080/1744666X.2022.2040988.

    Article  Google Scholar 

  98. Kelly CA, Saravanan V, Nisar M, et al. Rheumatoid arthritis-related interstitial lung disease: associations, prognostic factors and physiological and radiological characteristics–a large multicentre UK study. Rheumatology (Oxford, England). 2014;53(9):1676–82. https://doi.org/10.1093/rheumatology/keu165.

    Article  CAS  PubMed  Google Scholar 

  99. Hilgemann DW. Regulation of ion transport from within ion transit pathways. The Journal of general physiology. 2020; 152(1). https://doi.org/10.1085/jgp.201912455.

  100. Amanda G, Santiago H, Alexis W, et al. Regulation of ion transport and energy metabolism enables certain coral genotypes to maintain calcification under experimental ocean acidification. Mol Ecol. 2020;29(9):1657–73. https://doi.org/10.1111/mec.15439.

    Article  CAS  Google Scholar 

  101. Georgian SE, Dupont S, et al. Biogeographic variability in the physiological response of the cold-water coral Lophelia pertusa to ocean acidification. Mar Ecol. 2016;37(6):1345–59. https://doi.org/10.1111/maec.12373.

    Article  Google Scholar 

Download references

Acknowledgements

This work was supported by the National Natural Science Foundation of China (Nos.91428203), and the Natural Science Foundation of Guangxi Province (2023GXNSFAA026388). We express our gratitude to anonymous reviewers for providing many insightful comments.

Funding

This research was supported by the National Natural Science Foundation of China (Nos.91428203), and the Natural Science Foundation of Guangxi Province (2023GXNSFAA026388).

Author information

Authors and Affiliations

  1. Coral Reef Research Center of China, Guangxi Laboratory On the Study of Coral Reefs in the South China Sea, School of Marine Sciences, Guangxi University, Nanning, 530004, China

    Xucong He, Jie Zou, Qiqi Chen, Xiao Qin, Yuan Liu, Lujia Zeng & Hongfei Su

  2. School of Resources, Environment and Materials, Guangxi University, Nanning, 530004, China

    Jie Zou & Qiqi Chen

Authors
  1. Xucong He
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Jie Zou
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Qiqi Chen
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Xiao Qin
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Yuan Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Lujia Zeng
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Hongfei Su
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

We have taken appropriate measures to ensure the accuracy and reliability of the data and have followed the principles of scientific integrity in data analysis and result presentation. H.S. conceived the research; C.L., J.Z. and Q.C. contributed the materials; X.H. and C.L. performed all experiments; Y.L., L.Z. and X.Q. identified coral species; X.H. and H.S. wrote the manuscript; all authors edited and approved the manuscript. The authors declare that they have no conflict of interest.

Corresponding author

Correspondence to Hongfei Su.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

He, X., Zou, J., Chen, Q. et al. Microbial and transcriptional response of Acropora valida and Turbinaria peltata to Vibrio coralliilyticus challenge: insights into corals disease resistance. BMC Microbiol 24, 288 (2024). https://doi.org/10.1186/s12866-024-03438-7

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12866-024-03438-7

Keywords

BMC Microbiology

ISSN: 1471-2180

Contact us