- Research
- Open access
- Published:
Potential role of salivary lactic acid bacteria in pathogenesis of oral lichen planus
BMC Microbiology volume 24, Article number: 197 (2024)
Abstract
Background
Emerging evidence emphasized the role of oral microbiome in oral lichen planus (OLP). To date, no dominant pathogenic bacteria have been identified consistently. It is noteworthy that a decreased abundance of Streptococcus, a member of lactic acid bacteria (LAB) in OLP patients has been commonly reported, indicating its possible effect on OLP. This study aims to investigate the composition of LAB genera in OLP patients by high-throughput sequencing, and to explore the possible relationship between them.
Methods
We collected saliva samples from patients with OLP (n = 21) and healthy controls (n = 22) and performed 16 S rRNA gene high-throughput sequencing. In addition, the abundance of LAB genera was comprehensively analyzed and compared between OLP and HC group. To verify the expression of Lactococcus lactis, real time PCR was conducted in buccal mucosa swab from another 14 patients with OLP and 10 HC. Furthermore, the correlation was conducted between clinical severity of OLP and LAB.
Results
OLP and HC groups showed similar community richness and diversity. The members of LAB, Lactococcus and Lactococcus lactis significantly decreased in saliva of OLP cases and negatively associated with OLP severity. In addition, Lactococcus and Lactococcus lactis showed negative relationship with Fusobacterium and Aggregatibacter, which were considered as potential pathogens of OLP. Similarly, compared with healthy controls, the amount of Lactococcus lactis in mucosa lesion of OLP patients was significantly decreased.
Conclusions
A lower amount of Lactococcus at genus level, Lactococcus lactis at species level was observed in OLP cases and associated with disease severity. Further studies to verify the relationship between LAB and OLP, as well as to explore the precise mechanism is needed.
Background
Oral lichen planus (OLP) is a common inflammatory disease, which affects approximately 1.5% of the general population and is prevalent among middle-aged and elderly women [1]. It is classified as an oral potentially malignant disorder, and the malignant transformation rate is 0.44–2.28% [2]. Although OLP has been extensively studied, its etiopathogenesis is unclear. OLP is a multifactorial disease, with genetic predisposition, psychological factors, immune dysregulation, and microbial infection being the potential triggers [3, 4]. Previous studies have reported that the structure and composition of oral microbiota changes in OLP and could be related to the progression of the disease [5, 6]. Human microbiome has been related to host health. The oral microbiota is the second largest bacteria community of the body, comprising mostly commensal bacteria. Under certain conditions, oral microbiota undergoes compositional and/or functional alterations (dysbiosis) that lead to inflammation and abnormal immune response, contributing to several local and systemic diseases [7]. Previous studies have reported oral microbial dysbiosis in OLP patients, and several microorganisms have been identified to be associated with disease progression, including Prevotella and Fusobacterium [8,9,10]. Although the possible role of microbiome in OLP has been reported, same dominant pathogenic bacteria have not been identified in previous studies. Several studies have reported the decreased abundance of Streptococcus [10,11,12,13], a member of lactic acid bacteria (LAB), in OLP cases, indicating the close relationship between them. Moreover, LAB inhibit the growth of uropathogens, enteropathogens, and oral pathogens, but their infection-fighting mechanism is complex and unclear [14, 15]. However, the potential effect of friendly microbes, such as LAB, on the pathogenesis of OLP and their correlation with OLP disease severity has not been elucidated. Most previous studies have investigated the difference in highly abundant flora between OLP and control population; therefore, the clinical value and mechanisms of potential disease-related microbes with low abundance may have been overlooked.
In the present study, we investigated the difference in the oral microbiota composition between OLP patients and healthy control (HC) participants, with a focus on the abundance of LAB.
Methods
Participants
This study was approved by the Peking University Institutional Review Board, China [PKUSSIRB 202161004]. Participants were enrolled in Department of Oral Medicine, Peking University School and Hospital of Stomatology, China. We have followed the guidelines of the Helsinki Declaration in this investigation.
Inclusion criteria of patients with OLP
(1) age: 18–65 years; (2) number of natural teeth remaining: ≥20; and (3) OLP patients who were clinically and histologically diagnosed according to the World Health Organization (WHO) criteria (2003) [16].
The HC group included individuals without oral mucosa diseases.
Participant exclusion criteria
(1) pregnancy or lactation; (2) other known oral mucosal diseases; (3) life-threatening systemic diseases or autoimmune diseases; (4) use of immunomodulator or antibiotic within the 1-month-period before the start of the study; (5) use of any mouthwash within the 7-day-period before the start of the study; (6) tobacco or alcohol use; (7) severe periodontitis (clinical attachment loss: ≥5 mm, probing depth (PD): >6 mm, and extension of bone loss to the apical portion of the root), visible caries, and dentures.
The present study had two cohorts. We collected 43 saliva samples from patients with OLP (n = 21) and HC individuals (n = 22) and performed 16 S rRNA gene high-throughput sequencing in cohort 1. Cohort 2 included 24 swab samples of normal buccal mucosa (n = 10) and OLP buccal mucosa lesion (n = 14) to detect the amount of Lactococcus lactis. Clinical information on 2 cohorts was presented in Table 1.
Clinical examination
The severity of OLP lesions was evaluated using the reticular/hyperkeratotic, erosive/erythematous, ulcerative (REU) scoring system, as reported in a previous study [17]. Briefly, the scores were assigned based on the examination of reticular/hyperkeratotic (R) (0: none; 1: present), erythematous (E) and/or ulcerative (U) lesions (0: none; 1: lesions < 1 cm2; 2: lesions ranging in size from 1 to 3 cm2; 3: lesions > 3 cm2), and the total REU score was calculated as follows: REU = ∑ (R + E × 1.5 + U × 2.0).
Sample collection
All participants were instructed to avoid drinking or eating for 2 h before sampling. Samples were obtained between 8:00 to 11:00 AM. We collected 5 mL of whole unstimulated saliva in a sterile conical tube from each participant in cohort 1 using standard techniques. The tube containing saliva was centrifuged at 12,000 g for 15 min, the supernatant was removed and the precipitate was kept. Samples of cohort 2 were obtained by rotating a swab pressed to the buccal mucosa. All samples were stored at − 80 °C for further analyses [18].
DNA extraction, amplicon generation for sequencing
Total DNA from each sample in cohort 1 was extracted using the cetyltrimethyl ammonium bromide method [19]. DNA concentration and purity were evaluated on 1% agarose gels. After quantitation, DNA samples were diluted using sterile water to a final concentration of 1 ng/µL. The V3–V4 region of the 16 S rRNA gene was amplified by polymerase chain reaction (PCR) from the diluted DNA samples using the bacterial universal primers 343 F (5’-TACGGRAGGCAGCAG-3’) and 798R (5’-AGGGTATCTAATCCT-3’) in a T100PCR (BioRad, Hercules, CA, USA). Next, the obtained PCR products were mixed and purified using the Qiagen Gel Extraction Kit (Qiagen, Hilden, Germany).
Relative expression of Lactococcus lactis in HC and OLP by real-time PCR
Total bacteria DNA was extracted from mucosa swab using TIANamp Bacteria DNA Kit (DP302, TianGen Biotech, Beijing, China). And the quantitative PCR was performed using Universal SYBR Green Fast qPCR Mix (RK21203, ABclonal, Wuhan, China) following the protocol. Primers were: 16S rRNA universal: (F)5’- CGCTAGTAATCGTGGATCAGAATG-3’ and (R) 5’-TGTGACGGGCGGTGTGTA-3’ [20]; Lactococcus lactis: (F)5’- TGTCACAAGCCATGCGTAAAC − 3’ and (R)5’- CACGCAATTGGTTGATGAAAA − 3’ [21]. The expression level of Lactococcus lactis were normalized to 16 S rRNA universal and were calculated using 2−∆∆Ct method.
Sequence and data analysis
Sequencing libraries were generated using the TruSeq® DNA PCR-Free Sample Preparation Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions, and index codes were added. The quality of the library was assessed using a Qubit@ 2.0 fluorometer (Life Technologies, Carlsbad, CA, USA). Finally, the PCR products were sequenced and analyzed using the Novaseq 6000 platform (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions.
The sequencing reads were assigned to each sample according to their unique barcode. Paired-end reads were preprocessed using the Cutadapt software to detect and cut off the adapter. After trimming paired-end reads, low quality sequences were filtered, denoised, merged, and chimera reads were detected and cut off using DADA2 with the default parameters of the QIIME 2 platform [22, 23]; amplicon sequence variant (ASV) abundance table was obtained as the output.
The representative read of each ASV was selected using the QIIME 2 package. All representative reads were annotated and blasted against the SILVA database using the q2-feature-classifier with default parameters. The microbial diversity in WUS samples was estimated using the alpha diversity indexes, namely Chao1 and Shannon indexes, which measure species richness and species diversity, respectively, in a sample. The Binary Jacard algorithm run in the QIIME platform was used for UniFrac principal coordinates analysis (PCoA). A linear discriminant analysis effect size (LefSe) algorithm was used to identify potential biomarkers of OLP, and the linear discriminant analysis (LDA) threshold was set as 3.
Statistical analyses
Data were analyzed using the SPSS version 26.0 statistical package (SPSS® Inc., Chicago, IL, USA). Graphs were prepared using the software GraphPad Prism 9 (GraphPad Software, San Diego, CA, USA). Normality and homogeneity of variance were evaluated. Categorical data were analyzed using the Chi-square test or Fisher’s exact test for different groups. Continuous data were presented as mean ± standard deviation (SD), and independent-samples t-test or nonparametric test was used to analyze difference in data between two groups. Correlation analysis was performed using Spearman’s correlation coefficient. Differences were considered significant at P < 0.05.
Results
Sequence data
A total of 2,649,963 merged sequenced reads were obtained from all samples of both groups. The clean tags ranged between 35,446 and 71,753 reads after quality control. After removing chimera sequences, the valid tags ranged between 29,387 and 68,865 reads, with an average of 61,627 sequences for each sample. Finally, 120 to 1048 ASVs were identified. OLP and HC groups shared 981 ASVs. Moreover, the rarefaction curve tended to be flat, indicating that the 16 S rRNA gene sequences identified in this study represented the majority of the bacteria present in saliva samples.
Species richness and diversity of oral microbiota in OLP and HC groups
Alpha diversity analysis, based on Chao 1 and Shannon indexes, did not reveal significant differences in species richness and diversity, respectively, of oral microbiota between OLP and HC groups (P > 0.05; Fig. 1A, B).
The PCoA plot revealed obvious separation between HC and OLP groups, indicating that the overall structure of the bacterial community in the two groups was significantly different (P = 0.041). Moreover, the OLP patients exhibited distinct discrete characteristics, indicating extensive heterogeneity (Fig. 1C). PC1 explained 7.36% variability, whereas PC2 explained 4.16% variability.
Phylum- and genus-level identification of saliva microbiota in OLP and HC groups
All operational taxonomic units obtained from both groups were clustered into 9714 ASVs, representing 42 phyla, 105 classes, 243 orders, 390 families, and 755 genera.
At the phylum level, 98% sequences belonged to Proteobacteria, Firmicutes, Bacteroidota, Fusobacteria, Actinobacteria, and Patescibacteria in both OLP and HC groups. Moreover, Patescibacteria exhibited higher abundance in the HC group than in the OLP group (Fig. 2A).
At genus level, the relative abundance of 15 genera was > 1% in both OLP and HC groups, with Neisseria and Streptococcus accounting for approximately 20%, and Haemophilus and Prevotella accounting for approximately 10%. The abundance between two groups showed no significant difference (Fig. 2B).
LDA using LefSe revealed differences between OLP and HC groups at different taxonomic levels, including 3 phyla, 4 classes, 6 orders, 10 families. and 16 genera. Moreover, compared with those in the HC group, the abundance of Patescibacteria (phylum level), Gracilibacteria (class level), and Absconditabacteriales_SR1 (order, family, and genus levels) was significantly decreased in the OLP group, whereas that of Achromobacter and Citrobacter at the genus level was significantly increased (Fig. 2C).
Abundance of LAB in OLP and HC groups
Next, we investigated the composition of LAB at the genus level in OLP and HC groups. The abundance of Streptococcus, Selenomonas, Lactobacillus, Abiotrophia, and Enterococcus did not exhibit significant differences between OLP and HC groups, whereas the abundance of Lactococcus was significantly lower in the OLP group than in the HC group. Moreover, the abundance of Lactococcus lactis was significantly decreased in OLP patients compared with that in HC participants (Fig. 3). The real-time PCR of swab sample in cohort 2 further validated that Lactococcus lactis presented lower amount in patients with OLP rather than HC with statistically significance (Fig. 4).
Potential impact of LAB on microbiome composition shift in OLP
Further, we investigated the co-occurrence of LAB and other bacterial genera in both groups. Lactococcus and Lactococcus lactis were significantly negatively related with Fusobacterium (ρ=-0.377, P = 0.013; ρ=-0.368, P = 0.015). Moreover, Aggregatibacter (ρ=-0.352, P = 0.021; ρ=-0.336, P = 0.028) showed similar relevance. Streptococcus was significantly negatively correlated with Fusobacterium (ρ=-0.594, P < 0.001), Alloprevotella (ρ=-0.510, P < 0.001), Prevotella (ρ=-0.331, P = 0.030), and Leptotrichia (ρ=-0.329, P = 0.031). However, Gemella was positively associated with Streptococcus (ρ = 0.470, P = 0.001); (Fig. 5A; Appendix 1).
Relationship between LAB and clinical features of OLP patients
The association between LAB and other key microbes (the differential flora between OLP and HC or LAB related flora mentioned before) with OLP disease severity was analyzed using Spearman’s rank correlation coefficient. LAB, namely Streptococcus, Lactococcus, and Lactococcus lactis, were negatively correlated with REU score. However, the non-LAB genera, Fusobacterium, Alloprevotella, Aggregatibacter, Leptotrichia, and Prevotella were positively correlated with REU score (Fig. 5B).
Discussion
In the present study, we elucidated that the alpha diversity of oral microbiota of both OLP and HC groups did not exhibit any significant differences, which is in accordance with the results of previous studies [13, 24]. Moreover, despite the overlap as per the PCoA plot between the microbiota composition of both groups, separation in beta diversity was observed; the microorganism distribution in the OLP group was more heterogeneous than in the HC group.
Streptococcus is the most commonly reported LAB, and its abundance has been reported to significantly decrease in OLP patients [10, 12, 13]. In a previous study, the abundance of Streptococcus salivarius was lower in OLP patients than in HC participants, and the supplementation of the bacterium in diet as a probiotic alleviated OLP lesions [25]. This could be because of its ability to inhibit NF-κB pathway activation, resulting in downregulation of innate immunity including inflammatory response of epithelial cells. While others like Streptococcus pyogenes, Streptococcus agalactiae and Streptococcus pneumoniae may be pathogens, even in OLP. In contrast, Streptococcus intermedius and Streptococcus oralis are considered potential pathogens in OLP patients, but the underlying mechanisms of their pathogenic activity are unclear [26]. Therefore, the abundance of different species of the Streptococcus in oral microbiota of OLP patients should be investigated in future studies.
To the best of our best knowledge, this is the first study to establish a relationship between LAB and OLP. LAB are a clade of gram-positive, catalase-negative, acid-fast bacteria, and Streptococcus, Lactobacillus, Lactococcus, Leuconostoc, and Pediococcus are the key members of LAB. In humans, they are a part of the oral microbiota. They share metabolic and physiological characteristics, mainly the production of lactic acid from sugars. Furthermore, some LAB species produce antimicrobial peptides known as bacteriocins; they also produce bioactive peptides with anticancer effect that are more effective at higher concentrations [27]. Numerous studies have reported anti-inflammatory and homeostatic effects of LAB, and they have been used to treat and prevent immune and inflammatory disorders, such as atopic dermatitis, inflammatory bowel disease, and multiple sclerosis [28, 29].
In the present study, at the genus level, only Lactococcus exhibited extremely decreased abundance in OLP patients. Lactococcus and Streptococcus were negatively correlated with OLP disease severity (REU score), suggesting that lower abundance of certain LAB species may lead to the deterioration of oral condition in OLP patients. LAB can modulate the composition of microbiota, by increasing the abundance of beneficial bacteria and decreasing that of harmful bacteria [30]. This is in accordance with our results that putative harmful bacteria exhibited negative correlation with LAB and positive correlation with disease severity (REU score).
Moreover, the abundance of Lactococcus lactis was lower in OLP patients than in HC participants. Correlation analysis revealed that higher abundance of Lactococcus lactis suggests alleviation in OLP. A previous study reported that higher abundance of Lactococcus lactis reduces inflammatory cytokine levels and protects against intestinal barrier damage in mice [31]; they are able to selectively degrade proinflammatory cytokines in inflamed intestinal tissue [32], suggesting that they have the potential to protect individuals from OLP lesions. Furthermore, Lactococcus lactis secrete lactocepins, bacterial enzymes, which can degrade other bacteria. Lipopeptides derived from Lactococcus lactis, lactococcin Gb acted to inhibit certain infection like SARS-CoV-2 [33]. Lactococcus lactis LB 1022 exhibited nitric oxide (NO) suppression and increased the concentration of short-chain fatty acids (SCFAs) [34]. It has been found that NO level in the saliva and serum of OLP patients was significantly increased compared with HC [35]. This kind of oxidative stress damage may disrupt cellular proteins, DNA, lipids, and activate cellular immunity, contributing to pathogenesis of OLP [36]. On the other hand, SCFAs contribute to improving mucosa barrier damage in intestine of rat [37]. Shortage of Lactococcus lactis might produce less SCFAs, weakening capacity to repairing damaged mucosa barrier, which was believed to be related to the development of OLP [38]. An inverse statistical correlation was found between Lactococcus lactis and the putative harmful bacteria Fusobacterium and Aggregatibacter. However, the interaction between them should be further investigated in vivo and in vitro. This provides new insight into the potential of Lactococcus lactis as an adjunctive medication for OLP patients.
Moreover, this study elucidated that the abundance of opportunistic pathogens like Citrobacter increased in OLP patients compared with that in HC participants, and Citrobacter was positively related with severity of OLP. Similarly, in a previous study, higher abundance of Citrobacter freundii was associated with increased epithelial damage [39]. Perhaps it plays an important role in the progression of OLP disease even may play a part in its malignancy. Citrobacter was found to be one of the main microbes isolated from the oral squamous cell carcinoma sites [40], and supplementation of diet with LAB may reverse this phenomenon. As per animal studies, Citrobacter rodentium is a pathogen that can cause mucosa inflammation. In contrast, probiotic strains Lactobacillus reuteri and Lactobacillus acidophilus can relieve the severity of Citrobacter rodentium infections [41, 42]. However, longitudinal studies are required to establish whether Citrobacter can be used an indicator of OLP deterioration.
Therefore, in the present study, we elucidated that the decrease in the abundance of LAB could play a role in the onset or progression of OLP. However, 16 S rRNA sequencing is not suitable for identification at the species level, and other precise techniques should be developed to investigate the role of specific species in the pathogenesis of OLP; this could also help in the development of a probiotic-based treatment strategy for OLP.
Data availability
Sequence data that support the findings of the study are available in the NCBI Sequence Read Archive (SRA) repository under the BioProject ID PRJNA1049117. (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1049117).
Abbreviations
- OLP:
-
Oral lichen planus
- HC:
-
Healthy control
- LAB:
-
Lactic acid bacteria
- PD:
-
Probing depth
- REU:
-
Reticular/hyperkeratotic, erosive/erythematous, ulcerative
- PCR:
-
Polymerase chain reaction
- ASV:
-
Amplicon sequence variant
- PCoA:
-
Principal coordinates analysis
- LefSe:
-
Linear discriminant analysis effect size
- LDA:
-
Linear discriminant analysis
- SD:
-
Standard deviation
References
Ioannides D, Vakirlis E, Kemeny L, Marinovic B, Massone C, Murphy R, et al. European S1 guidelines on the management of lichen planus: a cooperation of the European Dermatology Forum with the European Academy of Dermatology and Venereology. J Eur Acad Dermatol Venereol. 2020;34:7.
Ramos-García P, González-Moles M, Warnakulasuriya S. Oral cancer development in lichen planus and related conditions-3.0 evidence level: a systematic review of systematic reviews. Oral Dis. 2021;27:8.
Olson MA, Rogers RS 3rd, Bruce AJ. Oral lichen planus. Clin Dermatol. 2016;34:4.
Cerqueira JDM, Moura JR, Arsati F, Lima-Arsati YBO, Bittencourt RA, Freitas VS. Psychological disorders and oral lichen planus: a systematic review. J Invest Clin Dent. 2018;9:4.
Li Y, Wang K, Zhang B, Tu Q, Yao Y, Cui B, et al. Salivary mycobiome dysbiosis and its potential impact on bacteriome shifts and host immunity in oral lichen planus. Int J Oral Sci. 2019;11:2.
Baek K, Choi Y. The microbiology of oral lichen planus: is microbial infection the cause of oral lichen planus? Mol oral Microbiol. 2018;33:1.
Kleinstein SE, Nelson KE, Freire M. Inflammatory networks linking oral microbiome with systemic health and disease. J Dent Res. 2020;99:10.
Yan C-X, Wang K, Zhang B, Xiao L-Y, Li S-Z, Deng Y et al. Structural Analysis of Salivary Bacterial and Fungal Microbiome in Oral Lichen Planus Patients. Sichuan da xue xue bao Yi xue ban = Journal of Sichuan University Medical science edition. 2022;53:2.
Du GH, Wang YF, Chen JJ, Deng YW. Han XZ, Tang GY. potential association between Fusobacterium nucleatum enrichment on oral mucosal surface and oral lichen planus. Oral Dis. 2020;26:1.
He Y, Gong D, Shi C, Shao F, Shi J, Fei J. Dysbiosis of oral buccal mucosa microbiota in patients with oral lichen planus. Oral Dis. 2017;23:5.
Li S, Zhang Y, Yang Z, Li J, Li Y, Li H, et al. Helicobacter pylori infection is correlated with the incidence of erosive oral lichen planus and the alteration of the oral microbiome composition. BMC Microbiol. 2021;21:1.
Wang X, Zhao Z, Tang N, Zhao Y, Xu J, Li L et al. Microbial Community Analysis of Saliva and biopsies in patients with oral Lichen Planus. Front Microbiol. 2020;11.
Choi YS, Kim Y, Yoon HJ, Baek KJ, Alam J, Park HK et al. The presence of bacteria within tissue provides insights into the pathogenesis of oral lichen planus. Sci Rep. 2016;6.
Mokoena MP. Lactic acid Bacteria and their bacteriocins: classification, biosynthesis and applications against Uropathogens: a Mini-review. Molecules. 2017;22:8.
Zhang Y, Ding Y, Guo Q. Probiotic species in the management of Periodontal diseases: an overview. Front Cell Infect Microbiol. 2022;12.
van der Meij EH, van der Waal I. Lack of clinicopathologic correlation in the diagnosis of oral lichen planus based on the presently available diagnostic criteria and suggestions for modifications. J Oral Pathol Med. 2003;32:9.
Park HK, Hurwitz S, Woo SB. Oral lichen planus: REU scoring system correlates with pain. Oral surgery, oral medicine, oral pathology and oral radiology. 2012;114:1.
Pekiner FN, Demirel GY, Borahan MO, Ozbayrak S. Cytokine profiles in serum of patients with oral lichen planus. Cytokine. 2012;60:3.
Wang L, Stegemann JP. Extraction of high quality RNA from polysaccharide matrices using cetyltrimethylammonium bromide. Biomaterials. 2010;31:7.
Zheng X, Tizzano M, Redding K, He J, Peng X, Jiang P, et al. Gingival solitary chemosensory cells are immune sentinels for periodontitis. Nat Commun. 2019;10:1.
Stevenson DM, Muck RE, Shinners KJ, Weimer PJ. Use of real time PCR to determine population profiles of individual species of lactic acid bacteria in alfalfa silage and stored corn stover. Appl Microbiol Biotechnol. 2006;71:3.
Callahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJ, Holmes SP. DADA2: high-resolution sample inference from Illumina amplicon data. Nat Methods. 2016;13:7.
Bolyen E, Rideout JR, Dillon MR, Bokulich NA, Abnet CC, Al-Ghalith GA, et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat Biotechnol. 2019;37:8.
Wang K, Lu W, Tu Q, Ge Y, He J, Zhou Y et al. Preliminary analysis of salivary microbiome and their potential roles in oral lichen planus. Sci Rep. 2016;6.
Li Y, Shao F, Zheng S, Tan Z, He Y. Alteration of Streptococcus salivarius in buccal mucosa of oral Lichen Planus and Controlled Clinical Trial in OLP Treatment. Probiotics Antimicrob Proteins. 2020;12:4.
Zhong EF, Chang A, Stucky A, Chen X, Mundluru T, Khalifeh M, et al. Genomic analysis of oral Lichen Planus and related oral Microbiome pathogens. Pathogens. 2020;9:11.
Mahmoudi M, Khomeiri M, Saeidi M, Davoodi H, Memarian A. Anticancer potential of fermented milk with autochthonous lactic acid bacteria. J Appl Microbiol. 2023.
Xie A, Chen A, Chen Y, Luo Z, Jiang S, Chen D et al. Lactobacillus for the treatment and prevention of atopic dermatitis: clinical and experimental evidence. Front Cell Infect Microbiol. 2023;13.
Un-Nisa A, Khan A, Zakria M, Siraj S, Ullah S, Tipu MK, et al. Updates on the role of probiotics against different Health issues: focus on Lactobacillus. Int J Mol Sci. 2022;24:1.
Burakova I, Smirnova Y, Gryaznova M, Syromyatnikov M, Chizhkov P, Popov E, et al. The effect of short-term consumption of lactic acid Bacteria on the gut microbiota in obese people. Nutrients. 2022;14:16.
Chen Y, Qiao L, Song X, Ma L, Dou X, Xu C. Protective effects of Selenium nanoparticle-enriched Lactococcus lactis NZ9000 against Enterotoxigenic Escherichia coli K88-Induced Intestinal Barrier damage in mice. Appl Environ Microbiol. 2021;87:23.
Engevik MA, Versalovic J. Biochemical features of Beneficial microbes: foundations for therapeutic Microbiology. Microbiol Spectr. 2017;5:5.
Manna S, Chowdhury T, Chakraborty R, Mandal SM. Probiotics-derived peptides and their Immunomodulatory molecules can play a preventive role against viral diseases including COVID-19. Probiotics Antimicrob Proteins. 2021;13:3.
Baek J, Kim JH, Kim W. Potential Anti-allergy and Immunomodulatory properties of Lactococcus lactis LB 1022 observed in vitro and in an atopic Dermatitis Mouse Model. J Microbiol Biotechnol. 2023;33:6.
Wang J, Yang J, Wang C, Zhao Z, Fan Y. Systematic Review and Meta-Analysis of Oxidative Stress and Antioxidant Markers in Oral Lichen Planus. Oxid Med Cell Longev. 2021;2021.
Jana A, Thomas J, Ghosh P. Erosive oral lichen planus inflicts higher cellular stress than reticular type. J Oral Maxillofac Pathol. 2021;25:2.
Sun Y, Song J, Lan X, Ma F, Jiang M, Jiang C. Calcium-sensitive receptors alters intestinal microbiota metabolites especially SCFAs and ameliorates intestinal barrier damage in neonatal rat endotoxemia. Infect Drug Resist. 2023;16.
Ren X, Li K, Fang X, Zhu Z, Chen Q, Li C et al. Oral mucosal changes in tight junction proteins in patients with oral lichen planus. Oral Dis. 2024.
Kortman GA, Boleij A, Swinkels DW, Tjalsma H. Iron availability increases the pathogenic potential of Salmonella typhimurium and other enteric pathogens at the intestinal epithelial interface. PLoS ONE. 2012;7:1.
Byakodi R, Krishnappa R, Keluskar V, Bagewadi A, Shetti A. The microbial flora associated with oral carcinomas. Quintessence international (Berlin, Germany: 1985). 2011;42:9.
Mackos AR, Eubank TD, Parry NM, Bailey MT. Probiotic Lactobacillus reuteri attenuates the stressor-enhanced severity of Citrobacter rodentium infection. Infect Immun. 2013;81:9.
Hrdý J, Couturier-Maillard A, Boutillier D, Lapadatescu C, Blanc P, Procházka J, et al. Oral supplementation with selected Lactobacillus acidophilus triggers IL-17-dependent innate defense response, activation of innate lymphoid cells type 3 and improves colitis. Sci Rep. 2022;12:1.
Acknowledgements
We appreciate the native English-speaking professional with science background at Elixigen Corporation for editing this manuscript.
Funding
This work was supported by grants from the National Natural Science Foundation of China [grant number 81730030]; the Program for New Clinical Techniques and Therapies of Peking University School and Hospital of Stomatology [grant number PKUSSNCT-22B11]; and the Young People Fund of Peking University School and Hospital of Stomatology [grant numbers PKUSS20220103].
Author information
Authors and Affiliations
Contributions
HH, CLL: Study and conception and design. XMR, DL, MMZ: Sample and Data collection. XMR, CLL: Statistical Analysis and interpretation of results. XMR, CLL: Draft manuscript preparation.
Corresponding author
Ethics declarations
Ethics approval and consent to participate
This study was approved by the Peking University Institutional Review Board, China [PKUSSIRB 202161004]. And informed consent was obtained from all participants.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Additional information
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Ren, X., Li, D., Zhou, M. et al. Potential role of salivary lactic acid bacteria in pathogenesis of oral lichen planus. BMC Microbiol 24, 197 (2024). https://doi.org/10.1186/s12866-024-03350-0
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s12866-024-03350-0