Skip to main content

Impact of Limosilactobacillus fermentum probiotic treatment on gut microbiota composition in sahiwal calves with rotavirus diarrhea: A 16S metagenomic analysis study”

Abstract

Background

Diarrhea poses a major threat to bovine calves leading to mortality and economic losses. Among the causes of calf diarrhea, bovine rotavirus is a major etiological agent and may result in dysbiosis of gut microbiota. The current study was designed to investigate the effect of probiotic Limosilactobacillus fermentum (Accession No.OR504458) on the microbial composition of rotavirus-infected calves using 16S metagenomic analysis technique. Screening of rotavirus infection in calves below one month of age was done through clinical signs and Reverse Transcriptase PCR. The healthy calves (n = 10) were taken as control while the infected calves (n = 10) before treatment was designated as diarrheal group were treated with Probiotic for 5 days. All the calves were screened for the presence of rotavirus infection on each day and fecal scoring was done to assess the fecal consistency. Infected calves after treatment were designated as recovered group. Fecal samples from healthy, recovered and diarrheal (infected calves before sampling) were processed for DNA extraction while four samples from each group were processed for 16S metagenomic analysis using Illumina sequencing technique and analyzed via QIIME 2.

Results

The results show that Firmicutes were more abundant in the healthy and recovered group than in the diarrheal group. At the same time Proteobacteria was higher in abundance in the diarrheal group. Order Oscillospirales dominated healthy and recovered calves and Enterobacterials dominated the diarrheal group. Alpha diversity indices show that diversity indices based on richness were higher in the healthy group and lower in the diarrheal group while a mixed pattern of clustering between diarrheal and recovered groups samples in PCA plots based on beta diversity indices was observed.

Conclusion

It is concluded that probiotic Limosilactobacillus Fermentum N-30 ameliorate the dysbiosis caused by rotavirus diarrhea and may be used to prevent diarrhea in pre-weaned calves after further exploration.

Peer Review reports

Background

Diarrhea results in heavy losses in terms of mortality and economics and is regarded as a major intestinal disease in calves [1]. It has been reported that up to 57% of mortality in calves especially in calves of less than one month of age occurs due to diarrhea [2]. Different infectious agents are responsible for causing diarrhea. Among the viral agents rotavirus is considered a major etiological agent causing acute diarrhea in cattle calves globally [3, 4],

Bovine rotavirus infects calves below 2 weeks of age and takes 12–24 h (incubation period) to produce diarrhea with excretion of virus in affected calves occuring within 5–7 days via feces. The excretion of virus thus predisposes the environment to contamination and a source of spreading the infection to uninfected calves [5]. Diarrhea appears when the destruction of epithelial cells of villi occurs. Vasoactive components like histamine and viral enterotoxin contribute to malabsorption and ultimately lead to diarrhea [6]. The pathogens responsible for causing intestinal infections are believed to result in disturbing the normal microbial composition of the intestinal tract, which can further worsen or intensify the symptoms of diarrhea. Infection with rotavirus has been proven to affect the microbiota of the intestine and results in its alteration in terms of bacterial taxa abundance, diversity, homogeneity and overall configuration [7]. The normal balanced gut microbiota impedes the invasion of the intestine by pathogens and helps in strengthening the immune system in the early days of life via interaction of the antigens with the defense system of the body. Dysbiosis in intestinal microbiota may promote inflammation in the intestine, alteration in immune response and affect the utilization of nutrients by intestinal flora and their competition with pathogens for these nutrients [8].

Rotavirus is a viral disease and it has no specific treatment and it is majorly treated symptomatically by providing supportive options including fluid therapy to recover fluid losses and restore electrolyte imbalance [9]. Different studies have reported that restoring normal gastrointestinal microbiota is an effective prophylactic and therapeutic strategy for infections of GIT [10, 11]. Restoring the imbalance of microbiota through fecal transplantation from healthy animals has proven successful in reducing diarrhea in calves [12]. Beneficial living microorganisms known as probiotics are known for their use as therapeutic and prophylactic purposes in gastroenteritis and exerting beneficial effects on improving gut health, enhancing immunity [13, 14] and improving and regulating the balance of gut microbiota [15, 16]. Rumen ecosystem improves after adding probiotics in feed due to the enzymes produced by these bacteria and enhancement in beneficial bacterial communities growth and function leads to stabilization of normal GIT microbiota [17]. Use of multispecies probiotics has shown promising results in shortening the duration of diarrhea in calves [18]. Probiotic bacterial strains of Bifidobacterium and Lactobacillus are found to have positive impact in combating rotavirus infection [19, 20]. The findings of a study also show that use of a milk replacer having a multispecies probiotic added lessens the intensity of BRV(Bovine RotaVirus) induced diarrhea and reduces the intestinal lesions due to enteritis [21], Therefore use of probiotics may be a possible therapeutic or prophylactic option in controlling diarrhea induced by viral enteropathogens such as BRV by restoring normal gut microbial commmunaties. The current study is designed to study the effect of single species probiotic (bovine intestinal origin) on fecal microbial composition and to check the differences in fecal microbiota in healthy, rotavirus-infected calves and recovered calves after administering probiotic. The variations detected in study groups will help in identifying the signature microbes that are known to increase or decrease with the rotavirus infection and the effect of probiotic on the microbiota of recovered calves. The findings will also help in selecting beneficial bacteria that are identified in healthy and recovered calves for future use as a candidate for use as probiotic in controlling the disease.

Methods

Sample collection and processing

The sampling for this study was carried out at Livestock Production and Research Institute (LPRI) Bahadar Nagar, 56,300 Okara- Pakistan. The calves used in this research was of Sahiwal breed and below one month of age reared under similar husbandry conditions and fed milk through buckets (Supplementary Table. S1) At the first step a total of 20 calves were enrolled including ten healthy calves and ten calves having diarrhea and found positive for rotavirus infection. Screening of the calves for the presence of rotavirus infection was done through visual inspection of clinical signs (fecal scoring) [22]and confirmation through Reverse Transcription Polymerase Chain Reaction (RT-PCR) from fecal samples. Viral RNA extraction was done from fecal samples using GeneJet RNA purification kit (Thermo, USA) followed by cDNA synthesis through Thermo Scientific Revert Aid First Strand cDNA Synthesis kit (Thermo, USA) following the guidelines outlined in the manufacturer instructions manual [23]. Bovine rotavirus was confirmed by targeting the VP6 gene for amplification using specific primers [24]. Healthy calves were taken as control while calves having rotavirus infection were named as as diarrheal group before treatment and were given an oral dose (1 × 108CFU/ml) of Probiotic (Limosilactobacillus fermentum N-30, NCBI Accession No.OR504458) for 5 days. The probiotic strain (Limosilactobacillus fermentum N-30 isolated from Sahiwal cattle calves feces and already characterized and tested for probiotic properties) was taken from Probiotic research laboratory, Institute of Microbiology, UVAS Lahore. The diarrheal group was designated as recovered group after treatment. No medicines were given to the calves having diarrhea during the course of experiment except probiotics. Furthermore the fecal scoring (Supplementary Table. S1) and screening using RT PCR was daily done. The treatment was continued till the diarrhea completely subsided and fecal samples were found negative for rotavirus. Fecal sampling for metagenomic analysis was done at two instances i.e. before starting treatment from healthy group and diarrheal group and after the treatment from recovered calves. 20gm fecal sample from each calf was collected in air tight specimen collection container and transportation was done at controlled temperature (4 °C). Samples were kept at -20 °C before processing. All the laboratory work was carried out at Probiotic Research Laboratory, Institute of Microbiology, University of Veterinary and Animal Sciences (UVAS), Lahore.

Bacterial DNA extraction and quality check

Processing of the samples was carried out within 24 h of collection. Initially all the samples were processed for DNA extraction using the kit method (Fast DNASpin Kit (MP Biomedicals) following the instructions of the manufacturer [25]. Two methods were used to assess the quality and quantity of extracted DNA. Spectrophotometric method, in which the DNA(quantity and quality) was assessed through Multiskan Sky microplate spectrophotometer (Thermoscientific, Waltham, MA, USA). Samples passing the criteria of having O.D in the range of 1.6–1.9 at 260/280nm were further subjected to16S rDNA amplification using set of universal primer i.e.8FLP and XB4 primers (AGTTTGATCCTGGCTCAG, GTGTGTACAAGGCCCGGGAAC) as described previously [26]. The amplified products were checked for the presence of band using 1.5% agarose gel. Among all DNA samples, 12 samples were processed for metagenomic analysis. Four samples were selected from each of the healthy, diarrheal and recovered group for metagenomic analysis. Samples were properly labeled, packed and dispatched to Macrogen (Seoul, South Korea) for further processing for metagenomic sequencing targeting 16S rRNA gene.

Sequencing and microbiome analysis

Briefly, target regions (V3 and V4) for 16S rDNA were amplified with a set of primers including 341F (5′-CCTAYGGGRBGCASCAG-3′) and 806R (5′-GGACTACNNGGGTATCTAAT-3′) utilizing specific barcode [17]. MiSeq (2 × 300 bp) platform was used for sequencing through the Illumina DNA Prep Kit (Illumina, San Diego, CA, USA).The Illumina 16S Metagenomic Sequencing Library Preparation Part #15044223 Rev. B document’s instructions were adopted during the library preparation step, as stated in the protocol.

Bioinformatics analysis was performed using QIIME 2(Version 2.2020.6) [27]. Raw reads (pair end) were imported to QIIME pipeline through import command mentioned in the guidelines available in QIIME 2 online tutorial. The refinement of overall sequence quality was achieved by removing noisy data through DADA2’s denoise-paired approach [28]. A 300 bp criteria was selected for trimming and sequences within this criterion were further processed by excluding longer and chimeric sequences. The operational taxonomic units (OTU’s)based classification of bacteria at different taxonomic levels was performed with SILVA database used as a reference and with a threshold of 99% similarity [29].Venn diagrams were used to show the similar and distinct taxa at different levels. Frequency tables were generated in QIIME 2 and bacterial taxonomic composition was graphically presented using taxa barplots and heat maps.

Statistical analysis

Diversity within the samples was assessed with alpha diversity indices [30] specifically Shannon, Simpson, Chao 1 and Observed species and analyzed using the non-parametric Kruskal Wallis test, while between the samples diversity was assessed with beta diversity indices such as weighted UniFrac, un-weighted UniFrac [31, 32], Jaccard and Bray–Curtis dissimilarity indices [33, 34]and analyzed using PERMENOVA. The variations among the bacterial communities at different levelswere assessed using ANOVA (Analysis of variance) though GraphPad Prism 8.0.1. (GraphPad Software, San Diego, CA, USA).

Results

Clinical signs and RT PCR results in healthy diarrheal and recovered groups

The clinical finding and RT PCR results are presented in the supplementary table. S1 indicates that healthy group calves were negative for RT-PCR during the course of experiment. whereas according to fecal scoring of calves treated with probiotic had a fecal scoring of 3, which represents watery consistency of the feces on first day after probiotic treatment and rotavirus was detected in their fecal samples. Improvement in fecal score was observed on 2nd and 3rd day of probiotic administration and all the calves fecal samples were of normal consistency on 4th day and rotavirus was not detected in 4 out of 10 calves. On 5th day all the calves were found negative for rotavirus infection both symptomatically and through RT-PCR.

Bacterial diversity and taxonomic picture at different levels in fecal microbiota of calves

The 16S RNA gene base metagenomic analysis of fecal samples (n = 4) from each of three groups of calves including healthy, diarrheal and recovered groups revealed a total of 34,835 OTU’s with a range of 1384–5088. The OTU’s found in healthy calves group were 15,564 with a range of 2714–5088, while in diarrheal calves group the lowest OTU’s were detected amongst the three groups i.e. 9545 with a range of 1384 to 2938. The total reads detected in recovered calves were 10,726 having a range of 1518–3488.

Distinct and shared bacterial taxa at different taxonomic levels

Fecal microbiota analysis shows that there were collectively 13 phyla that were present within all three groups, with four phyla being common to all of them. Common phyla among all groups included Bacteroidota, Desulfobacterota, Firmicutes and Proteobacteria. The number of detected phyla varied in fecal microbiota of recovered (7), healthy (10) and diarrheal group (9). No distinct phyla were detected in recovered group while 3 (Actinobacteriota, Campilobacterota, Planctomycetota) and 1 (Verrucomicrobiota) distinct phyla were detected in healthy and diarrheal group respectively. Diarrheal group shared 2 phyla each with healthy and recovered group while both healthy and recovered group (Fig. 1A).The total orders that were detected in all the groups were 35 in which distinct orders noted in healthy calves group were 8 and in diarrheal calves group were 4 and only 2 distinct orders were detected in recovered calves group samples as illustrated in Fig. 1B. 14 orders were shared amongst all groups, 3 orders were shared between recovered and diarrheal groups. In contrast, healthy group shared 2 orders with each of the other two groups. A total of 76 genera were detected in all groups, among those diarrheal group contained only 54 genera which were shared with the other two groups and no distinct genera was detected in this group. 14 distinct genera in the healthy calves group was detected while it shared 7 genera with recovered calves group making a total of 75 genera in this group. while 1 genus was distinct in recovered calves group among 62 genera as illustrated in Fig. 1C. The species level analysis resulted in the detection of 78 species distributed among the groups in which 18 distinct species were detected in the recovered calves group, 15 in the diarrheal calves group and 12 in the healthy calves group as represented in Fig. 1D. Nine species were shared between all the groups. While the healthy calves group and the recovered calves group shared 11 species, 9 species were shared between recovered and diarrheal calves group and 4 species between diarrheal and healthy calves group (Fig. 1D).

Fig. 1
figure 1

Shared and distinct taxa observed in fecal microbiota in three groups at (A) Phylum, (B) Order, (C) Genus and (D) Species Level

Differences in bacterial taxonomic composition at different levels

A diverse microbiota was detected at phylum level in fecal samples of all the three groups (Fig. 2). Firmicutes, Bacteroidota and Proteobacteria were the major phyla in fecal microbiota in all the groups. The recovered calves group and healthy calves group was dominated by Firmicutes with percentage abundance of 55.30% and 58.50% respectively followed by Bacteroidota with percentage abundance of 33.66% and 35.90% in recovered calves and healthy calves respectively (Table 1). The diarrheic group showed almost similar percentage abundance of Firmicutes (39.86%) and Bacteroidota (38.40%) as represented in Table 1; Fig. 3. The Proteobacteria phylum abundance was high in the diarrheal group (18.39%) as compared to healthy calves group (1.31%) and recovered calves group (8.38%). In addition to these phyla, Desulfobacterota (0.79%) and Fusobacteriota (0.99%) were highest in recovered group while the diarrheic group contained higher Cyanobacteria (0.97%) compared to other groups.

Table 1 Abundance (%) of bacterial taxa in fecal samples of cattle calves of first week age. Recovered group (n = 4), Diarrheal group (n = 4) and Healthy group (n = 4)
Fig. 2
figure 2

Heat map Sample wise distribution of phyla in fecal microbiota Samples A1-A4 represent recovered calves group, D1-D4 represent diarrheic calves group and H7-H10 represent healthy calves group

Fig. 3
figure 3

Graphical(heat map based) group wise (healthy, diarrheal and recovered calves) comparison of abundant phyla in fecal microbiota. Recovered group (n = 4), Diarrheal group (n = 4) and Healthy group (n = 4)

The major order detected in all the groups was Bacteroidales with high abundance observed in diarrheal calves group (37.84%) followed by recovered calves group (33.58%) and least in healthy group (35.59%) as revealed in Fig. 4. The 2nd abundant order in diarrheal calves group recorded was Enterobacteriales (14.18%) while Oscillospirales was in healthy (22.21%) and recovered group (17.63%). In addition recovered calves group samples other orders including Lanchospirales, (12.92%), Clostridia_UCG_014(6.65%) Enterobacteriales (7.44%) and Lactobacillales (6.98%) were identified. Orders including Lanchospirales(12.20%), Oscillospirales (7.65%) and Clostridia_UCG_014 (1.89%) having more than 1.5% abundance were also recorded in diarrheal calves group. Clostridia_UCG_014 (11.93%), Lanchospirales (9.10%) and Christenellales (5.90%) were the other 3 major orders observed in healthy calves group (Table 1).

Fig. 4
figure 4

Graphical (heat map based) group wise (healthy, diarrheal and recovered calves) comparison of abundant orders in fecal microbiota. Recovered group (n = 4), Diarrheal group (n = 4) and Healthy group (n = 4)

The percentage abundance of different genera is presented in Table 1, in which the Bacteroides representation in all the groups is high, as shown by its percentage abundance in recovered calves group (19.31%), followed by diarrheal calves group (17.58%) and healthy calves group (17.41%). Genus Clostridia_UCG_014 (7%) represented the 2nd most abundant genera in recovered calves group. In comparison Lactobacillus (6.77%) ranked 3rd in terms of abundance as shown in Fig. 5. In the diarrheal calves group Lactobacillus was at 2nd position in terms of abundance (9.57%) followed by Alloprevotella (3.28%). The abundance of Lactobacillus in the healthy group (1.14%) was very low as compared to the other two groups. Bacteroides (17.41%) was the most abundant genus in the healthy group followed by clostridia_UCG_014 as the 2nd most abundant (12.72%) genus and Christensenellaceae being 3rd in terms of abundance (6.59%) as shown in Fig. 5. Other genera were also detected in three groups but their abundance was low. Bacteroidales, Christensenellaceae, Desulfovibrio, Fusobacterium, Rikenellaceae and Ruminococcus were detected in low abundance in the recovered calves group. In the diarrheal calves group [Eubacterium]coprostanoligenes, Bacteroidales, Desulfovibrio, Fusobacterium, Rikenellaceae and Ruminococcus were detected but in low abundance. While in the healthy calves group low abundant genera that were detected included Rikenellaceae, [Eubacterium]coprostanoligenes, Bacteroidales, Desulfovibrio, Fusobacterium and Ruminococcusd(Table 1).

Fig. 5
figure 5

Graphical (heat map based) group wise (healthy, diarrheal and recovered calves) comparison of abundant genera in fecal microbiota. Recovered group (n = 4), Diarrheal group(n = 4) and Healthy group (n = 4)

The different abundant species detected in samples of the three groups are represented in Fig. 6. Species level distribution of fecal microbiota resulted in most of the species being assigned into unculturable and unassigned species. Some species that were detected in recovered calves group with varying abundance included Bacteroides uniformis (4.95%), Bacteroides massiliensis (4.15%), Bacteroides vulgates (1.96%), Butyricicoccus pullicaecorum (1.33%), Bacteroides nordii (0.96%), Fusobacterium mortiferum (0.80%) and Parabacteroides chinchilla (0.40%) as shown in Fig. 6Bacteroides vulgates (9.36%), Fusobacterium mortiferum (1.95%), Bacteroides uniformis (1.34%), Bacteroides nordii (0.91%), and Parabacteroides chinchilla (0.17%) were detected in diarrheal group. The healthy group included Bacteroides massiliensis (1.78%), Bacteroides vulgates (0.86%), Butyricicoccus pullicaecorum (0.62%) and Parabacteroides chinchilla (0.03%) as shown in Table 1.

Fig. 6
figure 6

Taxbar plot showing the different abundant species in recovered, diarrheal and healthy cattle calves groups. Recovered group (n = 4), Diarrheal group (n = 4) and Healthy group (n = 4)

Diversity analysis

Alpha diversity

Microbiota associated with healthy calves was found to be more diverse as depicted by different diversity indices. Shannon diversity index in healthy calves group was found to be the highest and represented as Mean ± SEM was 4.94 ± 0.17, while lowest diversity was detected in the recovered calves group (4.81 ± 0.30) and its value in the diarrheal group was 4.84 ± 0.30 as shown in Fig. 7. The Simpson diversity index was found to be highest in the healthy calves group (0.96 ± 0.00) while in the other two groups its value was same (0.95 ± 0.01) as given in Table 2. Chao1 and observed features indices showed that diversity was high in healthy group(43 ± 6.89) followed by recovered calves group(41.25 ± 5.55) and lowest in diarrheal calves group with values of 40.75 ± 6.98 for Chao 1 and 39 ± 6.41 for observed features. There was no significant difference observed among the different groups in any diversity index. However, the overall pattern shows that the samples of healthy group comprised of diverse microbiota and microbial diversity decreased in recovered and diarrheal group as represented by different indices (Fig. 7).

Table 2 Alpha diversity indices in different groups of calves fecal microbiota
Fig. 7
figure 7

Alpha diversity indices across groups

Beta diversity

The bacterial diversity PCA plot-based pictures (Fig. 8) in terms of non-phylogenetic diversity indices (Jaccard and Bray Curtis) shows clustering of healthy group samples separately and far from diarrheal and recovered groups, whereas recovered and diarrheal samples have clustered in mix pattern with each other. The Phylogenetic-based indices (both weighted and unweighted UniFrac distance indices show a mix pattern, in which 3 out of 4(75%) healthy samples have clustered together, whereas recovered samples have clustered along one axis. The diarrheal samples show a scatter pattern. The PCA plot of unweighted Unifrac indice shows that healthy samples have clustered along one line while recovered samples have not been clustered at one place but distance from each other is less as compared to diarrheal samples.

Fig. 8
figure 8

Diversity indices (a. Jaccard b. Bray Curtis c) Weighted UniFrac distance and d) Unweighted UniFrac distance) representation through PCA plots. Different colors represents samples of different groups (Red: Diarrheal, Green: Healthy and Blue: recovered)

Discussion

The major cause of mortality and reduced growth performance in calves at the neonatal stage is diarrhea affecting the farmers economically [2] Bovine rotavirus is considered as the most important etiological agent among infectious causes of diarrhea in bovine calves as well as humans infants [35]. Approximately 27–36% of calves are known to have rotavirus infection [36] with mortality ranging from 5 to 20% and may reach upto 80% [37]. Along with the economic impact associated with rotavirus, its zoonotic potential cannot be undermined [9]. The use of beneficial bacteria known as probiotic has shown promising results both as prophylactic and therapeutic options for various bacterial and viral infectious diseases in bovines, poultry and humans [38,39,40,41]. As normal microbiota play important role in normal physiological condition of specific niches and maintenance of homeostasis, any alteration may result in predisposing to disease conditions [42]. Restoring the normal microbial make up of gut may help in recovery from disease associated with dysbiosis in gut [6]. Probiotic may be used as an effective tool for stabilizing the disturbed gut microbiota [43, 44].

The current study was carried out to check whether indigenous probiotic isolated from bovine feces can help in improving the microbial composition of the gut especially in a local breed calves having rotavirus infection. To reduce variation similar age group calves having almost similar weight were selected and were fed and reared under similar conditions. The probiotic administration had a positive impact on improving the fecal scoring indicating reduction in diarrhea which is in agreement with the findings of a study which states that administration of probiotics having lactobacilli strains positively affected the fecal scoring in calves having diarrhea [45]. Upon metagenomic analysis variations in abundance at different taxonomic levels were observed across the three groups. In a study conducted on gut microbiota of pre weaned calves using 16S metagenomic approach [46], Firmicutes (64–82%) was found to be the major phyla in healthy calves, Bacteroidetes (8–24%) and Actinobacteria (1–12%) were among the other major detected phyla, our findings are in line with the study in terms of abundant phyla with variation in percent abundance, as Firmicutes (58.50%) and Bacteroidota (35.90%) were major phyla found in healthy calves. The higher abundance of Proteobacteria in calves having rotavirus infection is detected in the current study which is in line with the findings of a study wherein they have suggested that infection with rotavirus results in dysbiosis having higher abundance of Proteobacteria [47]. It can be seen that Proteobacteria tend to be higher in recovered as compared to healthy group which may be attributed to the fact that it is in stage of transition. Abundance of Firmicutes was higher in recovered calves as compared to diarrheal group calves which was also reported in calves recovered from bovine corona virus, other important cause of neonatal diarrhea [48].

An interesting finding in this study was that the genus Lactobacillus was reported to be highest in diarrheal and recovered group as compared to healthy group. Although this is an unexpected finding but a similar finding is reported in a study in fecal microbiota in neonatal calves having GIT problems of difference severity by Slanzon and Ridenhour [49] and they have suggested that overgrowth of Lactobacillus may serve as recuperative strategy for gut flora in diarrheic calves due to the broad spectrum nature of Lactobacillus.

Christensenellales order has been detected in higher abundance in healthy group while it was not detected in diarrheal calves fecal microbiota. Members of Christensenella genus have been suggested as having probiotic potential [50] but their beneficial effect on gastrointestinal system needs exploration. Rikenellaceae has been detected in higher abundance in healthy calves while their abundance was not appreciable in other groups as it has been suggested that it is associated with intestinal health [51] and hypothesized to be associated with carbohydrates degradation [52] yet their role in maintaining gut health needs investigation.

Next we studied diversity using different diversity indices based on diversity within and between samples. The alpha diversity based on richness such as Chao1 and observed species indicates that diversity was less within diarrheal calves samples whereas highest in healthy group which clearly indicates that diversity tends to decrease when dysbiosis occurs due to rotavirus infection which is also reported previously [7]. In a study conducted on Holstein Friesian calves, researchers suggested that dysbiosis in the gastrointestinal tract (GIT) could be attributed to the infection of calves with rotavirus. This suggestion was based on the observation of decrease in alpha diversity indices in rotavirus-infected calves compared to healthy ones [53]. Although in another study conducted on calves having diarrhea associated with different viral pathogens including rotavirus showed differences based on microbial diversity indices from healthy calves [54] yet there were some contradiction between our observations and their findings. Chao 1 and higher quantity of OTU’s were observed to be higher in healthy claves as compared to rotavirus infected calves which was not the case in our study, the possible explanation for this would be different factors are involved in shaping the microbial composition of the gut of calves such as host related factor i.e. age, breed, sex environmental factors and infectious agent related factors such as its strain and virulence [55]. Only two alpha diversity indices (Chao1 and observed features) were a little higher in recovered group as compared to diarrheal groups but lower than healthy group which indicates that bacterial imbalance in gut microbiota occurred due to rotavirus infection seems to have been towards restoration path due to treatment [48]. The community diversity base indices Shannon and Simpson indices which take both evenness and richness into account showed a different picture. Although healthy samples diversity was higher but diarrheal and recovered groups were almost similar, which may be due to the fact that due to administration of probiotic may temporarily disturb the evenness of community as Lactic acid bacteria produces lactic acid which lowers the pH and some bacterial species are pH sensitive [56]. In our study we observed clustering of healthy samples separately from other groups samples based on beta diversity indices which are in agreement with the results of jang et al [7] they reported differences in composition of gut microbiota of healthy and rotavirus infected calves. However a mixed pattern with no clear separation was observed between diarrheal and recovered group samples which is in contradiction with the findings of the study [48], in which bovine corona virus infected calves were treated fluid therapy and they observed a clear compositional differences based on beta diversity between pre and post therapy treatment samples. The differences observed may be attributed to the difference in infectious agent, treatment type and duration of treatment which was two months in that case. The overall picture suggests that there is a clear association between the presence of a disrupted gastrointestinal ecosystem (indicated by lesser diversity in calves having diarrhea) and the occurrence of rotavirus infection and administration of probiotics to rotavirus infected calves can restore the disturbed microbiota.

Conclusions

From the findings of the study it is concluded that Limosilactobacillus fermentum N-30 ameliorate rotavirus infection and dysbiosis caused by it therefore this strain may be further explored and developed as a probiotic candidate for the prevention and treatment of rotavirus diarrhea in pre-weaned calves.

Data availability

The data sets generated and/or analyzed during the current study are available in the National Center for Biotechnology Information (NCBI) under Bio Project number PRJNA1035647.

References

  1. Donovan G, Braun R. Evaluation of dairy heifer replacement-rearing programs compendium on continuing education for the practicing veterinarian, 1987. 9(4): p. F133-F139.

  2. Cho Y-i, Yoon K-J. An overview of calf diarrhea-infectious etiology, diagnosis, and intervention. J Vet Sci. 2014;15(1):1–17.

    Article  PubMed  PubMed Central  Google Scholar 

  3. Alfieri A, et al. Frequency of group a rotavirus in diarrhoeic calves in Brazilian cattle herds, 1998–2002. Trop Anim Health Prod. 2006;38:521–6.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  4. Barrington GM, Gay JM, Evermann JF. Biosecurity for neonatal gastrointestinal diseases. Veterinary Clinics: Food Anim Pract. 2002;18(1):7–34.

    Google Scholar 

  5. Ammar SSM, et al. Prevalence of rotavirus (GARV) and coronavirus (BCoV) associated with neonatal diarrhea in calves in western Algeria. Asian Pac J Trop Biomed. 2014;4:S318–22.

    Article  PubMed  PubMed Central  Google Scholar 

  6. Du W, et al. Modulating gastrointestinal microbiota to alleviate diarrhea in calves. Front Microbiol. 2023;14:1181545.

    Article  PubMed  PubMed Central  Google Scholar 

  7. Jang J-Y, et al. Rotavirus-mediated alteration of gut microbiota and its correlation with physiological characteristics in neonatal calves. J Microbiol. 2019;57:113–21.

    Article  CAS  PubMed  Google Scholar 

  8. Rolhion N, Chassaing B. When pathogenic bacteria meet the intestinal microbiota. Philosophical Trans Royal Soc B: Biol Sci. 2016;371(1707):20150504.

    Article  Google Scholar 

  9. Geletu US, Usmael MA, Bari FD. Rotavirus in calves and its zoonotic importance Veterinary Medicine International, 2021. 2021.

  10. Gareau MG, Sherman PM, Walker WA. Probiotics and the gut microbiota in intestinal health and disease. Nat Reviews Gastroenterol Hepatol. 2010;7(9):503–14.

    Article  Google Scholar 

  11. Lemon KP, et al. Microbiota-targeted therapies: an ecological perspective. Sci Transl Med. 2012;4(137):rv1375–1375.

    Article  Google Scholar 

  12. Kim HS, et al. Longitudinal evaluation of fecal microbiota transplantation for ameliorating calf diarrhea and improving growth performance. Nat Commun. 2021;12(1):161.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Canani RB, et al. Probiotics for treatment of acute diarrhoea in children: randomised clinical trial of five different preparations. BMJ. 2007;335(7615):340.

    Article  PubMed  PubMed Central  Google Scholar 

  14. Hill C, et al. Expert consensus document: the International Scientific Association for Probiotics and Prebiotics consensus statement on the scope and appropriate use of the term probiotic. Nature reviews Gastroenterology & hepatology; 2014.

  15. Sarowska J, et al. The therapeutic effect of probiotic bacteria on gastrointestinal diseases. Adv Clin Exp Med. 2013;22(5):759–66.

    PubMed  Google Scholar 

  16. Gul ST, Alsayeqh AF. Probiotics as an Alternative Approach to Antibiotics for Safe Poultry Meat production. Pakistan Veterinary J, 2022. 42(3).

  17. Zeineldin M, et al. Synergetic action between the rumen microbiota and bovine health. Microb Pathog. 2018;124:106–15.

    Article  PubMed  Google Scholar 

  18. Renaud D, et al. Evaluation of a multispecies probiotic as a supportive treatment for diarrhea in dairy calves: a randomized clinical trial. J Dairy Sci. 2019;102(5):4498–505.

    Article  CAS  PubMed  Google Scholar 

  19. Gonzalez-Ochoa G, et al. Modulation of Rotavirus severe gastroenteritis by the combination of probiotics and prebiotics. Arch Microbiol. 2017;199:953–61.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Rigo-Adrover M, et al. A combination of scGOS/lcFOS with Bifidobacterium breve M-16V protects suckling rats from rotavirus gastroenteritis. Eur J Nutr. 2017;56:1657–70.

    Article  CAS  PubMed  Google Scholar 

  21. Kayasaki F, et al. Direct evidence of the preventive effect of milk replacer–based probiotic feeding in calves against severe diarrhea. Vet Microbiol. 2021;254:108976.

    Article  CAS  PubMed  Google Scholar 

  22. Parreño V, et al. Milk supplemented with immune colostrum: protection against rotavirus diarrhea and modulatory effect on the systemic and mucosal antibody responses in calves experimentally challenged with bovine rotavirus. Vet Immunol Immunopathol. 2010;136(1–2):12–27.

    Article  PubMed  Google Scholar 

  23. Alekseev KP, et al. Genome characterization of a pathogenic porcine rotavirus B strain identified in Buryat Republic, Russia in 2015. Pathogens. 2018;7(2):46.

    Article  PubMed  PubMed Central  Google Scholar 

  24. Barua SR et al. Comparison of diagnostic tests for detection of bovine rotavirus a in calf feces. Macedonian Veterinary Rev, 2021. 44(1).

  25. Kennedy NA, et al. The impact of different DNA extraction kits and laboratories upon the assessment of human gut microbiota composition by 16S rRNA gene sequencing. PLoS ONE. 2014;9(2):e88982.

    Article  PubMed  PubMed Central  Google Scholar 

  26. Nawaz M, et al. Characterization and transfer of antibiotic resistance in lactic acid bacteria from fermented food products. Curr Microbiol. 2011;62:1081–9.

    Article  CAS  PubMed  Google Scholar 

  27. Bolyen E, et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat Biotechnol. 2019;37(8):852–7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Callahan BJ, et al. DADA2: high-resolution sample inference from Illumina amplicon data. Nat Methods. 2016;13(7):581–3.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Bokulich NA, et al. Optimizing taxonomic classification of marker-gene amplicon sequences with QIIME 2’s q2-feature-classifier plugin. Microbiome. 2018;6(1):1–17.

    Article  Google Scholar 

  30. Kim B-R, et al. Deciphering diversity indices for a better understanding of microbial communities. J Microbiol Biotechnol. 2017;27(12):2089–93.

    Article  PubMed  Google Scholar 

  31. Faith DP, Baker AM. Phylogenetic diversity (PD) and biodiversity conservation: some bioinformatics challenges. Evolutionary Bioinf. 2006;2:117693430600200007.

    Article  Google Scholar 

  32. Lozupone CA, et al. Quantitative and qualitative β diversity measures lead to different insights into factors that structure microbial communities. Appl Environ Microbiol. 2007;73(5):1576–85.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Ricotta C, Podani J. On some properties of the Bray-Curtis dissimilarity and their ecological meaning. Ecol Complex. 2017;31:201–5.

    Article  Google Scholar 

  34. Real R, Vargas JM. The probabilistic basis of Jaccard’s index of similarity. Syst Biol. 1996;45(3):380–5.

    Article  Google Scholar 

  35. Barros BdCVd, et al. Rotavirus A in wild and domestic animals from areas with environmental degradation in the Brazilian Amazon. PLoS ONE. 2018;13(12):pe0209005.

    Article  Google Scholar 

  36. Dhama K, et al. Rotavirus diarrhea in bovines and other domestic animals. Vet Res Commun. 2009;33:1–23.

    Article  CAS  PubMed  Google Scholar 

  37. Chauhan R, Singh N. Epidemiology of rotavirus infection in calves. Int J Anim Sci. 1996;11(1):221–3.

    Google Scholar 

  38. Alvarez-Olmos MI, Oberhelman RA. Probiotic agents and infectious diseases: a modern perspective on a traditional therapy. Clin Infect Dis. 2001;32(11):1567–76.

    Article  CAS  PubMed  Google Scholar 

  39. Callaway T, et al. Probiotics, prebiotics and competitive exclusion for prophylaxis against bacterial disease. Anim Health Res Reviews. 2008;9(2):217–25.

    Article  CAS  Google Scholar 

  40. Mehmood A et al. Probiotic effect of limosilactobacillus fermentum on growth performance and competitive exclusion of Salmonella Gallinarum in Poultry. Pakistan Veterinary J, 2023. 43(4).

  41. Ullah Q et al. Efficacy prediction of Lactobacillus rhamnosus GG and platelet-rich plasma (PRP) against Sub-clinical Bubaline Mastitis. Pakistan Veterinary J, 2023. 43(4).

  42. Sekirov I, et al. Gut microbiota in health and disease. Physiological reviews; 2010.

  43. McFarland LV. Use of probiotics to correct dysbiosis of normal microbiota following disease or disruptive events: a systematic review. BMJ open. 2014;4(8):e005047.

    Article  PubMed  PubMed Central  Google Scholar 

  44. Salminen S, Isolauri E, Salminen E. Probiotics and stabilisation of the gut mucosal barrier. Asia Pac J Clin Nutr. 1996;5:53–6.

    CAS  PubMed  Google Scholar 

  45. Fernández S, et al. Effect of the administration of Lactobacillus spp. strains on neonatal diarrhoea, immune parameters and pathogen abundance in pre-weaned calves. Beneficial Microbes. 2020;11(5):477–88.

    Article  PubMed  Google Scholar 

  46. Oikonomou G, et al. Fecal microbial diversity in pre-weaned dairy calves as described by pyrosequencing of metagenomic 16S rDNA. Associations of Faecalibacterium species with health and growth. PLoS ONE. 2013;8(4):e63157.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  47. Singh P, et al. Intestinal microbial communities associated with acute enteric infections and disease recovery. Microbiome. 2015;3(1):1–12.

    Article  Google Scholar 

  48. Kwon M-S, et al. Alteration of the gut microbiota in post-weaned calves following recovery from bovine coronavirus-mediated diarrhea. J Anim Sci Technol. 2021;63(1):125.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  49. Slanzon GS, et al. Fecal microbiome profiles of neonatal dairy calves with varying severities of gastrointestinal disease. PLoS ONE. 2022;17(1):e0262317.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  50. Singh TP, Natraj BH. Next-generation probiotics: a promising approach towards designing personalized medicine. Crit Rev Microbiol. 2021;47(4):479–98.

    Article  CAS  PubMed  Google Scholar 

  51. Hildebrand F, et al. Inflammation-associated enterotypes, host genotype, cage and inter-individual effects drive gut microbiota variation in common laboratory mice. Genome Biol. 2013;14:1–15.

    Article  Google Scholar 

  52. Pitta DW, et al. Rumen bacterial diversity dynamics associated with changing from bermudagrass hay to grazed winter wheat diets. Microb Ecol. 2010;59:511–22.

    Article  PubMed  Google Scholar 

  53. Kim S-H, et al. Analysis of fecal microbial changes in young calves following bovine rotavirus infection. Veterinary Sci. 2023;10(8):496.

    Article  Google Scholar 

  54. Cui S et al. Alterations of microbiota and metabolites in the feces of calves with diarrhea associated with rotavirus and coronavirus infections. Front Microbiol, 2023. 14.

  55. Castro J, et al. Changes in the intestinal bacterial community, short-chain fatty acid profile, and intestinal development of preweaned holstein calves. 2. Effects of gastrointestinal site and age. J Dairy Sci. 2016;99(12):9703–15.

    Article  CAS  PubMed  Google Scholar 

  56. Mikelsaar M, et al. Biodiversity of intestinal lactic acid bacteria in the healthy population advances in Microbiology. Infect Dis Public Health: Volume. 2016;4:1–64.

    Google Scholar 

Download references

Funding

This research was not supported from any external funding.

Author information

Authors and Affiliations

Authors

Contributions

Conceptualization, Nadeem Murtaza and Muhammad Nawaz.; methodology, Nadeem Murtaza.; software, Tahir Yaqub and Asim Khalid Mehmood.; validation, Asim Khalid Mehmood.; formal analysis, Nadeem Murtaza.; investigation, Nadeem Murtaza.; resources, Muhammad Nawaz.; writing, original draft preparation, Nadeem Murtaza.; writing, review and editing, Muhammad Nawaz.; visualization, Muhamamd Nawaz.; supervision, Muhammad Nawaz. All authors have read and agreed to publish version of this manuscript.

Corresponding author

Correspondence to Muhammad Nawaz.

Ethics declarations

Ethical approval

All the experiments were performed in accordance with the institutional guidelines of “Ethical review committee, University of Veterinary and Animal Sciences Lahore” after ethical approval (No.DR/452 dated 13-10-2023).

Consent for publication

Not Applicable.

Competing interest

Not Applicable.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Murtaza, N., Nawaz, M., Yaqub, T. et al. Impact of Limosilactobacillus fermentum probiotic treatment on gut microbiota composition in sahiwal calves with rotavirus diarrhea: A 16S metagenomic analysis study”. BMC Microbiol 24, 114 (2024). https://doi.org/10.1186/s12866-024-03254-z

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12866-024-03254-z

Keywords