Table 2 Characteristics of the best blocking oligonucleotides complementing the primer pair nu-SSU-1334-5’/nu-SSU-1648-3’ (FF390/FR-1). Fungal and non-fungal eukaryotic sequence coverage rate tested by in silico analysis
Target | Sequence | ComPrim | #nt | Tm (°C) | Fungi (%) | Alv. (%) | Rhiz. (%) | Stram. (%) | Tel. (%) |
|---|---|---|---|---|---|---|---|---|---|
Alveolata | gtcgctcctaccgattga | nu-SSU-1648-3ˊ | 12 | 50.3 | 0.08 | 52.6 | 6.3 | 0.9 | 3.3 |
Rhizaria | ttaacgaacgagacctcga | nu-SSU-1334-5ˊ | 16 | 48.9 | 0 | 0 | 24.3 | 0.3 | 0 |
Stramenopiles | tcgcacctaccgattgaa | nu-SSU-1648-3ˊ | 13 | 48.3 | 0 | 0.5 | 0.3 | 77.1 | 1.7 |
Telonema | gaccttaacctactaaatagtta | nu-SSU-1334-5ˊ | 5 | 48.1 | 0 | 0.3 | 0 | 0 | 39.2 |