Skip to main content

Advertisement

Table 1 Primer sequences used for RT-qPCR

From: Extracellular vesicles and soluble factors secreted by Escherichia coli Nissle 1917 and ECOR63 protect against enteropathogenic E. coli-induced intestinal epithelial barrier dysfunction

Genes Primer sequences References
ZO-1 Fw: 5′-CGGGACTGTTGGTATTGGCTAGA-3′ Rv: 5′-GGCCAGGGCCATAGTAAGTTG-3′ [53]
ZO-2 Fw: 5′-CTAGCAGCGATCAACTTAGGGACAA-3′ Rv: 5′-CCCAGGAGTTTCATTACCAGCAA-3′ [53]
occludin Fw: 5′- TCCTATAAATCCACGCCGGTTC − 3′ Rv: 5′- CTAAAGTTACCACCGCTGCTG − 3′ [53]
Claudin-1 Fw: 5′-GCCCCAGTGGAGGATTTACT-3′ Rv: 5′-GTTTTGGATAGGGCCTTGGT-3′ [54]
Claudin-2 Fw: 5′-ACCTGCTACCGCCACTCTGT-3′ Rv: 5′- CTCCCTGGCCTGCATTATCTC-3′ [48]
β-actin Fw: 5′-GCTCTGGCTCCTAGCACCAT-3′ Rv: 5′-GCCACCGATCCACACAGAGT-3′ [55]