Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer sequences used for RT-qPCR

From: Extracellular vesicles and soluble factors secreted by Escherichia coli Nissle 1917 and ECOR63 protect against enteropathogenic E. coli-induced intestinal epithelial barrier dysfunction

Genes Primer sequences References
ZO-1 Fw: 5′-CGGGACTGTTGGTATTGGCTAGA-3′
Rv: 5′-GGCCAGGGCCATAGTAAGTTG-3′
[53]
ZO-2 Fw: 5′-CTAGCAGCGATCAACTTAGGGACAA-3′
Rv: 5′-CCCAGGAGTTTCATTACCAGCAA-3′
[53]
occludin Fw: 5′- TCCTATAAATCCACGCCGGTTC − 3′
Rv: 5′- CTAAAGTTACCACCGCTGCTG − 3′
[53]
Claudin-1 Fw: 5′-GCCCCAGTGGAGGATTTACT-3′
Rv: 5′-GTTTTGGATAGGGCCTTGGT-3′
[54]
Claudin-2 Fw: 5′-ACCTGCTACCGCCACTCTGT-3′
Rv: 5′- CTCCCTGGCCTGCATTATCTC-3′
[48]
β-actin Fw: 5′-GCTCTGGCTCCTAGCACCAT-3′
Rv: 5′-GCCACCGATCCACACAGAGT-3′
[55]