Skip to main content

Table 2 Primers used in this study

From: Isocitrate dehydrogenase mutation in Vibrio anguillarum results in virulence attenuation and immunoprotection in rainbow trout (Oncorhynchus mykiss)

Primer Sequence (5′ to 3′, underlined sequences are designed restriction sites) Description Reference
pr31 GGTGAGCTCTATTCTTTATTGCCGATTATC For icd insertional mutant, forward, SacI This study
pr32 AAATCTAGAGTAAGTCGCTTTAATCGCTTC For icd insertional mutant, reverse, XbaI This study
pr50 AAAGAGCTCGTGATCCAGATGTCGATGCTA For sucA insertional mutant, forward, SacI This study
pr51 GGTTCTAGAGTTCAGTGTCGATAATGTGCA For sucA insertional mutant, reverse, XbaI This study
pr52 AAAGAGCTCGGTCGGATTAGTACAGCGAAG For sucC insertional mutant, forward, SacI This study
pr53 GGTTCTAGACTTTTTCAATTTCCACGCCGC For sucC insertional mutant, reverse, XbaI This study
pr54 AAAGAGCTCATGTTCGTTGCGGTCGGAATT For sdhC insertional mutant, forward, SacI This study
pr55 GGTTCTAGATCCAACTCTTCAAAGTGGCCC For sdhC insertional mutant, reverse, XbaI This study
pr56 GGTGAGCTCTCCTTGCACCATATTGATATG For fumA insertional mutant, forward, SacI This study
pr57 GGGTCTAGAAGGCTTATCATCGAGAAGAGAG For fumA insertional mutant, reverse, XbaI This study
pr29 GGTGAGCTCATGCCAGCGTTAACATTAAAC For mdh insertional mutant, forward, SacI This study
pr30 AAATCTAGAGCTGTATGACATCGCACCGGT For mdh insertional mutant, reverse, XbaI This study
pr33 AAAGAGCTCGCGGCGTGAGACTAAGGCATC For cra insertional mutant, forward, SacI This study
pr34 AAATCTAGACAATGGCAAAGCGCAGAAGTA For cra insertional mutant, reverse, XbaI This study
vah1 F RT GTTTGGTATGGAACACCGCTCAAG For vah1 qRT-PCR, forward This study
vah1 R RT GGCTCAACCTCTCCTTGTAACCAA For vah1 qRT-PCR, reverse This study
plp F RT CAGACGACCACCAGTAACCACTAA For plp qRT-PCR, forward [8]
plp R RT GCAATCATGATGACCCAGCAACAG For plp qRT-PCR, reverse [8]
Pm111 GGAAATTATTCCGCCGACGATGGA For rtxA qRT-PCR, forward [7]
Pm112 GCCGATACCGTATCGTTACCTGAA For rtxA qRT-PCR, reverse [7]