Skip to main content

Advertisement

Table 2 Primers used in the study

From: Identification of Mycobacterium avium subsp. hominissuis secreted proteins using an in vitro system mimicking the phagosomal environment

Gene Name Experiment Primer Sequence (5′ to 3′)
MAV_0502 BlaC F GGATCCATGCTCGACGCCGTG
R GAATTCTTGCCCCGCAATGAGAACG
RT-PCR F GTGAGCTGCAATGTCGGATG
R GCAGTACTGGTGCAGATCGT
MAV_0516 BlaC F GGATCCATGCCACAGGGAACTGTG
R GAATTCCAGGGAGCGGACTCCG
RT-PCR F ACAGGGAACTGTGAAGTGGTT
R GATTTCGAACTCGACCTTCTGG
MAV_0628 BlaC F GGATCCATGAGCACATCCAACACAGTC
R GAATTCGGGCGGGCAGGAGTG
RT-PCR F TCGCCGAGGGGTTACTCA
R AGGTAGTCGATGACGTTGCC
MAV_1356 BlaC F GGATCCATGGCGGCGATGAAG
R GAATTCGCTGGAGCTCGTGACG
RT-PCR F ATGGCGGCGATGAAGCC
R CTTGAGTTCGTCACGGAGGG
MAV_4394 BlaC F GGATCCGTGAAAACTCACCGGATCG
R GAATTCGACGAGAGGTGCTTGCGAAG
RT-PCR F CCTACGGGGTCAACTATGCC
R CACGATGTCCATCACCGAGG
MAV_1419 BlaC F GGATCCAATGTTCTCGCGCCGCATCATCACC
R GAATTCGGCGGGCTGGCCGGAGAATTGCGGG
RT-PCR F CGATGAGATGTTCCTCGCCC
R
MAV_0398 BlaC F GGATCCAATGACCATGCGGATCACGCGGGTTTGCCGGGCGGT
R GAATTCTTGACCCAGCGCGTTTTGCATGGCCCCGG
RT-PCR F GACGAGAACTGGACCAAGCA
R TATTGACCCAGCGCGTTTTG
MAV_1177 BlaC F GGATCCATGAGCATCAACTACCAGTTC
R GAATTCGGCCCAGCTGGACC
RT-PCR F ACTACCAGTTCGGCGATGTC
R CGACCCAACTGGGTGATGAA
MAV_1178 BlaC F GGATCCATGGCAACACGTTTTATGACTG
R GAATTCGCTGCTGAGGATCTGCTG
RT-PCR F TTATGACTGACCCGCACGAA
R GTTGACGATGTTGCGGAAGG
MAV_4077 BlaC F GGATCCAATGGGGGACCAGCAGAGCGGGCCGCAGGAA
R GAATTCTTGGTTCTTCTTCTGGCGCT
RT-PCR F GAAGGGCAAGGCCAAGGA
R TCTTCTTCTGGCGCTCCTC