Skip to main content

Advertisement

Table 1 Bacterial strains, plasmids and oligonucleotides used in this study

From: Plasmid pPCP1-derived sRNA HmsA promotes biofilm formation of Yersinia pestis

Strains
Name Description Sources
WT Y. pestis wild-type strain 201 [36]
WT::pBAD Y. pestis WT strain carrying plasmid pBAD-TF [39]
pPCP1 Y. pestis WT strain lacking plasmid pPCP1 [38]
hmsA hmsA deletion mutant derived from Y. pestis WT strain 201 [28]
hmsA::pBAD hmsA strain carrying plasmid pBAD-TF This study
hmsA::HmsA hmsA strain carrying plasmid pBAD-HmsA This study
∆hmsS hmsS deletion mutant derived from Y. pestis WT strain [18]
∆fur fur deletion mutant derived from Y. pestis WT strain [18]
∆hmsB hmsB deletion mutant derived from Y. pestis WT strain [35]
Plasmids
pRW50 A low-copy lacZ fusion vector [42]
pBAD-TF Transcriptional fusion vector modified from pBAD/HisA [39]
pBAD-HmsA HmsA overexpressing plasmid by inserting a DNA fragment amplified by primer HmsA-pBAD-F/R into pBAD-TF This study
Oligonucleotides
Name Sequence (5′-3′)
HmsA-pBAD-F/R CACGAATTCGCAAAAGTCAGGACTAGACATATTAAC/TTGAAGCTTACCACATAAAAAAGGCCCTCACAGG
HmsA-NB-F/R CACGAATTCGCAAAAGTCAGGAC/AATTGTAATACGACTCACTATAGGGCGTTGAAGCTTACCACATAAAAAAGGC
HmsB-NB-F/R TGTAATAATAGTCATATCATCGTAAATTTGAATTGTAATACGACTCACTATAGGGCGTGCTTCAGTGGCTCATGTC
HmsA-PE-R TCTGTGAGGGCGTATGATAAGG