Skip to main content

Table 3 Primers used in this study

From: ClpP-deletion impairs the virulence of Legionella pneumophila and the optimal translocation of effector proteins

Primer 5’ → 3’ sequence Source
XP-F1 TGGTCCGGATCCCTGCCAGTAGGTCCTATAAG This study
XP-P1 TATGACATACAAGTTGCTGGACATTCTAC This study
XP-F2 CAACTTGTATGTCATAGGAACGCTCACC This study
XP-P2 TGGTCCAGATCTTGGGAAAATTGACAAACCGT This study
XL091F TGGTGGTCTAGATTTAAGAAGGAGATATACATATGCCAGGCTATTCAGATAAT This study
XL091R TGGTGGGCATGCTTATAAGTCTGTAGAATGTCCAGC This study
Rac-F CGGGATCCATGCATCCAGAAATTGAAAAGGC This study
Rac-R ACGCGTCGACTTATTTCTTATAACTCGATCTACTTTC This study
LK2c-F CGGGATCCATGGTTTATTACATAAATTTGAAGGAACAA This study
LK2c-R ACGCGTCGACTTAGCTTGGGCCTCGCATCA This study
SDAc-F CGGGATCCTTGGTATATTATGAGATCATTAAGGATAT This study
SDAc-R ACGCGTCGACTTAAATAGTAAGACTCGAGTTAGTTG This study
SDBc-F CGGGATCCATGGCTAAAATTTATAATGCACCAAAAC This study
SDBc-R ACGCGTCGACCTAATTTATTTCTGGTATACTTTTTACG This study
SDDc-F CGGGATCCTTGGTATATTATGAGATCATTAAGGATAT This study
SDDc-R ACGCGTCGACTTAAATAGTAAGACTCGAGTTAGTTG This study
SDFc-F CGGGATCCATGCCACGAATCACTGAAAATAT This study
SDFc-R ACGCGTCGACTTAGAAGTTTACTGGCGTGG This study
LU1c-F CGGGATCCATGAAAGCAAAATACGAC This study
LU1c-R ACGCGTCGACCTACAATGGCTCACATTGGC This study