Skip to main content

Table 1 Skin attachment attenuated mutants removed after washing step

From: Identification of Salmonella enterica serovar Kentucky genes involved in attachment to chicken skin

Mutanta Protein ID Locationb
P02F10-P01G01 3-dehydroquinate dehydratase MAR2xT7^TActgtccggtggttagcgcctgttcg
P04G08-P01E02 Magnesium and cobalt transport protein CorA MAR2xT7^TAcgcgcaatcgctcgtcgtcgtccgg
P07D05-P01C06 Major outermembrane lipoprotein MAR2xT7^TAaataccggaagtaatagttatcctg
P07G06-P01E06 Dihydrolipoamide acetyltransferase MAR2xT7^TAtgtccgttcaccagaaacagcaaca
P07G09-P01F06 Dihydrolipoamide succinyl transferase MAR2xT7^TAgctttcagtttcgcccgacgtatac
P08F01-P01A08 Poly nucleotide phosphorylase/polyadenylase MAR2xT7^TAagcatggatgacaccgccgtattcg
P08C05-P01B08 Type IV conjugative transfer system coupling protein TraD MAR2xT7^TAccaggaacgtcccaaagtggcgccg
P09B04-P01D09 Lipo polysaccharide biosynthesis protein RffA MAR2xT7^TAtgtaacgtttaagcgcggcggtgtt
P09E05-P01F09 ADP-heptose:LPS heptosyl transferase II MAR2xT7^TAaacgaatttggcaacacccaggcgc
P10H10-P01D10 Anti-terminator-like protein MAR2xT7^TAtattgataaacctcacgcccggcta
P10D11-P01G11 DNA helicase IV MAR2xT7^TAtttgtcccgatcattcaaaacggcg
P04H01-P01F02 Phage tail fiber protein H MAR2xT7^TActcacgtctggaaccaggttaccgg
P06F05-P01H04 Precorrin-4C11-methyl transferase MAR2xT7^TAtgccggttcgctgatcaataccgaa
P10F06-P01B11 NADH pyro phosphatase MAR2xT7^TAtggatcgtataattgaaaaattaga
P10D07-P01G10 Conserved protein with nucleoside triphosphate hydrolase Domain MAR2xT7^TAgtgttcaagcagttgcaccatcgcg
P08F09-P01H07 Oligoribonuclease MAR2xT7^TAtctaaacgcctttaccgatctgaaa
P12F08-P02D02 Glutamyl-Q tRNA (Asp) synthetase MAR2xT7^TAtctccaccgccgcgacggactgttt
P13H05-P02A03 Chaperone protein HscA MAR2xT7^TAtaccaactctctggttgcgacggtt
P14B06-P02H03 Chaperone protein HscA MAR2xT7^TActgatcgtcgggcgcggcggcggtt
P16D03-P02A05 Shikimate 5-dehydrogenase AroDI gamma MAR2xT7^TAcgaagcgctggatctcaattatctc
P16H02-P02C05 Fatty acid oxidation complex sub-unit alpha MAR2xT7^TAcagcgggccgaggtgttgatactgc
P17C05-P02A07 SppA MAR2xT7^TAatgctttatcctcaccaaggtacaa
P18H08-P02C07 NADH dehydrogenase sub-unit H MAR2xT7^TAattgggtggtggccgatttaaacat
P23E10-P02E10 Ribulose-phosphate 3-epimerase MAR2xT7^TAcactttgacgtcatggataatcact
P25D03-P02C11 Tryptophan synthase beta sub-unit MAR2xT7^tgtgccgcagatcctgatgcctgcg
P15C06-P02G04 ATP-dependent RNA helicase DeaD MAR2xT7^TAtaccgattgaagtgggccgtgatgt
P11H11-P02B02 Putative regulatory protein MAR2xT7^TActgtcagcaatggccggaaaaagga
P15C03-P02H04 Glutathione reductase MAR2xT7^TActtcatacgacaacgtgctgggcaa
P21E02-P02C09 Aldolase MAR2xT7^TAtggtgtaatccagcaatttcctggc
P12C04-P02F02 Putative sodium/sulfate transporter, partial MAR2xT7^TAcagaatattggcggcggctttggct
P18C07-P02F07 GTP-binding protein MAR2xT7^TActatcctcgctaaaaacaccgctat
P23F01-P02D10 Ornithine decarboxylase MAR2xT7^TAgttggcctcttgcggattcatactg
P16E01-P02B05 Hypothetical protein STY0758 MAR2xT7^TAccagggggactgacggcctgtgcag
P19F07-P02H08 Oxidoreductase MAR2xT7^TAtattgagtcctcttccggcgtttcg
P25G02-P02F11 Intramembrane serine protease GlpG MAR2xT7^TAtatatactgtattttgtatgga
P19A07-P02A08 Fimbrial outer membrane usher protein MAR2xT7^TAcgttcggttcaatagcggtttcaat
P23C06-P02B10 Pyruvate dehydrogenase sub-unit E1 MAR2xT7^TAcatcaacactattgccgttgaagac
P20C11-P02B09 Alpha ribazole-5'-P phosphatase MAR2xT7^TAcaaataatcatacagtcggacgata
P18D02-P02G07 4-hydroxythreonine-4-phosphate dehydrogenase MAR2xT7^TActctgctaggtgctgcccgacccgg
P22G01-P02A10 Permease protein SitC MAR2xT7^TAagccatgcgcccagaaaactggtca
P13B03-P02E03 Putative sensor kinase protein MAR2xT7^TAcaacaagaaatcgccgagcgcggac
P10C09-P02C01 Exoribonuclease II MAR2xT7^TAtaaccagtcgccgacatcgcgctcc
P22E10-P02G09 Phosphorpyruvate hydratase MAR2xT7^TAtcacaccaggcacagccgaccggac
P19H03-P02B08 High-affinity zinc transporter periplasmic protein MAR2xT7^TAaaaccacgcgtacaagcgttgactt
  1. aMutants are listed according to the degree of attachment attenuation
  2. b MAR2xT7, mariner transposon; ^, insertion point; TA, two-base TA duplication; lowercase letters, 25-bp flanking unique gene sequences of S. enterica