Skip to content

Advertisement

You're viewing the new version of our site. Please leave us feedback.

Learn more

BMC Microbiology

Open Access

Erratum to: Development of a Multiplex-PCR probe system for the proper identification of Klebsiella variicola

  • Ulises Garza-Ramos1Email author,
  • Jesús Silva-Sánchez1,
  • Esperanza Martínez-Romero2,
  • Perla Tinoco1,
  • Marisol Pina-Gonzales1,
  • Humberto Barrios1,
  • Jesús Martínez-Barnetche3,
  • Rosa Elena Gómez-Barreto3 and
  • Juan Tellez-Sosa3
BMC MicrobiologyBMC series – open, inclusive and trusted201616:43

https://doi.org/10.1186/s12866-016-0652-4

Received: 19 February 2016

Accepted: 2 March 2016

Published: 16 March 2016

The original article was published in BMC Microbiology 2015 15:64

Erratum

The original version of this article [1] unfortunately contained a mistake in Table 1. The primer sequence which corresponds to KmtnC-R in the table 1 was provided incorrectly. The correct nucleotide sequence is:

KmtnC-R:GCATGGCCCAGGTGTTCAG

An updated version of Table 1 has been provided below.
Table 1

Amplification conditions, oligonucleotide combinations, sequence and amplification fragment of multiplex-PCR for K. variicola identification

Amplification conditionsa

Name of combination primers

Shared unique genes, oligonucleotides and sequence (5′- 3′) of each bacterial specie

K. pneumoniae

Amplification fragment (bp)

K. variicola

Amplification fragment (bp)

Klebsiella spp.

Amplification fragment (bp)

  

phosphohydrolase

 

phosphoglycerate mutase

 

phosphopentane phosphatase (mtnC)

 

1

M-PCR-1

KP888-F: AAGCAAGCCAGAACAGAAAG

888

KV770-F: TCCCGAGGTTCACATTTCC

449

KmtnC-F: CCGCCGACCTTATCACTAC

340

KP888-R: ACTTCGGTTTTATCCAGGTC

KV770-R: AGCGGGTGAACGTCGATAC

KmtnC-R: GCATGGCCCAGGTGTTCAG

  

transferase (yphG)

 

N-acetyltransferase

 

phosphopentane phosphatase (mtnC)

 

1

M-PCR-2

KP878-F: ACCGATAACCAGCCTGACTT

878

KV1615-F: ACACAACATTTCAGGCGGCT

499

KmtnC-F: CCGCCGACCTTATCACTAC

340

KP878-R: CTTTCTTCTGCCCACTGTTG

KV1615-R: GGGCGTGGCTTTTTTCATCG

KmtnC-R: GCATGGCCCAGGTGTTCAG

  

phosphohydrolase

 

thiopurine S-methyltransferase

 

phosphopentane phosphatase (mtnC)

 

2

M-PCR-3

KP888-F: AAGCAAGCCAGA ACAGAAAG

888

KV1000-F: CTGGGATGTGGCAATGGTG

438

KmtnC-F: CCGCCGACCTTATCACTAC

340

KP888-R: ACTTCGGTTTTATCCAGGTC

KV1000-F: AAACTGCGCCTGCTGTATC

KmtnC-R: GCATGGCCCAGGTGTTCAG

aMultiplex-PCR conditions used under the oligonucleotides combinations. 1: 5pmol/reaction of K. variicola and Klebsiella spp, 25pmol/reaction of K. pneumoniae; 2: 25 pmol/reaction of K. pneumoniae, 5 pmol/reaction of K. variicola and 1 pmol/reaction of Klebsiella spp

Notes

Declarations

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Departamento de Diagnóstico Epidemiológico
(2)
Centro de Ciencias Genómicas (CCG), Universidad Nacional Autónoma de México (UNAM)
(3)
Instituto Nacional de Salud Pública (INSP), Centro de Investigación Sobre Enfermedades Infecciosas (CISEI), Departamento de Inmunología

References

  1. Garza-Ramos et al. BMC Microbiology (2015) 15:64. doi:10.1186/s12866-015-0396-6.

Copyright

© Garza-Ramos et al. 2016

Advertisement