Skip to main content

Table 1 Bacterial strains, plasmids and oligonucleotides used for mutagenesis.

From: Role of the ArcAB two-component system in the resistance of Escherichia colito reactive oxygen stress

Bacterial strains and plasmids   Characteristics Source or reference
E. coli strains K12 Isolate MG1655 Dr. Sydney Kustu, University of California
  ΔarcA ΔarcA::kan derivative of K12 This study
  ΔarcB ΔarcB::cm derivative of K12 This study
  arcB::kan derivative of K12 in which Kanr was inserted adjacent to arcB while maintaining the function of arcB This study
  ΔarcB-rev kan derivative of ΔarcB with arcB::cm replaced by wild type arcB This study
  ΔfliC fliC non-polar deletion mutant of K12 This study
  ΔarcAfliC ΔarcA::kan/ΔfliC derivative of K12 This study
Plasmids pRB3-273C Apr, low to medium copy number plasmid [40]
  pRB3-arcA derivative of pRB3-273C containing arcA [38]
  pRB3-arcD2A derivative of pRB3-arcA containing Asp54 → Ala mutation This study
Oligonucleotides Used for Sequence
arcA5KO mutagenesis of arcA 5'-tcttatcgttgaagacgagttggtaacacgcaacacgttg
aaaagtattttcgaagcggagtgtaggctggagctgcttc-3'
arcA3KO mutagenesis of arcA 5'-tcttccagatcaccgcagaagcgataaccttcaccgtgaa
tggtggcgatgatttccggccatatgaatatcctccttag-3'
arcB5KO mutagenesis of arcB 5'-gccctcgtcgttcttgccattgtggtacaaatggcggtaaccatggtgct
gcatggtcaggtcgaaagcattgatgttatgtgtaggctggagctgcttc-3'
arcB3KO mutagenesis of arcB 5'-gtggcttttgccacccacgctttcagcacttctacgtcgtgacgccactc
ttctttcatctcttcaatccattcaccgaccatatgaatatcctccttag-3'
arcB-rev5 generation of arcB::kan 5'-cacattaatttttttaataaaaatggtacgcatcacacatttaactgattcatgtaacaa
atcatttaagttttgctatcttaactgcgtcatatgaatatcctccttag-3'
arcB-rev3 generation of arcB::kan 5'-gcgaatactgcgccaacaccagggaaatcttggctgcgccgtaaattattatgatga
gttacaagggcacagcactgtttttcaggccgcgtgtaggctggagctgcttc-3'
fliC5KO mutagenesis of fliC 5'-tcgctgatcactcaaaataatatcaacaagaaccagtctgcgctgtcgag
ttctatcgagcgtctgtcttctggcttgcggtgtaggctggagctgcttc-3'
fliC3KO mutagenesis of fliC 5'-ctgcggtacctggttagcttttgccaacacggagttaccggcctgctgga
tgatctgcgctttcgacatattggacacttcatatgaatatcctccttag-3'
  1. kan, kanamycin resistance cassette; cm, chloramphenicol resistance cassette. Sequences in bold in the table indicate those that are homologous to plasmids pKD3 and pKD4 [50], which were used as PCR templates for mutagenesis.