Skip to main content

Table 1 Oligonucleotide primers used in this study

From: The PhoBR two-component system regulates antibiotic biosynthesis in Serratia in response to phosphate

Name 5'-3' sequence Description Restriction site
HS34 GCTGACTCATAAATATCTGACTG pigA, primer extension oligo  
HS36 GCGAAAATAGCTCGGCTGATCTC smaI, primer extension oligo  
HS60 GTCTATATCGGCATCTGTTCC carA, primer extension oligo  
KML CCAGTAAGTTTTCCAGTAGGTGG F primer for KmR gene of miniTn5 Km1  
KMR CCGAGCTTGGTACCCAGTC R primer for KmR gene of miniTn5 Km1  
NW225 GACCACACGTCGACTAGTGCNNNNNNNNNACTG Random primed PCR primer 1  
NW226 GACCACACGTCGACTAGTGCNNNNNNNNNATGAC Random primed PCR primer 2  
NW227 GACCACACGTCGACTAGTGCNNNNNNNNNGTCTC Random primed PCR primer 3  
NW244 CGTCTGCCAGGTGCTATTGGTTATG pstSCAB region sequencing primer  
NW245 GGATAACGAAGTGAACAGCAAC pstSCAB region sequencing primer  
NW246 GCATCCTGGCCGAGCATACAGAAG pstSCAB region sequencing primer  
NW247 GCGACGCATGCGGATAAGCTCTG pstSCAB region sequencing primer  
NW250 CATTACTGCGATGCACAATCAG phoU sequencing primer  
NW251 GTGACGATTGATGAAGCTTGTG phoU sequencing primer  
OTG124 ATCAGAGAATTCTACTAATTGGAGTCATTACCG F primer for pTG27, smaI promoter construct Eco RI
OTG125 ATCAGAAAGCTTAGTCTATCATTATAGCGTTCC R primer for pTG27, smaI promoter construct Hin dIII
PF42 GCATAAGCTTCCATCACTACTCC R primer for pTA14, rap promoter construct Hin dIII
PF43 GTAAGAATTCGCGATGTTCAGAAAC F primer for pTA14, rap promoter construct Eco RI
PF154 GATGAATTCAGGAGGACAGGGATGGCAAGACGTATTTTG F primer for pTA74, PhoB expression construction Eco RI
PF155 TCTAAGCTTCAGTAACGCGTCGAG R primer for pTA74, PhoB expression construction Hin dIII
PF180 TTTGAATTCGTTAGTTTGGGAGATTTTC F primer for sequencing phoR Eco RI
PF182 TTTAAGCTTGCTGCGGGACGC R primer for sequencing phoR Hin dIII
PHORL GCGTTAGTTTGGGAGATTTTC F phoR primer  
PHORR CTCCCAAACTAACGCTGTC R phoR primer  
PST1 CAGCGTCTGCCAGGTGC pstS sequencing primer  
PST2 GTCCACGTTGCTGAG pstA sequencing primer  
PST3 CCAGCTTTACCCAGAGCAACATG pstB sequencing primer  
PST4 CAGAGTGTAGTTTGCAGG pstS sequencing primer  
PST5 CGAGCAACAGCCAGTAG pstA sequencing primer  
PSTSLN CAACAGGATAAAGGTAGTGGAGG pstS sequencing primer  
PSTSRN CTGCACGGTCTTGGTCG pstS sequencing primer  
T3 CGCGCAATTAACCCTCACTAAAG pBluescript II KS+ sequencing primer  
T7 GCGCGTAATACGACTCACTATAG pBluescript II KS+ sequencing primer