Bacterial strains and serum samples
For this study we included 670 Hib strains collected during the years 1983–2006 by the Netherlands Reference Laboratory for Bacterial Meningitis (NRBM) from Dutch patients with invasive disease. Of these strains 409 were isolated from CSF and 245 strains were isolated from blood. The remainder of the strains was isolated from other normally sterile compartments such as joints. Hib strains are sent to the NRBM on a voluntary basis, but it is estimated that this results in coverage of more than 85% of all cases of invasive Hib disease in the Netherlands. The strain collection contained all available 282 Hib strains isolated from 1996–2006 and 388 randomly selected strains from the time period 1983–1996. From each year of latter time period, we included approximately 20 Hib strains isolated from 0–4 year old children and approximately 10 strains from patients older than 4 years, 75% of which were 18 years or older. In addition, we used Hib reference strain Eagan and vaccine strain 1482 kindly provided by Dr. R. Schneerson. Dr. L. van Alphen kindly provided us with 134 Hib strains from different locations in the world collected during the years 1980–1990. However, the nature of these strains, carriage or invasive disease, was unknown. Of the Dutch Hib strains 667 were typed by multiple-locus variable number tandem repeats analysis (MLVA) [9] and 237 by multi-locus sequence typing (MLST) [10, 9].
Positive serum samples for SBA and ELISA were obtained from 5 volunteers who received a single dose of ActHib vaccine (Aventis Pasteur MSD, Lyon, France) and a negative control serum was obtained from a volunteer who was not immunized (ages ranged from 25 to 57 years). Serum samples were collected 2 months after vaccination, aliquoted and stored at -20°C until use.
DNA sequencing of the capsular gene cluster
For sequencing of the complete Hib capsule gene cluster PCR products creating overlapping fragments of the gene cluster were used. Sequence reactions were performed with the ABI PRISM BigDye Terminator cycle sequencing kit v3.1 (Applied Biosystems, Foster City, Calif.) and analyzed on an AB3700 DNA sequencer. DNA sequences have been submitted to GenBank under acc.no. DQ368334 and acc.no. DQ368335.
Hib capsular genotype specific PCR
For PCR detection of the type I hcsA oligonucleotide primers HiHcsA12667F-I (GTACTTGTCATTGACCAAACTTT) and HiHcsA13116R-I (GGTATATTGAAAGTATGCTGCAT) yielding a 450 bp PCR product were used. To detect type II hcsA primers HiHcsA12668F-II (TGCTTGTCATCGATCAAA) and HiHcsA13484R-II (ACTAAAGAAAGGGGTGCAA) yielding a 817 bp PCR product were used. Two separate PCRs were performed in AB9700 PCR machines using the following protocol: 1 μl of 1:10 diluted heat-treated H. influenzae lysate was added to a 24 μl mixture containing 10 pmol of each primer and 12.5 μl diluted HotStar Taq mastermix (Qiagen, Hilden, Germany). The PCR program used was 15 min at 95°C, followed by 30 cycles of amplification that consisted of 30 sec at 95°C, 1 min at 52°C, and 1 min at 72°C and a final 7 min at 72°C. Strains were screened by type I PCR and all samples that did not yield a PCR product were analyzed again in both the type I and type II PCR. All strains for which the hcsA PCR products were used for sequence analysis were analyzed in both PCRs.
Serum bactericidal activity
Functional antibodies binding to the PRP capsule of Hib and fixing complement onto the bacterial surface were measured by an slightly modified assay for serum bactericidal activity (SBA) described by Romero-Steiner et al. [15]. Ten μl of heat inactivated serum was mixed with 20 μl of the diluted Hib suspension and incubated for 15 min at 35°C at 5% CO2. Thereafter, 25 μl of Hanks buffer (Life Technologies, Grand Island, N.Y., USA) with 2% Fildes (BBL, Becton Dickinson and Co., Sparks, Md., USA) and 25 μl of baby rabbit complement (Pel-Freez, Brown Deer, Wis., USA) was added and the mixture was incubated for 1 h at 35°C at 5% CO2. From the mixture 5 μl aliquots were applied onto 12 × 12 cm square culture plates filled with Brain Hearth Infusion agar, supplemented with Haemophilus test medium supplement (Oxoid, Haarlem, The Netherlands). SBA titers were defined as the serum dilution that resulted in >90% killing of the Hib culture used for the assay.
Inhibition of the serum bactericidal activity
Hib suspensions used for absorption assays were obtained from 100 ml overnight cultures, grown in supplemented Brain Hearth Infusion broth. Fifty ml of culture was centrifuged for 10 min at 3000 g, and the pellet was resuspended in 5 ml 150 Mm NaCl after which the bacteria were killed by a 10 min incubation at 65°C. In the SBA absorption assays 10 μl aliquots of heat inactivated serum samples were pre-absorbed with 10 μl heat killed Hib suspensions. The mixture was incubated for 1 h at 37°C followed by an overnight incubation at 4°C. The mixture was then centrifuged for 10 min at 10,000 g and the supernatant was used for SBA. To ensure the various cultures contained the same number of bacteria, real time quantative PCR and protein quantification were used to assess and adjust the number of bacteria in each culture used for absorption. Cell suspensions and supernatants were aliquoted and stored at -20°C until use.
Type b polysaccharide inhibition ELISA
To assess the level of the capsular polysaccharide expression of the various Hib strains an inhibition ELISA was designed. For this purpose an ELISA, described by Phipps et al. [16] and used to determine antibody titers against Hib polysaccharide was adapted. In contrast to the original method 1:20,000 diluted horse-radish-peroxidase labeled Protein A/G (Pierce, Rockford, USA) and TMB substrate solution (110 mM NaAc pH 5.5, 166 μg/ml 3,3',5,5' tetramethylbenzidine, 0.006% H2O2) were used. Reactions were stopped after 5 min using 2 M H2SO4, and values were read at 450 nm in a Biotek EL312e ELISA reader. In order to relate the degree of inhibition to the amount polysaccharide, serial dilutions of purified polysaccharide (HBO-HA, National Institute for Biological Standards and Control, Hertfordshire, United kingdom) with known concentration were added to HBO-HA-coated microtiter plates after which a single dilution of a high titer serum sample was added to all wells and incubated for 1 h at room temperature. Subsequently the ELISA was performed as described above.
Hib suspensions used for the inhibition ELISA were obtained from the same overnight grown type I and type II cultures as those used for the absorption of the SBA. Five ml culture was centrifuged as described above and the pellet was reconstituted in 5 ml PBS after which Hib in both supernatant and cellular fraction were heat killed. To ensure the various cultures contained the same number of bacteria, real time quantative PCR and protein quantification were used to assess and adjust the number of bacteria in each culture used for absorption. To assess the polysaccharide content in Hib strains, the above described cells and culture supernatants from type I and type II strains were pre-treated with 0.1% SDS for 30 min at 60°C and used in the inhibition ELISA described above.
Electron microscopy of Hib strains
Fixation and capsular stain were basically performed according to the lysine-acetate-based formaldehyde-glutaraldehyde ruthenium red-osmium fixation procedure (LLR-methode) method [17]. A 30 ml overnight culture of Hib grown in supplemented BHI was centrifuged for 10 min at 1800 g. Half of the supernatant was discarded and the remaining cells were fixed in paraformaldehyde and glutaraldehyde in the presence of ruthenium red after which they were imbedded in agarose by centrifugation, dehydrated using graded series of ethanol, impregnated in the epoxy resin glycidether 100 and finally polymerized in BEEM capsules at 60°C. Ultrathin sections were cut with a diamond knife, contrasted with 2% uranyl acetate, counterstained with lead citrate and examined in a FEI Tecnai12 transmission electron microscope.
Purification of the Hib polysaccharide
The capsular polysaccharide of various Hib strains was isolated and purified from liquid cultures as described before with some modifications [18]. Strains were cultured 22 hours at 35°C in 500 ml supplemented brain heart infusion broth. The culture was centrifuged for 30 min at 3000 g and 0.65% cetyl trimethyl ammonium bromide (CTAB) was added to the culture supernatant. After overnight incubation at 4°C the solution was centrifuged for 30 min. at 3000 g. The pellet was dissolved in 50 ml solution containing 1 M NaCl, 5 mM NaAc pH5.2 and 72% ethanol was added. After overnight incubation the solution was centrifuged for 30 min at 3000 g and the pellet was dissolved in 10 ml PBS (200 mM NaCl, 4.5 mM KCl, 17 mM phosphate buffer pH7.4). The solution was then purified on a Hi Prep 16/60 Sephacryl S300 high resolution column (GE Healthcare, Uppsala, Sweden) using PBS at a flow rate of 0.5 ml/min. The purified polysaccharide was eluted from the column in a 12 ml volume directly after the void volume. The purified polysaccharide was precipitated by adding 1 M NaCl, 5 mM NaAc pH5.2 and 72% ethanol and overnight incubation at 4°C. After centrifugation for 30 min. at 3000 g the pellet was dissolved in water, dialyzed extensively against water in a slide-a-lyzer with a 7000 Da cut-off (Pierce Biotechnology, Rockford, USA) and dried in a SpeedVac. The average yield of this procedure was 5–10 mg of purified PRP.
Nuclear magnetic resonance analysis of Hib polysaccharide
The purified PRP was analyzed by nuclear magnetic resonance (NMR) as described before [19]. Briefly, samples were dissolved in deuterated water (D2O), containing 0.075% (w/w) of trimethylsilyl-[D4]-propanoate sodium salt (Sigma-Aldrich, Zwijndrecht, The Netherlands). NMR-spectra were recorded on a JEOL JNM-ECP400 FT NMR system (JEOL, Tokyo, Japan) at 9.4 T using a pre-saturation pulse to lower the residual water peak.
