Two variants among Haemophilus influenzae serotype b strains with distinct bcs4, hcsA and hcsB genes display differences in expression of the polysaccharide capsule

Sequence analysis of the Hib capsule locus

The DNA sequence of the locus carrying the genes encoding the components required to synthesize and export the capsular polysaccharide was determined. Sequencing of the complete capsular gene cluster was performed on 9 Hib strains isolated from Dutch patients with invasive disease, on reference strain Eagan and on strain 1482 which has been used for the production of the Hib conjugate vaccine (Table 1). The 9 clinical isolates were selected because they represented pre- and post-vaccination strains and because they were isolated from vaccinated and non-vaccinated patients of various ages. Analysis revealed that the DNA sequence of the complete 17 kb capsule gene cluster was identical among 8 of the 9 Dutch Hib strains. The gene cluster of the divergent Hib strain, isolated from an 18 months old non-vaccinated patient in 1994, differed considerably from that of the other 8 strains (Fig. 1). We designated strains with the composition of the gene cluster found in the 8 strains as Hib type I and the strain with the aberrant gene cluster as Hib type II. Sequence analysis of the gene cluster of the Eagan strain and of the Hib vaccine strain 1482, yielded sequences that were virtually identical to the Dutch type II strain, with the exception of a single, silent C→T mutation at position 194 of the hcsA gene. The differences between the DNA sequences of the type I and type II capsule gene clusters were restricted to bcs3 (a single nucleotide polymorphism (SNP)), the bcs4 (12 SNPs + 24 bp deletion in type II), hcsA (93 SNPs) and hcsB (24 SNPs + 24 bp deletion in type II) genes. The 24 bp deletion in the bcs4 gene of type II strains results in an 8 amino acids loss in the C-terminal part of the product encoded by this gene. The 24 bp deletion of the hcsB gene was caused by a 2 bp deletion in the intergenic region between hcsA and hcsB, resulting in the loss of the ATG start codon of hcsB. However, a C→G SNP created a new start codon in the now 24 bp shorter hcsB gene. As a result HcsB in type II strains have an 8 amino acid shorter signal sequence.

Strain number	Age patient	Isolated from	Vaccine failure	Capsule locus type
Hib from pre-vaccination era
H1990-0614	14 months	CSF	No	I
H1991-1722	3 years	CSF	No	I
H1992-2218	10 months	CSF	No	I
H1994-0151	18 months	CSF	No	II
Hib from post-vaccination era
H2000-1692	71 years	Blood	No	I
H2000-1882	2 years	CSF	Yes	I
H2001-1610	3 years	Blood	Yes	I
H2002-2067	8 months	CSF	Yes	I
H2002-2328	73 years	Blood	No	I
Other Hib
Vaccine strain 1482			No	II
Strain Eagan			No	II

Comparison with the sequences in the publicly available databases revealed that sequences of the capsule gene clusters from 3 different Hib strains have been published [6]. Although the sequences were not identical, they were highly similar (e.g. 17 bp difference between type II sequences DQ368335 and AF54213) and it was clear that the capsule gene cluster in one of these 3 strains, a Hib minus strain isolated from a patient in the USA, is of type I (acc.no. AF549212). The capsule gene clusters of the other 2 strains, a regular Hib strain and a Hib minus strain, have a type II composition (acc.no. AF549213 and AF549210). Currently, the Sanger Institute, in collaboration with Dr. Derrick Crook and Prof. Richard Moxon, is sequencing the genome of a Hib isolate (strain 10810) from a meningitis patient from the United Kingdom [8]. The nucleotide sequence of the capsular genes in the unfinished genome sequence of this strain 10810 is identical to that of the type I capsular gene cluster found in the Dutch strains.

Distribution of Hib type I and type II strains

Sequence variation of the hcsA gene

We found only 2 variants of the capsule gene cluster in the 11 strains from which the complete gene cluster was sequenced, suggesting very limited variation of the capsular genes. To verify this finding we determined the DNA sequence of hcsA PCR products obtained from a large number of type I and type II strains. In total the DNA sequences of the hcsA PCR products obtained from 111 Dutch type I strains collected during the time period 1984 to 2006 were determined. The DNA sequences of 109 of the 111 PCR products were identical. Only two strains, one isolated in 1992 from a 99 year old patient and the other in 1996 from 4 months non-vaccinated old child, had an A→G SNP at position 597 of the type I hcsA gene that did not lead to an amino acid substitution. The DNA sequences of the hcsA PCR products from all 21 type II strains in the strain collection were determined and all products had identical sequences. In addition, the sequences of the hcsA PCR products of 14 type I and 13 type II Hib strains collected during the pre-vaccination era in various other parts of the world were also determined. This revealed very limited variation in the hcsA sequence of type I strains. As, The A→G SNP at position 597 of the type I hcsA gene which was also found in the Dutch Hib strains, appeared to be present in a strain from South-Africa, in one from Malaysia, one from Vietnam and in 2 strains from the USA. Furthermore, 2 strains from Cuba contained 2 SNPs: an A→G SNP at position 736 and a C→A SNP at position 806. Both base pair changes lead to amino acid substitutions. Remarkably, these SNPs correspond to the sequences found in the type II hcsA gene. All PCR products obtained from the 13 type II strains had sequences identical to the previously determined type II hcsA sequence.

Association between capsular type and genotype

Assessing 667 of the Dutch Hib strains by MLVA [9], revealed that the type II strains were not randomly distributed among the 47 MLVA types. Of the 22 type II strains, 13 (59%) had MLVA type 40 which is the predominant type among Dutch strains, one strain belonged to MLVA type 19 and the remaining 8 strains formed a separate branch of MLVA types not found among type I strains (Fig. 2). Of the collection of Dutch strains available, 247 Hib strains were analyzed by MLST [10, 9] and none of the 19 type II strains among this collection were of sequence type 6 (ST-6), which was by far the predominant sequence type (75%) among the 247 Hib strains (Fig 2). This suggested an inverse relationship between capsule locus type II and ST-6. To assess such a possible inverse relationship we amplified and subsequently sequenced the MLST fucK locus for all 89 type II Hib strains from our collection, including strains isolated in other countries. All strains with a fucK allele other than allele number 5 were classified as not having ST-6. Only a few type II Hib strains yielded fucK allele 5 and for these strains the MLST pgi locus was amplified and subsequently sequenced. None of these strains carried pgi allele 7. As pgi allele 7 and fucK allele 5 are part of the ST-6 allelic profile this showed that none of the type II isolates had ST-6, demonstrating an absolute inverse relationship between capsule locus type II and ST-6 genotype for the 89 type II Hib strains included in this study.

Composition of the capsular polysaccharide obtained from type I and type II strains

The sequence differences between the homologous genes in the type I and type II capsule loci prompted us to analyze the structure of capsular polysaccharides produced by type I and type II strains. NMR analysis of polysaccharides isolated from the culture supernatant of two type I and two type II strains showed no obvious differences between NMR spectra of the polysaccharides obtained from the two types, suggesting the structure of the polysaccharide from the two types is identical (Fig. 3). The few very minor differences in the NMR spectra were not associated with the two capsular genotypes.

Level of expression of polysaccharide capsule in type I and type II Hib strains

In order to detect differences in the level of capsule polysaccharide expression by capsule locus type I and type II strains, polysaccharide production was assessed by an inhibition ELISA. Four type I and 4 type II strains were analyzed to determine the level of polysaccharide production. The results showed that absorption of serum with cell fractions of the type I cultures caused more inhibition than with cells of type II strains. Using a standard curve based on inhibition with serial dilutions of purified polysaccharide, we deduced that the type I cells contained approximately twice as much capsular polysaccharide as type II cells (Fig. 4). This result was reproducible (the same experiment was performed three times) and statistically significant (ANOVA analysis, p ≤ 0.002). The culture supernatants from type I and type II cultures contained significantly more polysaccharide than the cellular fractions. However, the amount of polysaccharide in the culture supernatant from type I strains did not differ significantly from that of type II strains. This indicates that the amount of shed polysaccharide in type I and type II strains is the same, but that the total amount of polysaccharide produced in type I strains is higher.

Possible differences in the level of polysaccharide production were also assessed in a serum bactericidal assay. The SBA was performed using heat inactivated serum obtained from adult human volunteers that were immunized with Hib conjugate vaccine. Serial dilutions of the serum were used in SBAs using type I and type II Hib as target cells. Twice as much serum was required to kill 90% of the type I target cells in the SBA compared to the amount required to kill type II target cells (Fig. 5). Remarkably, the use of type I strains as target cells yielded a more pronounced pro-zone effect than type II strains. Cell fractions of the 4 type I and 4 type II strains used in the above described inhibition ELISA were used to perform absorption of a high titer serum from a human volunteer. Absorption of the serum with cells from the type I strains reduced its SBA titer from 1:2,048 to 1:32. In contrast, the serum sample retained an SBA titer of 1:128 after absorption with type II cells (Table 4.). The same 4-fold difference in reduction of SBA titer was observed if either type I or a type II Hib strains were used as target cells for the SBA. Other high titer serum samples absorbed with type I cells yielded similar results. Absorption with cell fractions of isogenic type I or type II Hib minus variants did not reduce the SBA titer, showing the observed reduction is caused by the polysaccharide and not by other components of the bacteria.

	SBA titer
	Type I target cells	Type II target cells
Unabsorbed	1:2,048	1:4,096
Absorbed with type I cells	1:32	1:64
Absorbed with type II cells	1:128	1:256

Electron microscopy of type I and type II strains

To determine if the observed difference in capsular expression could also be visualized on the surface of the bacterial cells, electron microscopy (EM) was performed. For this purpose overnight grown type I (H1976-0705) and type II (Eagan) cultures and their isogenic capsule minus variants were stained and fixed to visualize capsular structures on the surface of the cells. Examination by electron microscopy revealed that type I cells had a thinner capsular layer than the cells from type II strain (Fig. 6). The average thickness of the capsular layer of type I cells and type II cells was 42 nm (range 16–104 nm, SE 13 nm) and 72 nm (range 23–152 nm, SE 23 nm), respectively. However, the capsule of type I cells was more electron dense, appearing as a more compact layer on the cell surface compared the capsule of the type II cells.

Bacterial strains and serum samples

For this study we included 670 Hib strains collected during the years 1983–2006 by the Netherlands Reference Laboratory for Bacterial Meningitis (NRBM) from Dutch patients with invasive disease. Of these strains 409 were isolated from CSF and 245 strains were isolated from blood. The remainder of the strains was isolated from other normally sterile compartments such as joints. Hib strains are sent to the NRBM on a voluntary basis, but it is estimated that this results in coverage of more than 85% of all cases of invasive Hib disease in the Netherlands. The strain collection contained all available 282 Hib strains isolated from 1996–2006 and 388 randomly selected strains from the time period 1983–1996. From each year of latter time period, we included approximately 20 Hib strains isolated from 0–4 year old children and approximately 10 strains from patients older than 4 years, 75% of which were 18 years or older. In addition, we used Hib reference strain Eagan and vaccine strain 1482 kindly provided by Dr. R. Schneerson. Dr. L. van Alphen kindly provided us with 134 Hib strains from different locations in the world collected during the years 1980–1990. However, the nature of these strains, carriage or invasive disease, was unknown. Of the Dutch Hib strains 667 were typed by multiple-locus variable number tandem repeats analysis (MLVA) [9] and 237 by multi-locus sequence typing (MLST) [10, 9].

Positive serum samples for SBA and ELISA were obtained from 5 volunteers who received a single dose of ActHib vaccine (Aventis Pasteur MSD, Lyon, France) and a negative control serum was obtained from a volunteer who was not immunized (ages ranged from 25 to 57 years). Serum samples were collected 2 months after vaccination, aliquoted and stored at -20°C until use.

DNA sequencing of the capsular gene cluster

For sequencing of the complete Hib capsule gene cluster PCR products creating overlapping fragments of the gene cluster were used. Sequence reactions were performed with the ABI PRISM BigDye Terminator cycle sequencing kit v3.1 (Applied Biosystems, Foster City, Calif.) and analyzed on an AB3700 DNA sequencer. DNA sequences have been submitted to GenBank under acc.no. DQ368334 and acc.no. DQ368335.

Hib capsular genotype specific PCR

For PCR detection of the type I hcsA oligonucleotide primers HiHcsA12667F-I (GTACTTGTCATTGACCAAACTTT) and HiHcsA13116R-I (GGTATATTGAAAGTATGCTGCAT) yielding a 450 bp PCR product were used. To detect type II hcsA primers HiHcsA12668F-II (TGCTTGTCATCGATCAAA) and HiHcsA13484R-II (ACTAAAGAAAGGGGTGCAA) yielding a 817 bp PCR product were used. Two separate PCRs were performed in AB9700 PCR machines using the following protocol: 1 μl of 1:10 diluted heat-treated H. influenzae lysate was added to a 24 μl mixture containing 10 pmol of each primer and 12.5 μl diluted HotStar Taq mastermix (Qiagen, Hilden, Germany). The PCR program used was 15 min at 95°C, followed by 30 cycles of amplification that consisted of 30 sec at 95°C, 1 min at 52°C, and 1 min at 72°C and a final 7 min at 72°C. Strains were screened by type I PCR and all samples that did not yield a PCR product were analyzed again in both the type I and type II PCR. All strains for which the hcsA PCR products were used for sequence analysis were analyzed in both PCRs.

Serum bactericidal activity

Functional antibodies binding to the PRP capsule of Hib and fixing complement onto the bacterial surface were measured by an slightly modified assay for serum bactericidal activity (SBA) described by Romero-Steiner et al. [15]. Ten μl of heat inactivated serum was mixed with 20 μl of the diluted Hib suspension and incubated for 15 min at 35°C at 5% CO₂. Thereafter, 25 μl of Hanks buffer (Life Technologies, Grand Island, N.Y., USA) with 2% Fildes (BBL, Becton Dickinson and Co., Sparks, Md., USA) and 25 μl of baby rabbit complement (Pel-Freez, Brown Deer, Wis., USA) was added and the mixture was incubated for 1 h at 35°C at 5% CO₂. From the mixture 5 μl aliquots were applied onto 12 × 12 cm square culture plates filled with Brain Hearth Infusion agar, supplemented with Haemophilus test medium supplement (Oxoid, Haarlem, The Netherlands). SBA titers were defined as the serum dilution that resulted in >90% killing of the Hib culture used for the assay.

Inhibition of the serum bactericidal activity

Hib suspensions used for absorption assays were obtained from 100 ml overnight cultures, grown in supplemented Brain Hearth Infusion broth. Fifty ml of culture was centrifuged for 10 min at 3000 g, and the pellet was resuspended in 5 ml 150 Mm NaCl after which the bacteria were killed by a 10 min incubation at 65°C. In the SBA absorption assays 10 μl aliquots of heat inactivated serum samples were pre-absorbed with 10 μl heat killed Hib suspensions. The mixture was incubated for 1 h at 37°C followed by an overnight incubation at 4°C. The mixture was then centrifuged for 10 min at 10,000 g and the supernatant was used for SBA. To ensure the various cultures contained the same number of bacteria, real time quantative PCR and protein quantification were used to assess and adjust the number of bacteria in each culture used for absorption. Cell suspensions and supernatants were aliquoted and stored at -20°C until use.

Type b polysaccharide inhibition ELISA

To assess the level of the capsular polysaccharide expression of the various Hib strains an inhibition ELISA was designed. For this purpose an ELISA, described by Phipps et al. [16] and used to determine antibody titers against Hib polysaccharide was adapted. In contrast to the original method 1:20,000 diluted horse-radish-peroxidase labeled Protein A/G (Pierce, Rockford, USA) and TMB substrate solution (110 mM NaAc pH 5.5, 166 μg/ml 3,3',5,5' tetramethylbenzidine, 0.006% H₂O₂) were used. Reactions were stopped after 5 min using 2 M H₂SO₄, and values were read at 450 nm in a Biotek EL312e ELISA reader. In order to relate the degree of inhibition to the amount polysaccharide, serial dilutions of purified polysaccharide (HBO-HA, National Institute for Biological Standards and Control, Hertfordshire, United kingdom) with known concentration were added to HBO-HA-coated microtiter plates after which a single dilution of a high titer serum sample was added to all wells and incubated for 1 h at room temperature. Subsequently the ELISA was performed as described above.

Hib suspensions used for the inhibition ELISA were obtained from the same overnight grown type I and type II cultures as those used for the absorption of the SBA. Five ml culture was centrifuged as described above and the pellet was reconstituted in 5 ml PBS after which Hib in both supernatant and cellular fraction were heat killed. To ensure the various cultures contained the same number of bacteria, real time quantative PCR and protein quantification were used to assess and adjust the number of bacteria in each culture used for absorption. To assess the polysaccharide content in Hib strains, the above described cells and culture supernatants from type I and type II strains were pre-treated with 0.1% SDS for 30 min at 60°C and used in the inhibition ELISA described above.

Electron microscopy of Hib strains

Fixation and capsular stain were basically performed according to the lysine-acetate-based formaldehyde-glutaraldehyde ruthenium red-osmium fixation procedure (LLR-methode) method [17]. A 30 ml overnight culture of Hib grown in supplemented BHI was centrifuged for 10 min at 1800 g. Half of the supernatant was discarded and the remaining cells were fixed in paraformaldehyde and glutaraldehyde in the presence of ruthenium red after which they were imbedded in agarose by centrifugation, dehydrated using graded series of ethanol, impregnated in the epoxy resin glycidether 100 and finally polymerized in BEEM capsules at 60°C. Ultrathin sections were cut with a diamond knife, contrasted with 2% uranyl acetate, counterstained with lead citrate and examined in a FEI Tecnai12 transmission electron microscope.

Purification of the Hib polysaccharide

The capsular polysaccharide of various Hib strains was isolated and purified from liquid cultures as described before with some modifications [18]. Strains were cultured 22 hours at 35°C in 500 ml supplemented brain heart infusion broth. The culture was centrifuged for 30 min at 3000 g and 0.65% cetyl trimethyl ammonium bromide (CTAB) was added to the culture supernatant. After overnight incubation at 4°C the solution was centrifuged for 30 min. at 3000 g. The pellet was dissolved in 50 ml solution containing 1 M NaCl, 5 mM NaAc pH5.2 and 72% ethanol was added. After overnight incubation the solution was centrifuged for 30 min at 3000 g and the pellet was dissolved in 10 ml PBS (200 mM NaCl, 4.5 mM KCl, 17 mM phosphate buffer pH7.4). The solution was then purified on a Hi Prep 16/60 Sephacryl S300 high resolution column (GE Healthcare, Uppsala, Sweden) using PBS at a flow rate of 0.5 ml/min. The purified polysaccharide was eluted from the column in a 12 ml volume directly after the void volume. The purified polysaccharide was precipitated by adding 1 M NaCl, 5 mM NaAc pH5.2 and 72% ethanol and overnight incubation at 4°C. After centrifugation for 30 min. at 3000 g the pellet was dissolved in water, dialyzed extensively against water in a slide-a-lyzer with a 7000 Da cut-off (Pierce Biotechnology, Rockford, USA) and dried in a SpeedVac. The average yield of this procedure was 5–10 mg of purified PRP.

Nuclear magnetic resonance analysis of Hib polysaccharide

The purified PRP was analyzed by nuclear magnetic resonance (NMR) as described before [19]. Briefly, samples were dissolved in deuterated water (D2O), containing 0.075% (w/w) of trimethylsilyl-[D4]-propanoate sodium salt (Sigma-Aldrich, Zwijndrecht, The Netherlands). NMR-spectra were recorded on a JEOL JNM-ECP400 FT NMR system (JEOL, Tokyo, Japan) at 9.4 T using a pre-saturation pulse to lower the residual water peak.