Skip to main content

Table 2 E. coli strains1, plasmids, and primers used in this work

From: Integration of regulatory signals through involvement of multiple global regulators: control of the Escherichia coli gltBDF operon by Lrp, IHF, Crp, and ArgR

Strain/plasmid/primer Description Source or reference
Strains
   BE3471 PS2209 gltB (psiQ39)::lacZ (Mu d1-1734) [28]
   BE3479 PS2209 gltB (psiQ32)::lacZ (Mu d1-1734) [28]
   BE3779 PS2209 gltB (psiQ32)::lacZ (Mu d1-1734) lrp-35::Tn10 [28]
   BL21(DE3) F- ompT hsdS B (rB-mB-) gal dcm (DE3) Novagen
   JWD3 BE1 (W3110 lrp-201:: Tn10) pJWD2 [28]
   LP1000 PS2209 gltB::lacZ transcriptional fusion at λatt with -406 to +246 of the gltBDF operon [14]
   LP1050 LP1000 ΔargR This work
   LP1060 BL21DE3/pLP1060 This work
   LP1070 BL21DE3/pLP1070 This work
   LP1080 BL21DE3/pLP1080 This work
   LP1270 PS2209 gltB::lacZ transcriptional fusion at λatt with -270 to +246 of the gltBDF operon This work
   LP2002 W3110 rph+ This work
   LP2010 LP2002 ΔlacZYA This work
   LP2020 LP2010 gltB::lacZ transcriptional fusion at λatt with -406 to +246 of the gltBDF operon This work
   LP2023 LP2020 ΔargR This work
   PM2003 PS2209/pPM2005 This work
   PM2004 PS2209/pPM2006 This work
   PS2209 W3110 Δlac-169 F. C. Neidhardt
   W3110 F- prototroph rph F. C. Neidhardt
   XL1-Blue recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 Δlac-pro [F' proAB lacIqZΔM15 Tn10] Stratagene
Plasmids
   pBH403 pKK232-8 with promoterless lacZ gene inserted upstream of cat gene in a derivative of pBR322 [61, 62]
   pPM2005 pBH403 with gltB promoter region cloned from BamHI to SalI This work
   pPM2006 pPM2005 with mutations in the Crp-binding sequence This work
   PJWD2 pTrc 99A (Pharmacia) with the lrp coding sequence cloned into the NcoI site [28]
   pLP1060 pET23b (Novagen) with the argR coding sequence cloned into the NdeI/XhoI sites This work
   pLP1070 pET29a (Novagen) with the crp coding sequence inserted into the NdeI/XhoI sites This work
   pLP1080 pET28A (Novagen) with the himA and himD coding sequences inserted in tandem into the NcoI//BamHI sites This work
   pGEMT-easy Cloning vector Promega
   pKO3 Suicide vector [54]
Primers
   arg1 CGCCAGCAGCGCCGAGGACTGCGAC  
   arg2 CACTAATTATTGAGCTAATTAATACCGCGC  
   arg3 CATATGCGAAGCTCGGCTAAG  
   arg4 CTCGAGTTATTAAAGCTCCTGGTCGAACAGCTC  
   crp5 CCATATGGTGCTTGGCAAACCGC  
   crp6 CCTCGAGTTAACGAGTGCCGTAAACGAC  
   gltP1 CGGGATCCCATAATCACATAAATCACTTTTGCTTATC  
   gltP2 ACGCGTCGACAGCGGATTTCCAACTTATCG  
   gltcrp12 CAGTCAATTAATAAAGAATA TAA CGCTAAAGGCGG TTTCTGTACCAATAAGCTTGCC  
   gltcrp2 GGCAAGCTTATTGGTACAGAAACCGCCTTTAGCGTTATATTCTTTATTAATTGACTG  
   himA1 GGTACCGGCATCATTGAGGGATTGAACCTATGGCGCTTACA  
   himA2 CTCGAGCTCGTCTTTGGGCGAAGC  
   himD1 GGTACCTTAACCGTAAATATTGGCGCGATCGCG  
   himD2 TCATGACCAAGTCAGAATTGATAGAAGAC  
   lac6 GGATACGACGATACCGAAGACAGCTCATG  
   lac7 CGAGCCGGAAGCATAAAGTGTAAAGC  
   lac8 GCTTTACACTTTATGCTTCCGGCTCGGGCGTTCCTTGTCGGGTTATTCG  
   rph1 GCGTCTGATCGCCCGTGCTCTTCGCGC  
   rph23 CGTCGCTACAATGGATTCGATTCCCCC TCGGGC  
   rph33 GCCCGAG GGGGAATCGAATCCATTGTAGCGACG  
   rph4 ACGGCAGGTCCAGGTCGTGATGCTCCG  
  1. 1All strains are Escherichia coli K-12.
  2. 2The underlined bases alter the Crp-binding site in the gltBDF promoter.
  3. 3The underlined italic base is inserted to replace the base deleted in the rph mutation.