Open Access

Bactericidal activity of M protein conserved region antibodies against group A streptococcal isolates from the Northern Thai population

  • Nonglak Yoonim1Email author,
  • Colleen Olive3,
  • Chulabhorn Pruksachatkunakorn2 and
  • Sumalee Pruksakorn1
BMC Microbiology20066:71

https://doi.org/10.1186/1471-2180-6-71

Received: 15 June 2006

Accepted: 09 August 2006

Published: 09 August 2006

Abstract

Background

Most group A streptococcal (GAS) vaccine strategies have focused on the surface M protein, a major virulence factor of GAS. The amino-terminus of the M protein elicits antibodies, that are both opsonic and protective, but which are type specific. J14, a chimeric peptide that contains 14 amino acids from the M protein conserved C-region at the carboxy-terminus, offers the possibility of a vaccine which will elicit protective opsonic antibodies against multiple different GAS strains. In this study, we searched for J14 and J14-like sequences and the number of their repeats in the C-region of the M protein from GAS strains isolated from the Northern Thai population. Then, we examined the bactericidal activity of J14, J14.1, J14-R1 and J14-R2 antisera against multiple Thai GAS strains.

Results

The emm genes of GAS isolates were sequenced and grouped as 14 different J14-types. The most diversity of J14-types was found in the C1-repeat. The J14.1 type was the major sequence in the C2 and C3-repeats. We have shown that antisera raised against the M protein conserved C-repeat region peptides, J14, J14.1, J14-R1 and J14-R2, commonly found in GAS isolates from the Northern Thai population, are able to kill GAS of multiple different emm types derived from an endemic area. The mean percent of bactericidal activities for all J14 and J14-like peptide antisera against GAS isolates were more than 70%. The mean percent of bactericidal activity was highest for J14 antisera followed by J14-R2, J14.1 and J14-R1 antisera.

Conclusion

Our study demonstrated that antisera raised against the M protein conserved C-repeat region are able to kill multiple different strains of GAS isolated from the Northern Thai population. Therefore, the four conserved "J14" peptides have the potential to be used as GAS vaccine candidates to prevent streptococcal infections in an endemic area.

Background

Streptococcus pyogenes or group A streptococcus (GAS) is a human bacterial pathogen that colonizes the throat or skin surfaces of the host. GAS infection can lead to a number of diseases including pharyngitis, impetigo and necrotising fasciitis. In a small percentage of individuals that are left untreated or are treated ineffectively with antibiotics, streptococcal infections can lead to more serious illnesses such as rheumatic fever (RF) and rheumatic heart disease (RHD) which are a significant health concern in developing countries [1].

Most GAS vaccine strategies have focused on the M protein, a major virulence factor of GAS. The M protein has an alpha helical coiled-coil structure comprised of a variable amino terminal domain followed by a set of three repeat regions called A, B and C-repeats, a cell wall anchor motif and a stretch of hydrophobic amino acids which are embedded in the cell membrane. Antibodies to the highly variable amino terminal region of the M protein have been shown to be opsonic and protective in murine models and correlate with protection in humans [25]. However, there are more than 150 recognized emm genotypes [6] and an increasing number of non-M typeable strains [79]. Therefore, type-specific antibodies are ineffective in providing broad-spectrum protection against multiple different GAS strains. Strategies employed to develop a broad strain coverage GAS vaccine have included the design of multivalent constructs containing type-specific M protein sequences [1013] associated with a particular disease or geographical region and the identification of vaccine candidates based on the conserved C-region of the M protein [1417].

Many studies have investigated the potential of the M protein C-repeat region that is conserved among different GAS strains as a vaccine candidate [1417]. Using a series of 15 overlapping peptides spanning the entire M protein C-region, a peptide LRRDLDASREAKKQVEKALE (p145) that is recognized by antibodies in the sera of most adults living in areas of high GAS exposure was identified [16, 18]. The acquisition of these antibodies with age paralleled the acquisition of GAS immunity indicating the potential use of p145 as a vaccine candidate. Human sera with antibodies to p145 have also been shown to be opsonic against heterologus GAS strains. Similarly, mice immunized with p145 elicited antibodies that were opsonic against GAS [2, 3]. However, several studies indicated that p145 contained a T cell epitope shared with determinants on human cardiac myosin, and keratin in mouse [19]. In another study [20], J14 (KQAEDKVKASREAKKQVEKALE QLEDRVK), a peptide with minimal B and T cell epitopes within p145 was identified as a GAS M protein C-region peptide devoid of potentially deleterious T cell autoepitopes, but which contained an opsonic B cell epitope. J14 offers the possibility of a vaccine which will elicit protective opsonic antibodies against multiple different GAS strains. J14 is a chimeric peptide that contains 14 amino acids from M protein C-region (shown in bold) and is flanked by yeast-derived GCN4 sequences which was necessary to maintain the correct helical folding and conformational structure of the peptide.

From GenBank database search and many studies [3, 21], there are about 60% of GAS that contain J14 sequences, while the remaining contain J14-like sequences. Although J14 has the potential to be a vaccine candidate to prevent streptococcal infection, there are still one-third of M types that do not contain the J14 sequence but contain J14-like sequences. This study utilised three peptides, KQAEDKVKASREAKKKVEADLA QLEDRVK (J14.1), KQAEDKVKASREAKKQVEKDLA QAEDKVK (J14-R1) and KQAEDKVKASRAAKKELEAEHQ QAEDKVK (J14-R2), representing commonly occurring J14-like sequences, in addition to J14, and assessed their ability to elicit broadly opsonic antibodies following immunization of mice, and potential as vaccine candidates. It is likely that a vaccine incorporating J14 and J14-like sequences would be more beneficial in providing protection against streptococcal infections covering the majority of GAS M types.

Results and discussion

We searched for J14 and J14-like sequences and the number of their repeats in the C-terminal region of the M protein from GAS strains isolated from the Northern Thai population. Then, we examined the bactericidal activity of J14, J14.1, J14-R1 and J14-R2 antisera against multiple Thai GAS strains. This data is important to the development of an appropriate vaccine against GAS infection in a specific endemic population.

Distribution of J14 and J14-like sequences

Twenty different emm types of GAS isolated from ChiangMai, Thailand were included in this study. Emm types were analyzed by sequencing the N-terminal region of emm genes. The C-repeat region of emm genes of these isolates were sequenced to examine the distribution of J14 and J14-like sequences. The majority of the isolates 12/20 (60%) contained three C-repeats. Seven of 20 isolates (35%) contained two C-repeats. Only one isolate (5%), ST9, contained a single C-repeat (Table 1).
Table 1

Sequence of J14 types in the M protein C-repeat region of Thai GAS isolates

Isolate no.

emm type*

Year of collection

Source of isolation

C1-repeat

C2-repeat

C3-repeat

1

ST9

1985

throat

-

-

J14

2

M109

1990

nares

-

J14.1

J14.1

3

M70

1985

throat

-

J14.1

J14.1

4

M44

2000

skin

-

J14-R2

J14.1

5

M66

1985

throat

-

J14-R5

J14.1

6

M3

-

Ref

-

J14-R1

J14

7

ST1

1985

throat

-

J14-R9

J14-R6

8

STBSA29

2000

skin

-

J14-R4

J14-R11

9

M49

1985

skin

J14.1

J14.1

J14.1

10

M22

1985

throat

J14-R2

J14.1

J14.1

11

ST8

2000

hand

J14-R4

J14.1

J14.1

12

M75

1985

skin

J14-R6

J14.1

J14.1

13

TR2612

2000

blood

J14-R7

J14.1

J14.1

14

ST3

2000

skin

J14-R10

J14.1

J14.1

15

ST10

1995

throat

J14-R3

J14-R1

J14.1

16

ST6735

2000

leg

J14-R5

J14.1

J14-R12

17

M13

-

Ref

J14-R2

J14-R2

J14-R2

18

M18

-

Ref

J14-R1

J14-R1

J14

19

M74

1985

throat

J14-R3

J14-R3

J14

20

M5

-

Ref

J14-R3

J14-R8

J14

* emm gene sequencing. Ref, Reference strain from Health Protection Agency Center for Infection, Respiratory and Systemic Infection Laboratory, London, UK

J14, ASREAKKQVEKALE. J14.1, ASREAKKKVEADLA. J14-R1, ASREAKKQVEKDLA. J14-R2, ASRAAKKELEAEHQ. J14-R3, ASREAKKQLEAEHQ. J14-R4, ASRAAKKELEAKHQ. J14-R5, ASRAAKKDLEAEHQ. J14-R6, ASRAAKKELEANHQ. J14-R7, GSRAAKKELEAKHQ. J14-R8, ASREAKKQLEAEQQ. J14-R9, ASREAKKELEANHQ. J14-R10 ASRAAKKGLEAEHQ. J14-R11, ASREANKKVTSELT. J14-R12, ASRAAKKKVEADLA.

We found 14 different J14-types which were J14, J14.1, J14-R1 to J14-R12. The most diversity of J14-types was found in the C1-repeat which contained 9 different J14-types (Table 1). The C2-repeat contained 8 different J14-types with the majority being J14.1 (Table 1). In addition, J14.1 is also the major sequence within the C3-repeat. J14 was only found in the C3-repeat.

Although J14 has the potential to be a vaccine candidate to prevent streptococcal infection, only 5 of 20 (25%) GAS isolates in our study contained the J14 sequence in the C-repeat region. Interestingly, the J14.1 sequence was found with a higher rate, 12 of 20 (60%), than J14. In addition, we found that J14-R1 and J14-R2 are common among the remaining J14-types. Therefore, the four "J14" peptides; J14, J14.1, J14-R1 and J14-R2, are promising GAS vaccine candidates.

Bactericidal activity of GAS isolates

We have examined the bactericidal activity (% reduction in CFU) of J14, J14.1, J14-R1 and J14-R2 antisera against GAS isolates from Chiang Mai, Thailand.

Strong bactericidal activity (>70% reduction) was found against 75% (15/20), 80% (16/20), 65% (13/20) and 75% (15/20) of GAS isolates when tested with J14, J14.1, J14-R1 and J14-R2 antisera, respectively (Table 2). Medium bactericidal activity (50-70% reduction) was found against 25% (5/20), 15% (3/20), and 10% (2/20) of GAS isolates when tested with J14, J14-R1 and J14-R2 antisera, respectively (Table 2). Low bactericidal activity (<50% reduction) was found against 20% (4/20), 20% (4/20), and 15% (3/20) of GAS isolates when tested with J14.1, J14-R1 and J14-R2 antisera, respectively (Table 2).
Table 2

Bactericidal activity* (% reduction in CFU) of J14 peptide antisera against Thai GAS isolates with different emm types

Isolate no.

emm type

J14 (KALE)

J14.1 (ADLA)

J14-R1 (KDLA)

J14-R2 (AEHQ)

  

IMS/NMS

% reduction

IMS/NMS

% reduction

IMS/NMS

% reduction

IMS/NMS

% reduction

1

ST9

94.5 ± 20.8/200.6 ± 81.8

52.89 ± 10.36

110.5 ± 19.3/200.6 ± 81.8

44.92 ± 9.62

123.5 ± 17.3/200.6 ± 81.8

38.43 ± 8.63

82.9 ± 17.1/200.6 ± 81.8

58.67 ± 8.54

2

M109

34.6 ± 9.5/4025 ± 1753

99.14 ± 0.24

45.1 ± 28.6/4025 ± 1753

98.88 ± 0.71

38.3 ± 26.4/4025 ± 1753

99.05 ± 0.66

25.6 ± 7.8/4025 ± 1753

99.36 ± 0.19

3

M70

215.5 ± 136.5/5171 ± 1916

95.83 ± 2.64

123.9 ± 101.9/5171 ± 1916

97.60 ± 1.97

217.1 ± 112.9/5171 ± 1916

95.80 ± 2.18

152.5 ± 55.2/5171 ± 1916

97.05 ± 1.07

4

M44

10.5 ± 6.4/297.6 ± 140

96.47 ± 2.16

14.1 ± 7.5/297.6 ± 140

95.25 ± 2.52

63 ± 22.7/297.6 ± 140

78.83 ± 7.61

3.8 ± 3.1/297.6 ± 140

98.72 ± 1.03

5

M66

31.8 ± 9.5/117 ± 129

72.86 ± 8.11

11.2 ± 8.3/117 ± 129

90.46 ± 7.05

18.7 ± 11.1/117 ± 129

84.05 ± 9.45

5.2 ± 2.6/117 ± 129

95.58 ± 2.19

6

M3

102.9 ± 43.8/1514 ± 532

93.21 ± 2.89

268.4 ± 69.7/1514 ± 532

82.28 ± 4.60

634.3 ± 187.7/1514 ± 532

58.11 ± 12.4

30.4 ± 11.4/1514 ± 532

97.99 ± 0.75

7

ST1

7.5 ± 2.3/20.8 ± 8.2

63.94 ± 11.02

4.1 ± 1.5/20.8 ± 8.2

80.17 ± 7.18

10.2 ± 2.8/20.8 ± 8.2

51.12 ± 13.24

11.3 ± 1.3/20.8 ± 8.2

45.51 ± 6.05

8

STBSA29

16.4 ± 9.7/59.9 ± 44.9

72.66 ± 16.16

15.0 ± 3.5/59.9 ± 44.9

74.96 ± 5.84

29.2 ± 6.3/59.9 ± 44.9

51.31 ± 10.44

7.8 ± 4.5/59.9 ± 44.9

86.92 ± 7.57

9

M49

25.9 ± 14.8/278.5 ± 251

90.99 ± 5.15

31.6 ± 16.2/278.5 ± 251

89.01 ± 5.64

24.8 ± 22.1/278.5 ± 251

91.39 ± 7.68

22.5 ± 16.3/278.5 ± 251

92.17 ± 5.67

10

M22

52.9 ± 44.4/3437 ± 1099

98.46 ± 1.29

155.4 ± 66.7/3437 ± 1099

95.48 ± 1.94

246.1 ± 66.8/3437 ± 1099

92.84 ± 1.94

24.2 ± 11.6/3437 ± 1099

99.30 ± 0.34

11

ST8

391.3 ± 55.0/2336 ± 381

83.25 ± 2.36

663.2 ± 124.9/2336 ± 381

71.60 ± 5.35

485.8 ± 59.0/2336 ± 381

79.20 ± 2.52

576.8 ± 26.4/2336 ± 381

75.31 ± 1.13

12

M75

125.3 ± 75.1/1661 ± 1014

92.46 ± 4.52

191.2 ± 48.9/1661 ± 1014

88.49 ± 2.94

119 ± 79.1/1661 ± 1014

92.84 ± 4.77

75.9 ± 28.2/1661 ± 1014

95.43 ± 1.70

13

TR2612

394.3 ± 34.4/7776 ± 3043

94.93 ± 0.44

606.8 ± 163.4/7776 ± 3043

92.20 ± 2.10

212.6 ± 21.1/7776 ± 3043

97.27 ± 0.27

440.6 ± 69.2/7776 ± 3043

94.33 ± 0.89

14

ST3

3.0 ± 1.2/14.7 ± 8.3

79.59 ± 7.86

2.0 ± 1.1/14.7 ± 8.3

86.39 ± 7.35

1.1 ± 1.3/14.7 ± 8.3

92.35 ± 8.95

6.0 ± 2.6/14.7 ± 8.3

59.18 ± 17.78

15

ST10

22.2 ± 9.6/1284 ± 961

98.27 ± 0.75

82.6 ± 31.6/1284 ± 961

93.56 ± 2.46

52.6 ± 22.0/1284 ± 961

95.90 ± 1.71

61.8 ± 14.8/1284 ± 961

95.19 ± 1.15

16

ST6735

30.5 ± 4.5/87.5 ± 47

65.14 ± 5.13

75.7 ± 13.0/87.5 ± 47

13.52 ± 14.84

49.5 ± 6.5/87.5 ± 47

43.43 ± 7.43

51.0 ± 7.7/87.5 ± 47

41.71 ± 8.80

17

M13

72.6 ± 31.2/1130 ± 571

93.57 ± 2.76

196.5 ± 27.0/1130 ± 571

82.61 ± 2.39

320.3 ± 124.4/1130 ± 571

71.65 ± 11.0

46.6 ± 25.0/1130 ± 571

95.87 ± 2.21

18

M18

386.0 ± 68.2/2113 ± 650

81.73 ± 3.23

362.1 ± 157.9/2113 ± 650

82.86 ± 7.47

215.3 ± 195.4/2113 ± 650

89.81 ± 9.25

124.2 ± 54.2/2113 ± 650

94.12 ± 2.57

19

M74

270.8 ± 75.2/664.5 ± 228

59.24 ± 11.32

429.8 ± 83.4/664.5 ± 228

35.31 ± 12.55

383 ± 60.6/664.5 ± 228

42.36 ± 9.12

368.5 ± 42.9/664.5 ± 228

44.54 ± 6.45

20

M5

375.6 ± 47.4/1092 ± 154.9

65.60 ± 4.34

608.5 ± 24.2/1092 ± 154.9

44.28 ± 2.21

645.7 ± 54.3/1092 ± 154.9

40.87 ± 4.97

303.2 ± 44.4/1092 ± 154.9

72.23 ± 4.07

* The value is an average of experiment done in quadruplicate.

IMS/NMS: mean CFU in immune serum ± SD/mean CFU in normal serum ± SD

We also compared bactericidal activity of peptide antisera against GAS containing different numbers of C-repeats. The mean percent reduction in CFU of isolates with a single C-repeat was significantly lower than isolates with two or three C-repeats (Table 3). This result corresponded to a study of Vohra et al [21] which found that the mean percent reduction in CFU of isolates with two C-repeats was statistically lower than strains with three C-repeats.
Table 3

Bactericidal activity (mean % reduction in CFU) of J14 peptide antisera against Thai GAS isolates with different numbers of M protein C-repeats.

Isolate no.

Number of C-repeat

Bactericidal activity (% reduction)

  

J14 (KALE)

J14.1 (ADLA)

J14-R1 (KDLA)

J14-R2 (AEHQ)

1

single

52.89 ± 10.36*

44.91 ± 9.62*

38.43 ± 8.63*

58.67 ± 8.54*

2–8

two

84.87 ± 14.49

88.51 ± 9.41

74.04 ± 20.49

88.73 ± 19.52

9–20

three

83.60 ± 13.73

72.94 ± 26.88

77.49 ± 22.44

79.95 ± 21.07

* Significantly less (P < 0.05) compared to isolate numbers 2–8 and 9–20.

Recently, Sandin et al. [22] and McArthur et al. [23] have commented on the capacity of fibrinogen and albumin to bind to the B- and C-repeats, respectively, causing inhibition of antibody binding under physiological conditions. Nevertheless, several studies [18, 21, 2426] demonstrated the binding of anti-C-repeat antibody to GAS isolates, which are in agreement with our study.

Then, we examined the correlation between the opsonization specificity of peptide antisera and J14-types. We found no correlation between the opsonization ability of peptide antisera and J14-types contained in the C-repeats. For example, all J14 peptide antisera showed strong bactericidal activity (>70% reduction) against isolates 2 and 3 having only J14.1 with two C-repeats and isolate 9 also having only J14.1 but with three C-repeats.

These data indicate that these four peptides, J14, J14.1, J14-R1 and J14-R2, have the potential to be used as GAS vaccine candidates to prevent streptococcal infections.

For further study towards the development of a broad strain protective GAS vaccine, it may be possible to use a strategy designed to assemble all four J14 peptides into a single construct [27]. This would have several advantages, including inducing a heterologous opsonic immune response and also providing protection against challenge with many different GAS strains [4]. One such technology is the lipid core peptide (LCP) technology [25, 28] which has been used to incorporate up to four different peptides into a single LCP vaccine construct [29]. This system also incorporates the carrier and adjuvant into the vaccine and has the potential for the development of self-adjuvanting multi-antigen component vaccines for human application [25, 30].

Conclusion

Our study demonstrated that antisera raised against the M protein conserved C-repeat region are able to kill multiple different GAS strains isolated from the Northern Thai population. Therefore, the four conserved "J14" peptides have the potential to be used as GAS vaccine candidates to prevent streptococcal infections in an endemic area.

Methods

Bacteria

GAS strains used in this study were isolated from the normal population and patients with sore throat, rheumatic heart disease or impetigo in 1985, 1990, 1995, and 2000 from Chiang Mai, Thailand.

DNA isolation and PCR

DNA was isolated from GAS based on the method previously described [8, 31]. The sense primer (CAGTATTCGCTTAGAAAATT AAAA) is derived from the conserved leader sequence of the emm gene [32]. The antisense primer for OF-positive emm gene, P49 (TTGGGATCCTGCTGATCTT GAACGGTTAGC), is derived from the conserved region of the membrane anchor [33]. The antisense primer for OF-negative emm gene, P6 (TGCGGATCCAGCTGTT GCCATAACAGTAAG), is derived from the conserved region of the proline/glycine rich region [33]. The PCR conditions were 94°C for 1 minute, 35 cycles at 94°C for 30 second, 45°C for 30 second, and 72°C for 2 minutes, ending with 72°C for 10 minutes.

Searching for J14 and J14-like sequences and the number of their repeats in the conserved carboxy terminal segment of the M protein

The PCR products of emm gene were sequenced using the ABI Dye Terminator Cycle Sequencing Ready Reaction Kit following the manufacturer's instructions (The Perkin-Elmer Corporation) and determined by an ABI 310 automated sequencer (The Perkin-Elmer Corporation). The obtained DNA sequences of the conserved carboxy terminal segment of the M protein were deduced into an amino acid sequence and then searched for J14 sequence or J14-like sequences. The number of their repeats was recorded.

Peptides

J14, J14.1, J14-R1 and J14-R2, containing 29 amino acid sequences KQAEDKVKASREAKKQVEKALE QLEDRVK, KQAEDKVKASREAKKKVEADLA QLEDRVK, KQAEDKVKASREAKKQVEKDLA QAEDKVK and KQAEDK VKASRAAKKELEAEHQ QAEDKVK, respectively, were synthesized by the "tea-bag" method. Purity was checked by HPLC. Peptides were dissolved in water at a concentration of 10 mg/ml and kept at -20°C until used.

Antisera

Antisera to J14, J14.1, J14-R1 and J14-R2 peptides were raised in B10.BR mice. Mice, eight per group, were immunized subcutaneously at the tail base with 30 μg of peptide emulsified in complete Freund's adjuvant (a total of 50 μl was administered). Mice were given subsequent booster injections at intervals of 7 days with 3 μg peptide dissolved in PBS for 5 boosts. Prior to boosting, mice were bled and sera isolated were kept at -20°C until used. Antibody production was assessed by ELISA. Sera showing titer more than 6400 were pooled and used in indirect bactericidal assays to assess their ability to opsonize GAS.

ELISA

Peptides were diluted to 5 μg/ml in carbonate-bicarbonate buffer, pH 9.6, and coated onto microtiter plates in a volume of 100 μl per well overnight at 4°C. Excess antigen was removed and the wells were blocked with 200 μl of 5% skim milk in PBS-Tween 20 for 1.5 hr at 37°C. Plates were washed five times with PBS-Tween 20. Serum dilutions prepared in 0.5% skim milk in PBS-Tween 20 were added and incubated for 1.5 hr at 37°C. Plates were washed five times with PBS-Tween 20 and incubated with peroxidase conjugated sheep-anti-mouse IgG at a dilution of 1:3000 in 0.5% skimmed milk for 1.5 hr at 37°C. Plates were washed five times with PBS-Tween 20. 100 μl of o-phenylenediamine (OPD) substrate was added and incubated for 30 min. The optical density was measured at 450 nm in an ELISA plate reader. The highest dilution that gave an O.D. 3× higher than those of the average of control wells containing normal mouse serum at the same dilution was defined as the titer.

Indirect bactericidal assay

GAS isolates were cultured overnight in Todd-Hewitt broth at 37°C and diluted to 10-5 dilution in sterile NSS and kept on ice. Fifty μl of the bacterial dilution were plated out in duplicate using the pour plate method and incubated at 37°C for 24 hrs. The numbers of colonies were counted and the colony forming units (CFUs) from these plates were determined as the inoculum size. Fifty μl of the bacterial dilution were also mixed with 50 μl of serum (normal mouse or immune mouse) and then 400 μl of non-opsonic heparinized human donor blood was added. The mixtures were incubated end-over-end at 37°C for 3 hrs, and then 50 μl were plated out in duplicate using the pour plate method. CFUs were counted after 24 hrs of incubation. Bactericidal activity of immune sera (% reduction in mean CFU) was calculated as: 1-[mean CFUs in the presence of immune mouse sera/mean CFUs in the presence of normal mouse sera] × 100. Blood and bacterial controls were included with each isolate of GAS. Each isolate of GAS was done in quadruplicate.

Declarations

Acknowledgements

This study was supported by the Royal Golden Jubilee Ph.D. Program, the Thailand Research Fund, grant No. PHD/00100/2541 and the Thailand Research Fund, grant No. BGJ/17/2543.

Authors’ Affiliations

(1)
Department of Microbiology, Faculty of Medicine, Chiang Mai University
(2)
Department of Pediatrics, Faculty of Medicine, Chiang Mai University
(3)
Queensland Institute of Medical Research

References

  1. Cunningham MW: Pathogenesis of group A streptococcal infections. Clin Microbiol Rev. 2000, 13: 470-511. 10.1128/CMR.13.3.470-511.2000.PubMed CentralView ArticlePubMedGoogle Scholar
  2. Brandt ER, Hayman WA, Currie B, Carapetis J, Wood Y, Jackson DC, Cooper J, Melrose WD, Saul AJ, Good MF: Opsonic human antibodies from an endemic population specific for a conserved epitope on the M protein of group A streptococci. Immunology. 1996, 89: 331-337. 10.1046/j.1365-2567.1996.d01-754.x.PubMed CentralView ArticlePubMedGoogle Scholar
  3. Brandt ER, Hayman WA, Currie B, Pruksakorn S, Good MF: Human antibodies to the conserved region of the M protein:Opsonisation of heterologous strains of group A streptococci. Vaccine. 1997, 15: 1805-1812. 10.1016/S0264-410X(97)00178-3.View ArticlePubMedGoogle Scholar
  4. Brandt ER, Sriprakash KS, Hobb RI, Hayman WA, Zeng W, Batzloff MR, Jackson DC, Good MF: New multi-determinant strategy for a group A streptococcal vaccine designed for the Australian Aboriginal population. Nat Med. 2000, 6: 455-459. 10.1038/74719.View ArticlePubMedGoogle Scholar
  5. Brandt ER, Teh T, Relf WA, Hobb RI, Good MF: Protective and nonprotective epitopes from amino termini of M proteins from Australian aboriginal isolates and reference strains of group A streptococci. Infect Immun. 2000, 68: 6587-6594. 10.1128/IAI.68.12.6587-6594.2000.PubMed CentralView ArticlePubMedGoogle Scholar
  6. Streptococcus emm types.http://www.cdc.gov/ncidod/biotech/strep/emmtypes.htm
  7. Moses AE, Hidalgo-Grass C, Dan-Goor M, Jaffe J, Shetzigovsky I, Ravins M, Korenman Z, Cohen-Poradosu R, Nir-Paz R: emm typing of M nontypeable invasive group A streptococcal isolates in Israel. J Clin Microbiol. 2003, 41: 4655-4659. 10.1128/JCM.41.10.4655-4659.2003.PubMed CentralView ArticlePubMedGoogle Scholar
  8. Pruksakorn S, Sittisombut N, Phornphutkul C, Pruksachatkunakorn C, Good MF, Brandt E: Epidemiological analysis of non-M-typeable group A Streptococcus isolates from a Thai population in northern Thailand. J Clin Microbiol. 2000, 38: 1250-1254.PubMed CentralPubMedGoogle Scholar
  9. Tran PO, Johnson DR, Kaplan EL: The presence of M protein in nontypeable group A streptococcal upper respiratory tract isolates from Southeast Asia. J Infect Dis. 1994, 169: 658-661.View ArticlePubMedGoogle Scholar
  10. Hu MC, Walls MA, Stroop SD, Reddish MA, Beall B, Dale JB: Immunogenicity of a 26-valent group A streptococcal vaccine. Infect Immun. 2002, 70: 2171-2177. 10.1128/IAI.70.4.2171-2177.2002.PubMed CentralView ArticlePubMedGoogle Scholar
  11. Kotloff KL, Corretti M, Palmer K, Campbell JD, Reddish MA, Hu MC, Wasserman SS, Dale JB: Safety and immunogenicity of a recombinant multivalent group a streptococcal vaccine in healthy adults: phase 1 trial. JAMA. 2004, 292: 709-715. 10.1001/jama.292.6.709.View ArticlePubMedGoogle Scholar
  12. Hall MA, Stroop SD, Hu MC, Walls MA, Reddish MA, Burt DS, Lowell GH, Dale JB: Intranasal immunization with multivalent group A streptococcal vaccines protects mice against intranasal challenge infections. Infect Immun. 2004, 72: 2507-2512. 10.1128/IAI.72.5.2507-2512.2004.PubMed CentralView ArticlePubMedGoogle Scholar
  13. Dale JB: Multivalent group A streptococcal vaccine designed to optimize the immunogenicity of six tandem M protein fragments. Vaccine. 1999, 17: 193-200. 10.1016/S0264-410X(98)00150-9.View ArticlePubMedGoogle Scholar
  14. Mannam P, Jones KF, Geller BL: Mucosal vaccine made from live, recombinant Lactococcus lactis protects mice against pharyngeal infection with Streptococcus pyogenes. Infect Immun. 2004, 72: 3444-3450. 10.1128/IAI.72.6.3444-3450.2004.PubMed CentralView ArticlePubMedGoogle Scholar
  15. Batzloff MR, Yan H, Davies MR, Hartas J, Lowell GH, White G, Burt DS, Leanderson T, Good MF: Toward the development of an antidisease, transmission-blocking intranasal vaccine for group a streptococcus. J Infect Dis. 2005, 192: 1450-1455. 10.1086/466528.View ArticlePubMedGoogle Scholar
  16. Pruksakorn S, Galbraith A, Houghten RA, Good MF: Conserved T and B cell epitopes on the M protein of group A streptococci. Induction of bactericidal antibodies. J Immunol. 1992, 149: 2729-2735.PubMedGoogle Scholar
  17. Bessen D, Fischetti VA: Synthetic peptide vaccine against mucosal colonization by group A streptococci. I. Protection against a heterologous M serotype with shared C repeat region epitopes. J Immunol. 1990, 145: 1251-1256.PubMedGoogle Scholar
  18. Pruksakorn S, Currie B, Brandt E, Martin D, Galbraith A, Phornphutkul C, Hunsakunachai S, Manmontri A, Good MF: Towards a vaccine for rheumatic fever: identification of a conserved target epitope on M protein of group A streptococci. Lancet. 1994, 344: 639-642. 10.1016/S0140-6736(94)92083-4.View ArticlePubMedGoogle Scholar
  19. Pruksakorn S, Currie B, Brandt E, Phornphutkul C, Hunsakunachai S, Manmontri A, Robinson JH, Kehoe MA, Galbraith A, Good MF: Identification of T cell autoepitopes that cross-react with the C-terminal segment of the M protein of group A streptococci. Int Immunol. 1994, 6: 1235-1244.View ArticlePubMedGoogle Scholar
  20. Hayman WA, Brandt ER, Relf WA, Cooper J, Saul A, Good MF: Mapping the minimal murine T cell and B cell epitopes within a peptide vaccine candidate from the conserved region of the M protein of group A streptococcus. Int Immunol. 1997, 9: 1723-1733. 10.1093/intimm/9.11.1723.View ArticlePubMedGoogle Scholar
  21. Vohra H, Dey N, Gupta S, Sharma AK, Kumar R, McMillan D, Good MF: M protein conserved region antibodies opsonise multiple strains of Streptococcus pyogenes with sequence variations in C-repeats. Res Microbiol. 2005, 156: 575-582. 10.1016/j.resmic.2004.12.009.View ArticlePubMedGoogle Scholar
  22. Sandin C, Carlsson F, Lindahl G: Binding of human plasma proteins to Streptococcus pyogenes M protein determines the location of opsonic and non-opsonic epitopes. Mol Microbiol. 2006, 59: 20-30. 10.1111/j.1365-2958.2005.04913.x.View ArticlePubMedGoogle Scholar
  23. McArthur JD, Walker MJ: Domains of group A streptococcal M protein that confer resistance to phagocytosis, opsonization and protection: implications for vaccine development. Mol Microbiol. 2006, 59: 1-4. 10.1111/j.1365-2958.2005.04967.x.View ArticlePubMedGoogle Scholar
  24. Olive C, Hsien K, Horvath A, Clair T, Yarwood P, Toth I, Good MF: Protection against group A streptococcal infection by vaccination with self-adjuvanting lipid core M protein peptides. Vaccine. 2005, 23: 2298-2303. 10.1016/j.vaccine.2005.01.041.View ArticlePubMedGoogle Scholar
  25. Olive C, Batzloff MR, Horvath A, Wong A, Clair T, Yarwood P, Toth I, Good MF: A lipid core peptide construct containing a conserved region determinant of the group A streptococcal M protein elicits heterologous opsonic antibodies. Infect Immun. 2002, 70: 2734-2738. 10.1128/IAI.70.5.2734-2738.2002.PubMed CentralView ArticlePubMedGoogle Scholar
  26. Batzloff MR, Hayman WA, Davies MR, Zeng M, Pruksakorn S, Brandt ER, Good MF: Protection against group A streptococcus by immunization with J8-diphtheria toxoid: contribution of J8- and diphtheria toxoid-specific antibodies to protection. J Infect Dis. 2003, 187: 1598-1608. 10.1086/374800.View ArticlePubMedGoogle Scholar
  27. Jackson DC, O'Brien-Simpson N, Ede NJ, Brown AE: Free radical induced polymerization of synthetic peptides into polymeric immunogens. Vaccine. 1997, 15: 1697-1705. 10.1016/S0264-410X(97)00085-6.View ArticlePubMedGoogle Scholar
  28. Toth I, Danton M, Flinn N, Gibbons WA: A combined adjuvant and carrier system for enhancing synthetic peptides immunogenicity utilising lipidic amino acids. Tetrahedron Lett. 1993, 34: 3925-3928. 10.1016/S0040-4039(00)79265-3.View ArticleGoogle Scholar
  29. Olive C, Ho M, Dyer J, Lincoln D, Barozzi N, Toth I, Good MF: Immunization with a tetraepitopic lipid core peptide vaccine construct induces broadly protective immune responses against group A streptococcus. J Infect Dis. 2006, 193: 1666-1676. 10.1086/504266.View ArticlePubMedGoogle Scholar
  30. Olive C, Batzloff M, Horvath A, Clair T, Yarwood P, Toth I, Good MF: Potential of lipid core peptide technology as a novel self-adjuvanting vaccine delivery system for multiple different synthetic peptide immunogens. Infect Immun. 2003, 71: 2373-2383. 10.1128/IAI.71.5.2373-2383.2003.PubMed CentralView ArticlePubMedGoogle Scholar
  31. Yoonim N, Olive C, Pruksachatkunakorn C, Good MF, Pruksakorn S: M protein typing of Thai group A streptococcal isolates by PCR-Restriction fragment length polymorphism analysis. BMC Microbiol. 2005, 5: 63-10.1186/1471-2180-5-63.PubMed CentralView ArticlePubMedGoogle Scholar
  32. Manjula BN, Khandke KM, Fairwell T, Relf WA, Sriprakash KS: Heptad motifs within the distal subdomain of the coiled-coil rod region of M protein from rheumatic fever and nephritis associated serotypes of group A streptococci are distinct from each other: nucleotide sequence of the M57 gene and relation of the deduced amino acid sequence to other M proteins. J Protein Chem. 1991, 10: 369-384. 10.1007/BF01025251.View ArticlePubMedGoogle Scholar
  33. Podbielski A, Melzer B, Lutticken R: Application of the polymerase chain reaction to study the M protein(-like) gene family in beta-hemolytic streptococci. Med Microbiol Immunol (Berl). 1991, 180: 213-227.View ArticleGoogle Scholar

Copyright

© Yoonim et al; licensee BioMed Central Ltd. 2006

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.