Consecutive P. aeruginosa (90) isolates were recovered from different patients specimens (one per patient) submitted for bacteriological investigations at the Clinical Microbiology Laboratory at the American University of Beirut Medical Center (AUBMC), between September 2003 and May 2004. Patients acquiring a nosocomial infection due to P. aeruginosa as determined by clinical and laboratory testing and indicated in their medical records, were only considered in this study. Fever, and recovery of P. aeruginosa from the site of infection during stay at the medical center, constituted the most important criteria that defined patient's infection with this organism. Patients' data collected from the medical records, included age (2 to 91 years), sex (Males: 43 and Females: 47), admission date, admission diagnosis, invasive procedures used on the patients, symptoms, and the date of the first positive culture for P. aeruginosa. The drugs used in the treatment of these patients, mainly included: amikacin, azactam, gentamicin, tobramycin, and tazocin. Patients were distributed within ten different units in the medical center, mainly the Respiratory Care Unit (RCU), Intensive Care Unit (ICU), Coronary Care Unit (CCU), the Surgery Unit, as well as other units. Twenty three isolates were also collected from different environmental sources, such as, respirators, respirators' filters, water irrigation, tap water, basins, trays, bed side tables, side rails, and sink sides. Statistical analysis determined the sample size required to estimate the true proportion (percentage of P. aeruginosa infections during a given period of time) to within 0.10, with 95% confidence was calculated. Calculations estimated the minimum number of samples required to be 54 [9].
The presumptive identification of P. aeruginosa on culture based on colonial morphology, Gram stain microscopy, and oxidase test was further confirmed by the API NE Kits and growth at 42°C. Susceptibility of all isolates to a panel of antimicrobial agents (amikacin, aztreonam, ceftazidime, ciprofloxacin, gentamicin, imipenem, piperacillin/tazobactam, tobramycin) was determined according to the guidelines of the National Committee for Clinical Laboratory Standards (NCCLS) [10]. P. aeruginosa ATCC 25321 strain was used as positive control in all tests.
DNA was extracted from P. aeruginosa ATCC strain and from all isolates of P. aeruginosa by the GFX™ Genomic Blood DNA Purification Kit (Amersham PharmaciaBiotech, Uppsala, Sweden) according to the manufacturers' specifications. Random amplified polymorphic DNA (RAPD) analysis of the clinical and environmental isolates using two in-house oligonucleotide primers, Pa1 (5'AGGGGTCTTG 3') and Pa2 (5' CTTCTTCAGCTCGACGCGACG 3') was done. RAPD was carried out according to Matar et al [11] using the PTC-100™ Programmable Thermal Controller (MJ Research, Inc., Watertown, Mass., USA). Briefly, RAPD was carried out on all isolates in 100 μl reaction mixtures containing each: 10 μl of template DNA, 16 μl of dNTPs (0.2 mM), 10 μl of 10X PCR buffer (100 mM TrisHCl [pH 8.3], 500 mM KCl, 4 mM MgCl2), 1 μl of primer 1 (0.5 μM), 1 μl of primer 2 (0.3 μg/ μl), 2.5 U of Taq DNA polymerase and 61.5 μl of nanopure sterile water. The amplification program, included the following steps: denaturation at 94°C for 3s, annealing at 53°C for 1 min and extension at 72°C for 1 min, for 44 cycles. The cycles were followed by a final extension step at 72°C for 10 min. Amplicons were subjected to electrophoresis on 2% agarose gels at 107 volts for 2 hours. Patterns that had the same number of bands and similar fragments size were considered identical.
The enzymatic activities of the isolates of P. aeruginosa were evaluated by spot inoculation containing 106 CFU/ml of the organisms in various media [12]. Media used: Brain heart infusion for the protease activity, 1% elastin (Sigma Chemical Co. St Louis, Mo. USA) for the elastase activity, human fibrinogen type 1 (Sigma Chemical Co. St Louis, Mo. USA) for the fibrinolytic activity, trypticase soy agar (TSA) supplemented with egg yolk (Difco Laboratories, Detroit, Mi., USA) for the lecithinase production, TSA with tween 80 (Sigma Chemical Co. St Louis, Mo. USA) for the lipase activity, DNase test agar with toluidine blue 0, (Difco Laboratories, Detroit Mi., USA) for the DNAase production, and rabbit plasma (Difco Laboratories, Detroit Mi., USA) for the coagulase activity. Positivity of tests was assessed as follows: clearing of opacity around the inoculum spots for the protease, elastase and fibrinolytic activities, white precipitate around or beneath the inoculum spots for the lecithinase activity, a turbid halo around the inoculum spots for the lipase activity, formation of a pink halo around the inoculum spots for the DNase activity, and gelling of rabbit plasma after 48 hours for the coagulase activity.
