Skip to main content

Table 2 Primers used for cDNA synthesis, qPCR and Two-Hybrid cloning

From: Trehalose synthesis in Aspergillus niger: characterization of six homologous genes, all with conserved orthologs in related species

Primer name Sequence 5′-3′ Purpose
pKT25F ACGATTTCGAGGCGGTCAAG Confirmation of cloned cDNA to pKT25 vector
pUT18CF TGTCTTCTACGAGAACCGTGCATAC Confirmation of cloned cDNA to pUT18C vector