Open Access

Detection and genetic analysis of the enteroaggregative Escherichia coli heat-stable enterotoxin (EAST1) gene in clinical isolates of enteropathogenic Escherichia coli(EPEC) strains

  • Lucas EP Silva1,
  • Tamara B Souza1,
  • Neusa P Silva2 and
  • Isabel CA Scaletsky1Email author
BMC Microbiology201414:135

Received: 29 January 2014

Accepted: 23 May 2014

Published: 30 May 2014



The enteroaggregative E. coli heat-stable enterotoxin 1 (EAST1) encoded by astA gene has been found in enteropathogenic E. coli (EPEC) strains. However, it is not sufficient to simply probe strains with an astA gene probe due to the existence of astA mutants (type 1 and type 2 SHEAST) and EAST1 variants (EAST1 v1-4). In this study, 222 EPEC (70 typical and 152 atypical) isolates were tested for the presence of the astA gene sequence by PCR and sequencing.


The astA gene was amplified from 54 strains, 11 typical and 43 atypical. Sequence analysis of the PCR products showed that 25 strains, 7 typical and 18 atypical, had an intact astA gene. A subgroup of 7 atypical strains had a variant type of the astA gene sequence, with four non-synonymous nucleotide substitutions. The remaining 22 strains had mutated astA gene with nucleotide deletions or substitutions in the first 8 codons. The RT-PCR results showed that the astA gene was transcribed only by the strains carrying either the intact or the variant type of the astA gene sequence. Southern blot analysis indicated that astA is located in EAF plasmid in typical strains, and in plasmids of similar size in atypical strains. Strains carrying intact astA genes were more frequently found in diarrheic children than in non-diarrheic children (p < 0.05).


In conclusion, our data suggest that the presence of an intact astA gene may represent an additional virulence determinant in both EPEC groups.


EAST1 gene astA gene Enteropathogenic Escherichia coli


Enteropathogenic Escherichia coli (EPEC) are an important cause of infant diarrhea in developing countries [1]. The majority of EPEC isolates belong to classic serotypes derived from 12 classical O serogroups (O26, O55, O86, O111, O114, O119, O125, O126, O127, O128, O142, and O158) [2, 3]. EPEC induces attaching and effacing (A/E) lesions on epithelial cells, characterized by microvilli destruction, cytoskeleton rearrangement, and the formation of a pedestal-like structure at the site of bacterial contact [4]. The A/E genes are localized to the locus for enterocyte effacement (LEE) and encode intimin, a type III secretion system, secreted proteins and the translocated intimin receptor [57].

“Typical” EPEC strains (tEPEC) contain also the EPEC adherence factor (EAF) plasmid [8], which carries genes encoding a regulator (per) [9] and the bundle-forming pili (BFP) [10]. EPEC strains lacking the EAF plasmid have been designated “atypical” EPEC (aEPEC) [11]. Recent epidemiological studies indicate that aEPEC are more prevalent than tEPEC in both developed and developing countries [1]. Some aEPEC strains are genetically related to the enterohemorrhagic E. coli (EHEC), and both are considered as emerging pathogens [12].

Typical EPEC strains express only the virulence factors encoded by the LEE region and the EAF plasmid, with the exception of the cytolethal distending toxin produced by O86:H34 strains and the enteroaggregative heat-stable enterotoxin 1 (EAST1) found in O55:H6 and O127:H6 strains. In contrast, aEPEC strains frequently express EAST1 and additional virulence factors not encoded by LEE region [12]. In a previous study [13], EAST1 was the most frequent (24%) virulence factor found in a collection of 65 aEPEC strains, and was significantly associated with children diarrhea.

EAST1-positive aEPEC strains have been associated with outbreaks of diarrhea involving children and adults in the United State [14] and Japan [15]. However, it is not sufficient to simply probe strains with an astA gene probe due to the existence of EAST1 variants [16]. In one study, 100% of the O26, O111, O145, and O157:H7 enterohemorrhagic E. coli (EHEC) strains examined carried DNA sequences homologous to the EAST1 gene (SHEAST) with two different mutation types. Type 1 SHEAST has 12 nucleotide non-synonymous substitutions including one in the initiation codon; type 2 SHEAST lacks the first 8 codons of EAST1 sequence [16]. The focus of the study was to investigate the astA gene sequence present in tEPEC and aEPEC strains. The strains were collected in different cities of Brazil in different periods of time and in a previous study poor relatedness was observed by RAPD analysis of 118 strains belonging to this collection [13].

Results and discussion

We examined 222 EPEC strains (70 typical and 152 atypical) for the presence of the astA gene by PCR using primers that anneal to the 5’ ends of the EAEC 042 astA gene sequence [16]. Those strains were isolated from diarrheic and non diarrheic Brazilian children in previous studies [1720]. As shown in Table 1, 11 (16%) tEPEC and 43 (28%) aEPEC strains were positive in the PCR assay. Among the aEPEC PCR-positive strains, 13 belonged to the O26 and O119 serogroups.
Table 1

EPEC- astA strains isolated from diarrheic and non-diarrheic children



No. of strains (positive/total)


Diarrheic children

Non-diarrheic children

Total of children



























Other serotypesa






















































Other serotypesb












aO2:H2;H45; O101:H33; O145:HND; O157:HND; O162:H33; ONT:H45; ONT:HND.

bO4:HND; O15:HND O33:H6; O35:H19; O37:HND; O49:HND; O61:HND; O63:HND; O79:HND; O85:H40; O96:HND; O98:HND; O101:NM; O103:NM; O105:H7; O108:H31; O109:H54; O117:HND; O132:HND; O141:HND; O1523H2; O156:H16; O157:HND; O167:H6; O169:H6; O175:HND;ONT:NM; ONT:H18; ONT:HND.

Note: NM, nommotile, ND, nondetermined, ONT, nontypeable.

The 54 astA gene PCR products were sequenced. Twenty five strains, 7 tEPEC and 18 aEPEC, carried the DNA sequence identical to the EAST1 gene (042-type EAST1) (Figure 1). A subgroup of 7 aEPEC strains presented a variant type of the 042-type EAST1 gene sequence, with four non-synonymous nucleotide substitutions. Nine other strains, including one typical, carried either the sequence identical to type 1 SHEAST (7 strains) or to type 2 SHEAST (two strains). The remaining 13 strains carried mutated sequences of the 042-type EAST1 (five strains), type 1 SHEAST (two strains) or type 2 SHEAST (six strains) genes.
Figure 1

Nucleotide sequences of the PCR products from tEPEC (T) and aEPEC (A) strains. The nucleotide sequences of the EAST1, SHEAST1 and SHEAST2 genes are shown for comparison. Identical nucleotides are shown as dots. Asterisks indicate the positions of nucleotide deletion.

The expression of EAST1 was examined by RT-PCR and quantitative RT-PCR. The RT-PCR results showed that the astA gene was transcribed only by the strains carrying either the intact or the variant type of the astA gene sequence (Figure 2). The astA gene expression levels of the 32 RT-PCR positive strains (CT values ranged from 20.3 ± 0.11 to 21.6 ± 0.04) were nearly identical to that of EAEC 042 strain (CT value 20.8 ± 0.01).
Figure 2

Agarose gel electrophoresis of the RT-PCR products of representative strains of tEPEC (T) and aEPEC (A). EAEC 042 strain (C+) was used as positive control. Molecular size standard bands are at left.

Plasmids of the 54 PCR-positive strains were examined for astA gene presence by Southern blot hybridization with the astA probe. In 23 (42.6%) strains, a single copy of the astA gene was located to a large plasmid (Figure 3). In all the eleven tEPEC strains, the astA probe hybridized to the EAF plasmid as previously reported [21], and in twelve aEPEC the astA probe hybridized with large plasmids of similar size. The plasmids of the remaining strains were astA probe negative.
Figure 3

Southern blot hybridization of the plasmids of tEPEC (T) and aEPEC (A) strains. (A) and (C) Hybridization results with the astA probe. (B) Hybridization results with the EAF probe. EAEC 042 and EPEC E2348/69 were used as positive controls (C+) for astA and EAF probes, respectively. The arrows in panels A and C indicate the pAA2 plasmid (65-MDa) for EAEC 042 strain and the arrow in panel B indicate the EAF plasmid (60-MDa) for EPEC E2348/69 strain. Molecular size standard bands are at left.

We previously reported that 24% of 65 aEPEC strains hybridized with a DNA probe for EAST1 [13]. Here, we analyzed by PCR a larger group of EPEC, including typical strains and found that 11 (16%) of 70 tEPEC and 43 (28%) of 152 aEPEC were astA positive. Sequence analysis of the PCR products showed that 7 (63.6%) of 11 tEPEC and 18 (41.9%) of 43 aEPEC had an intact 042-type astA gene.

As shown in Table 2, strains carrying intact astA gene were more frequently found in diarrheic children than in non-diarrheic children (p = 0.03, Fisher’s exact test). However, we should point out that among the 222 strains analyzed only 118 were collected from a case–control study [13].
Table 2

Sequences of the astA gene found in EPEC strains isolated from diarrheic and non-diarrheic children

astAgene sequence type

N (%) of strains from:

Serogroup ( n)


Diarrheic children

Non-diarrheic children


042-type EAST1

24 (14.3)

1 (1.8)a

O9 (1), O33 (2), O108 (2), O111 (1), O119 (8), O142 (1), O152 (1), O157 (1), O169 (1), OND (7)


6 (3.6)

1 (1.8)

O26 (1), O9 (1), O96 (1) O111 (1), O141 (1), ONT (2)

type 1 SHEAST

6 (3.6)

1 (1.8)

O26 (1), O55 (1), O103 (1), O153 (1), OND (3)

type 2 SHEAST

2 (1.2)


O26 (1), O55 (1)




O26 (3), O55 (1), O111 (5), O119 (1), O127 (2), ONT (1)





ap = 0.03; Fisher’s exact test (diarrheic x non-diarrheic).

The EAST1 gene family includes one major type of sequence, i.e. the astA of EAEC strain 042 that is widely distributed among different diarrheagenic E. coli strains [2126] and four variant types of EAST1, i.e. the EAST1v1 of EAEC 17–2 [21, 22], EAST1v2 of EPEC N1 [21], and EAST1v3 and EAST1v4 of E. coli O166:H15 [25].In this study, a subgroup of aEPEC strains had a new variant type of EAST1 gene sequence that differed from those previously reported, and was denominated EAST1v5 (Figure 4). The RT-PCR analysis showed that EAST1v5 was transcribed to produce mRNA. However, more studies are necessary to determine whether EAST1v5 is associated with a functional polypeptide toxin.
Figure 4

Nucleotide sequence of the EAST1 gene and its variants, including the new one described in this study. Identical nucleotides are shown as dots.


In conclusion, our data suggest that the presence of an intact astA gene may represent an additional virulence determinant in both EPEC groups.


Bacterial strains

The 222 EPEC strains examined in this study included 176 strains isolated in 1999 to 2004 during an epidemiological study of acute diarrhea in children <2 years of age conducted in different regions of Brazil, and 46 strains isolated from children <5 years of age with diarrhea in São Paulo between 2002 to 2003 [1720]. All strains were characterized as tEPEC or aEPEC by hybridization with eae and EAF probes and serotyped (Table 1).

Ethics statement

The study was approved by the ethics committee of the Universidade Federal de São Paulo, Brazil. Stool samples were obtained with the written informed consent from the parents or guardians of the children.

PCR assays

For template DNA preparation, three to five isolated bacterial colonies grown on LB agar plates were pooled, suspended in 300 μl of sterile distilled water, and boiled for 10 min. PCR was carried out in a total volume of 25-μl containing 5 μl of template DNA. PCR primers were EAST13a (F-5’AGAACTGCTGGGTATGTGGCT) located 110 nucleotides upstream from the initiation ATG sequence of the astA gene, and EAST12b (R-5’CTGCTGGCCTGCCTCTTCCGT) located 20 nucleotides downstream from the stop TGA sequence of the astA gene [26]. Cycling conditions were denaturation for 30 s at 95°C, annealing for 120 s at 55°C, and polymerization for 120 s at 72°C (30 cycles). PCR products were analyzed by 2% agarose gel electrophoresis.

DNA hybridization

The following probes were used in this study: astA, a 111-bp PCR product from EAEC 042 strain with the primer set EAST11a (5’-CCATCAACACAGTATTCCGA) and EAST12b (5’-GGTCGCGAGTGACGGCTTTGT) [26]; and EAF, a 1.0 kb BamHI-SalI fragment from plasmid pMAR2 [27]. The DNA fragments were purified, labeled with [α-32P] dCTP with a DNA labeling kit (Amersham Pharmacia Biotech Inc., EUA) and used as probes. For Southern blotting, plasmid DNA was extracted using the method of Birnboim and Doly [28], separated in 0.8% agarose gel electrophoresis, and transferred to a nylon membrane, following a standard protocol [29]. Blots were hybridized in a solution containing the labeled probe (105 cpm), 5 × standard saline citrate (SSC), 2 × Denhardt’s solution (Invitrogen), 0.1% sodium dodecyl sulfate (SDS), and 5 mg/ml of salmon sperm DNA for 16 h at 65°C. After hybridization, washes were done in aqueous solution with 2 × SSC with 0.1% SDS and exposed to X-ray film.

RNA extraction and RT-PCR assays

Total RNA was extracted after bacterial growth in LB broth for 18 h at 37°C with the RNase Mini extraction kit (Qiagen) according to the manufacturer’s instructions. After extraction, approximately 1 μg of total RNA was digested with DNase I (Qiagen) for 30 min at 37°C, and the enzyme was then inactivated by adding 1 μl of 25 mM EDTA and heating the solution at 65°C for 10 min. To obtain the cDNA, the SperScript III One Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen) was used according to the manufacturer’s specifications. Primers for 16S ribosomal protein were used to control PCR [30], and the assay was then carried out with the primers EAST11a and EAST11b [26]. PCR products were analyzed by 2% agarose gel electrophoresis.

Quantitative PCR was performed in a Mastercycler ep realplex4 (Eppendorf), and threshold cycle numbers were determined using Eppendorf realplex software (version 2.0). Reactions were performed in triplicate, and threshold cycle numbers were averaged. The 50-μl reaction mixture was prepared as follows: 25 μl of Platinum® Quantitative PCR SuperMix-UDG (Invitrogen), 10 μM of the Taqman probe (5’FAM-TGCATCGTGCATATGGTGCGCAA) and 10 μM of each primer (R-5’GCGAGTGACGGCTTTGTAG and F-5’GAAGGCCCGCATCCAGTT), and 10 μl of cDNA (100 ng). The reaction consisted of: 2 min at 48°C; 10 min at 95°C followed by 40 cycles of 15 s at 95°C, 1 min at 60°C, and 1 min at 72°C. The astA expression of the tested strains was compared to the astA expression of EAEC 042, according to the formula, 2(-ΔΔCt)[31].

DNA sequencing

Nucleotide sequencing of the PCR products was performed at the Centro de Estudos do Genoma Humano-USP, São Paulo. Nucleotide sequence data were analyzed using SeqMan and MegAlign software and the BLAST tool (

Statistical analysis

Data for diarrheic and non diarrheic children were compared using a 2-tailed Chi-square test. Results with p values ≤ 0.05 were considered to be statistically significant.

Nucleotide sequence and accession number

The EAST1v5 gene sequence was deposited in the NCBI database under accession number KJ47188.



This study was supported by research grants from Fundação de Amparo a Pesquisa do Estado de São Paulo (FAPESP) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq). We thank Dr. Renata Torres de Souza for her help with the nucleotide sequence deposition.

Authors’ Affiliations

Departamento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de São Paulo
Disciplina de Reumatologia, Universidade Federal de São Paulo


  1. Ochoa TJ, Contreras CA: Enteropathogenic Escherichia coli infection in children. Curr Opin Infect Dis. 2011, 24: 478-483. 10.1097/QCO.0b013e32834a8b8b.PubMed CentralView ArticlePubMedGoogle Scholar
  2. WHO: Programme for Control of Diarrhoeal Diseases, Manual for Laboratory Investigation of Acute Enteric Infections. 1987, Geneva: World Health OrganizationGoogle Scholar
  3. Nataro JP, Kaper JB: Diarrheagenic Escherichia coli. Clin Microbiol Rev. 1998, 11: 142-201.PubMed CentralPubMedGoogle Scholar
  4. Moon HW, Whipp SC, Argenzio RA, Levine MM, Gianella RA: Attaching and effacing activities of rabbit and human enteropathogenic Escherichia coli in pig and rabbit intestines. Infect Immun. 1983, 41: 1340-1351.PubMed CentralPubMedGoogle Scholar
  5. Jerse AE, Yu J, Tall BD, Kaper JB: A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proc Natl Acad Sci U S A. 1990, 87: 7839-7843. 10.1073/pnas.87.20.7839.PubMed CentralView ArticlePubMedGoogle Scholar
  6. Jarvis KG, Girón JA, Jerse AE, McDaniel TK, Donnenberg MS, Kaper JB: Enteropathogenic Escherichia coli contains a putative type III secretion system necessary for the export of proteins involved in attaching and effacing lesion formation. Proc Natl Acad Sci U S A. 1995, 92: 7996-8000. 10.1073/pnas.92.17.7996.PubMed CentralView ArticlePubMedGoogle Scholar
  7. Kenny B, DeVinney R, Stein M, Finlay BB: Enteropathogenic E. coli (EPEC) transfers its receptor for intimate adherence into mammalian cells. Cell. 1997, 91: 511-520. 10.1016/S0092-8674(00)80437-7.View ArticlePubMedGoogle Scholar
  8. Baldini MM, Kaper JB, Levine MM, Candy DC, Moon HW: Plasmid-mediated adhesion in enteropathogenic Escherichia coli. J Pediatr Gastroenterol Nutr. 1983, 2: 534-539. 10.1097/00005176-198302030-00023.View ArticlePubMedGoogle Scholar
  9. Gómez-Duarte OG, Kaper JB: A plasmid-encoded regulatory region activates chromosome eaeA expression in enteropathogenic Escherichia coli. Infect Immun. 1995, 63: 1767-1776.PubMed CentralPubMedGoogle Scholar
  10. Girón JA, Ho AS, Schoolnik GK: An inducible bundle-forming pilus of enteropathogenic Escherichia coli. Science. 1991, 254: 710-713. 10.1126/science.1683004.View ArticlePubMedGoogle Scholar
  11. Kaper JB: Defining EPEC. Rev Microbiol São Paulo. 1996, 27: 130-133.Google Scholar
  12. Trabulsi LR, Keller R, Gomes TAT: Typical and atypical Enteropathogenic Eschericia coli (EPEC). Emerg Infect Dis. 2002, 8: 508-513. 10.3201/eid0805.010385.PubMed CentralView ArticlePubMedGoogle Scholar
  13. Dulguer MV, Fabricotti SH, Bando SY, Moreira-Filho CA, Fagundes-Neto U, Scaletsky ICA: Atypical enteropathogenic Escherichia coli strains: phenotypic and genetic profiling reveals a strong association between enteroaggregative E. coli heat-stable enterotoxin and diarrhea. J Infect Dis. 2003, 188: 1685-1694. 10.1086/379666.View ArticlePubMedGoogle Scholar
  14. Hedberg CW, Savarino SJ, Besser JB, Paulus CJ, Thelen VM, Myers LJ, Cameron DN, Barret TJ, Kaper JB, Osterholm MT: An outbreak of foodborne illness caused by Escherichia coli O39:NM, an agent not fitting into the existing scheme for classifying diarrheogenic E. coli. J Infect Dis. 1997, 176: 1625-1628. 10.1086/517342.View ArticlePubMedGoogle Scholar
  15. Yatsuyanagi Y, Salto S, Miyajima T: Characterization of atypical enteropathogenic Escherichia coli strains harboring the astA gene that were associated with a waterborne outbreak of diarrhea in Japan. J Clin Microbiol. 2003, 41: 2033-2039. 10.1128/JCM.41.5.2033-2039.2003.PubMed CentralView ArticlePubMedGoogle Scholar
  16. Yamamoto T, Taneike I: The sequences of enterohemorrhagic Escherichia coli and Yersinia pestis that are homologous to the enteroaggregative E. coli heat-stable enterotoxin gene: cross-species transfer in evolution. FEBS Lett. 2000, 472: 22-26. 10.1016/S0014-5793(00)01414-9.View ArticlePubMedGoogle Scholar
  17. Scaletsky ICA, Fabbricotti SH, Aranda KR, Morais MB, Fagundes-Neto U: Comparison of DNA hybridization and PCR assays for detection of putative pathogenic enteroadherent Escherichia coli. J Clin Microbiol. 2002, 40: 1254-1258. 10.1128/JCM.40.4.1254-1258.2002.PubMed CentralView ArticlePubMedGoogle Scholar
  18. Scaletsky ICA, Fabbricotti SH, Silva SO, Morais MB, Fagundes-Neto U: HEp-2–adherent Escherichia coli strains associated with acute infantile diarrhea, São Paulo, Brazil. Emerg Infect Dis. 2002, 8: 855-858. 10.3201/eid0808.010492.PubMed CentralView ArticlePubMedGoogle Scholar
  19. Araújo JM, Tabarelli GF, Aranda KR, Fabbricotti SH, Fagundes-Neto U, Mendes CM, Scaletsky ICA: Typical enteroaggregative and atypical enteropathogenic types of Escherichia coli (EPEC) are the most prevalent diarrhea-associated pathotypes among Brazilian children. J Clin Microbiol. 2007, 45: 3396-3399. 10.1128/JCM.00084-07.PubMed CentralView ArticlePubMedGoogle Scholar
  20. Scaletsky ICA, Aranda KR, Souza TB, Silva NP, Morais MB: Evidence of pathogenic subgroups among atypical enteropathogenic Escherichia coli strains. J Clin Microbiol. 2009, 47: 3756-3759. 10.1128/JCM.01599-09.PubMed CentralView ArticlePubMedGoogle Scholar
  21. Yamamoto T, Wakisaka N, Sato F, Kato A: Comparison of the nucleotide sequence of enteroaggregative Escherichia coli heat-stable enterotoxin 1 genes among diarrhea-associated Escherichia coli. FEMS Microbiol Lett. 1997, 147: 89-96. 10.1111/j.1574-6968.1997.tb10225.x.View ArticlePubMedGoogle Scholar
  22. Savarino SJ, McVeigh A, Watson J, Cravioto A, Molina J, Echeverria P, Bhan MK, Levine MM, Fasano A: Enteroaggregative Escherichia coli heat-stable enterotoxin is not restricted to enteroaggregative E. coli. J Infect Dis. 1996, 173: 1019-1022. 10.1093/infdis/173.4.1019.View ArticlePubMedGoogle Scholar
  23. Sousa CP, Dubreuil JD: Distribution and expression of the astA gene (EAST1 toxin) in Escherichia coli and Salmonella. Int J Med Microbiol. 2001, 291: 15-20. 10.1078/1438-4221-00097.View ArticleGoogle Scholar
  24. Savarino SJ, Fasano A, Watson J, Martin BM, Levine MM, Guandalini S, Guerry P: Enteroaggregative Escherichia coli heat-stable enterotoxin 1 represents another subfamily of E. coli heat-stable toxin. Proc Natl Acad Sci U S A. 1993, 90: 3093-3097. 10.1073/pnas.90.7.3093.PubMed CentralView ArticlePubMedGoogle Scholar
  25. Zhou Z, Ogasawara J, Nishikawa Y, Seto Y, Helander A, Hase A, Iritani N, Nakamura H, Arikawa K, Kai A, Kamata Y, Hoshi H, Haruki K: An outbreak of gastroenteritis in Osaka, Japan due to Escherichia coli serogroup O166:H15 that had a coding gene for enteroaggregative E. coli heat-stable enterotoxin 1 (EAST1). Epidemiol Infect. 2001, 128: 363-371.Google Scholar
  26. Yamamoto T, Echeverria P: Detection of the enteroaggregative Escherichia coli heat- stable enterotoxin 1 gene sequences in enterotoxigenic E. coli strains pathogenic for humans. Infect Immun. 1996, 64: 1441-1445.PubMed CentralPubMedGoogle Scholar
  27. Nataro JP, Baldini MM, Kaper JB, Black RE, Bravo N, Levine MM: Detection of an adherence factor of enteropathogenic Escherichia coli with a DNA probe. J Infect Dis. 1985, 152: 560-565. 10.1093/infdis/152.3.560.View ArticlePubMedGoogle Scholar
  28. Birnboim HC, Doly J: A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 1979, 247: 1513-1523.View ArticleGoogle Scholar
  29. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory Manual. 1989, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 2Google Scholar
  30. Leverton LQ, Kaper JB: Temporal expression of enteropathogenic Escherichia coli virulence genes in an in vitro model of infection. Infect Immun. 2005, 73: 1034-1043. 10.1128/IAI.73.2.1034-1043.2005.PubMed CentralView ArticlePubMedGoogle Scholar
  31. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001, 25: 402-408. 10.1006/meth.2001.1262.View ArticlePubMedGoogle Scholar


© Silva et al.; licensee BioMed Central Ltd. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.
