Skip to main content

Advertisement

Table 2 Primers for PCR amplifications.

From: Regulation of phenylacetic acid uptake is σ54 dependent in Pseudomonas putidaCA-3

Primer Sequence 5'-3' Annealing temp°C
GS326 acgatgcccagggagtagaga 60
OP2-55 gctgatggcgatgaatgaaca 55
TNInt2 cctgcaggcatgcaagcttcggc 65
27F agagtttgatcatggctcag 55
1492R ggttaccttgttacgactt 55
paaFf paaFr paaGf ggttgagcatgtaggacggt gccaataccgccttgcttga ccgaaggcaactgggtcac 57 57 55
paaGr aggcggcgttcttgttctg 55
paaLf cggcatgctcgcgaccacctg 60
paaLr aaagcgatgttctgcgactc 60
Sig54f-Hind tattacaagcttatgaaaccatcgctgtcctaaaaatga 60
Sig54r-Xba atcatttctagactacatcagtcgcttgcgttcgctcgab 60
paaLproF gccgcgcaacagccagagc 63
paaLproR cgccgagatgccgaggaagg 63
paaLf-Hind tattacaagcttatgacagccctgcgctccttcacctta 60
paaLr-Xba atcatttctagactagtggttactggccttggctb 60
  1. a: Hind III restriction site, b: Xba I restriction site.
  2. Oligonucleotide sequences and annealing temperatures utilised in polymerase chain reaction amplification of gene targets from P. putida CA-3 in this study.