Skip to main content

Table 2 Oligonucleotides used in the present study

From: Campylobacter jejuni dsb gene expression is regulated by iron in a Fur-dependent manner and by a translational coupling mechanism

Name Sequence Orientation//restriction site
H0B GTCTAGGATCC GCTTGATATCGCTGATTACT Fwd//BamHI
H4X ATCTGTCTAGAGCCAGCAGGAGCAATTACATCT Rev//XbaI
Cj16RS GCAGTCGAC TCAATGAAGGTAAGAGTAAG Rev//SalI
Cj17Bgl CCTAGATCT AGCCTGCTAAACACATTAGT Rev//BglII
Cj17Nde GTACAT ATGAACGAAATCAATAAAAC Fwd//NdeI
Cj17RBgl TTCAGATCT CTAATGTGTTTAGCAGGC Fwd//BglII
Cj17RM TATGAATTC AGGAATACCTGTGCTAACAA Rev//EcoRI
Cj17LSal GCTGTCGAC TGATAAGAAAGAATATTG Rev//SalI
Cj17WDBam-low GGATCC TGTGGGGAGTGCGATAG Rev//BamHI
Cj17WDBam-up GGATCC ACAGGTATTCCTCCTTATGTAG Fwd//BamHI
Cj18Bgl CCTAGATCT GATAATCAGTATCAAGGCGA Rev//BglII
Cj18L29 CCAAGCTACCATTACCtAACCAAAAGCCAAAT Rev//Ø
Cj18L29_c ATTTGGCTTTTGGTTaGGTAATGGTAGCTTGG Fwd//Ø
Cj18LM TATGGATCC CAGGAGCACTATTAACAATA Fwd//BamHI
Cj18M1R AAAGTTCAAGAAACTCCcTAGTATCTCCTTTG Rev//Ø
Cj18M1Rc CAAAGGAGATACTAgGGAGTTTCTTGAACTTT Fwd//Ø
Cj18Nde-Rev ATA CTGCAG CAAGAAACTC CATATG ATCTCC Rev//PstI, NdeI
Cj18RM TGAGGATCCAAGCCAAGCTACCATTACCA Rev//BamHI
Cj19LX-2 AGTTCTAGA AGTTGGACAGCTTGCTGATA Fwd//XbaI
Cjj43Eco GCAGAATTC AAGCATAGCAGGATCTTTGG Rev//EcoRI
Cjj43mwL CGTGGATCCCCGGGTA GGACTTATATTTAATC Fwd//SmaI, BamHI
Cjj44X AGTTCTAGA CATTTAGCCCTTCCTTACAG Rev//XbaI
Cjj45B ATCGGATCC GATACTATGGAGTTTCTTGA Fwd//BamHI
Cjj45Dig TCAAGAAACTCCATAGTATC Rev//Ø
Cjj46 CATGTGAAATCAATAATATC Fwd//Ø
Cjj46mwR ATACCCGGGGATCCA AAGTTACTGAAAGCTAC Rev//SmaI, BamHI
Cj-RT GCAGTCGAC TAGGATCGATAGTAGCTGAA Rev//SalI
Cjj879B ATCGGATCC CACAATCTAAAGGGTATTTC Fwd//BamHI
Cjj880 CTTATCCATAAAATATAATG Fwd//Ø
Cjj880B ATCGGATCC ACCTAGATTATTCTACTTTG Fwd//BamHI
Cjj880B2 ATCGGATCC TTTCCAGTAAAATTAGCAAG Fwd//BamHI
Cjj880X AGTTCTAGA CACATACAACAATAGATCTT Rev//XbaI
Cjj881B ATCGGATCC AAAATGAAAGATAATTGCAG Fwd//BamHI
Cjj881X AGTTCTAGA AAATGTGCTATACAAGTAAG Rev//XbaI
Cjj882 AGGTGTAAGTCTTGGAGAGC Fwd//Ø
Cjj882B ATGGATCC GACTTAGCAAAACTCTTTGT Fwd//BamHI
Cjj882X AGTTCTAGA AGAGTTTTGCTAAGTCTCAT Rev//XbaI
Cjj882B3 ATCGGATCC ATGATGATTATAGCAAATGC Fwd//BamHI
Cjj883X2 AGTTCTAGA GCTAATGCAAAACTTGAATA Rev//XbaI
CM-L ATATCACGCAATTAACTTGG Rev//Ø
CM-R GGATGAATTACAAGACTTGC Fwd//Ø
DIG_dsbA1 GCTAATGCAAAACTTGAATA Rev//Ø
DIG_dsbA2X CACATACAACAATAGATCTTG Rev//Ø
DIG_chuF CATATGAGAAATAATGCTTTC Fwd//Ø
EMSAchuR TTTGGGTGCAAATTTTACTC Rev//Ø
Fur-L TGAATTTTTATTGGTTTGATGC Fwd//Ø
Fur-R TCCTCATCTTCAATGTTTGC Rev//Ø
KAN-L TATCACCTCAAATGGTTCGCTGGG Rev//Ø
KAN-R GGGGATCAAGCCTGATTGGGAGA Fwd//Ø
KM-L1 GAGAATATCACCGGAATTGA Fwd//Ø
KM-R1 CTTCATACTCTTCCGAGCAA Rev//Ø
lacZ AGGTTACGTTGGTGTAGATG Rev//Ø
lacZ1 GGAATTCACTGGCCGTCGTT Fwd//Ø
  1. Bold letters indicate C. jejuni 81-176 sequences; restriction recognition sites introduced for cloning purposes are underlined, complementary fragments of primers Cjj46mwR and Cjj43mwL are marked with italics. Point mutated nucleotides in primers are marked with small letters. Orientation of the primers (Fwd states for forward/Rev - for reverse) refers to the orientation of particular C. jejuni gene studied. RT-Cj primer was designed on the basis of C. coli 72Dz/92 dsbI nucleotide sequence (there are 2 nucleotide changes compared to the nucleotide sequence of its orthologue from C. jejuni 81-176).