Skip to main content

Advertisement

Table 2 Primers used in Real time quantitative PCR

From: Inositol monophosphate phosphatase genes of Mycobacterium tuberculosis

Gene Primer pair Primer sequence
sigA SIGAF ATCTGCTGGAAGCCAACCT
  SIGAR GATCACCTCGACCATGTGC
impA IMPAF: CGATCTCGTCTTCGTCGC
  IMPAR: CCCTATGCTGCCAAGAATCTC
suhB IMPBF: GCGAGAAGCAGGCAGAATT
  IMPBR: CTCTCGGCGTTGACAACAA
impC IMPCF: GCTGCTTGAAGATGGCGTC
  IMPCR: CCACCAGGCAGTAAGACAGAA
cysQ CYSQF: ATCTGACGGACGACCTGACT
  CYSQR: CCAACGGGTCAATAATCCAC