Skip to main content

Table 1 Primers used in this study

From: Proteomic analysis of Salmonella enterica serovar Enteritidis following propionate adaptation

Primer name Sequence (5'→3') Amplification target
CpxR-F Long CCAGCACTTCCTGGCTTAAATGTTCACGGG cpxR in qRT-PCR
CpxR-R Long GGCCAAACGCTGGAGCTGACCGGTACGG cpxR in qRT-PCR
SodA-F Long GGTCACGATCCACGTTATGCCAAACTGAGCG sodA in qRT-PCR
SodA-R Long GATCGGGAAGCCGGAAGCGCCGGAAATGG sodA in qRT-PCR
rplF-F Long GGTCAACCGGGTGAGAGAAACCTAAAGACAGG rplF in qRT-PCR
rplF-R Long GGCTTCACTAAGAAGCTGCAGCTGGTTGG rplF in qRT-PCR
rplE-F Long GGGAAGATGATCTGCTCACGGACACCCATGC rplE in qRT-PCR
rplE-R Long GCCTGATCACTATTGCTGTTCCTCGTATCCG rplE in qRT-PCR
dps-F Long CGGCCAGTTCTTTTAAGTGATCCTGCACG dps in qRT-PCR
dps-R Long GGCGTTAGGCACCACGCAAGTTATCAACAGC dps in qRT-PCR
16 s rRNA-FP GGTAGCCAACTGCTGCTGTCT 16 S rRNA in qRT-PCR
16 s rRNA-RP CCGCAGCCGACATCCA 16 S rRNA in qRT-PCR
CpxR-P1 GTTGATGATGACCGAGAGCTGACTTCCCTGTGTGTA GGCTGGAGCTGCTT KmR gene from pKD4; specific for deletion of cpxR
CpxR-P2 AGCGGAAACCATCAGATAGCCGCGACCACGCATATG AATATCCTCCTTAG KmR gene from pKD4; specific for deletion of cpxR
CpxR-UpF CTGCTGACGCTGATGTTCGG region upstream of cpxR
CpXR-UpR CAGGGAAGTCAGCTCTCGGTC region upstream of cpxR
CpxR-DwnF CGTGGTCGCGGCTATCTGATGG region downstream of cpxR
CpxR-DwnR GCGGATGATCGGCGTTATCCGC region downstream of cpxR
dps-P1 TGCTTTATACCCGTAACGATGTATCAGAGAGCGTGT GTAGGCTGGAGCTGCTT KmR gene from pKD4; specific for deletion of dps
dps-P2 AGGTCGCGTGATGCGGCGGTAAAGATATCGGCCATA TGAATATCCTCCTTAG KmR gene from pKD4; specific for deletion of dps
dps-UpF CTGACCAGCATCGTGACAATGAGC region upstream of dps
dps-UpR CGCTCTCTGATACATCGTTACGG region upstream of dps
dps-DwnF GCCGATATCTTTACCGCCGC region downstream of dps
dps-DwnR GGGCAAAACCAGTATGCCGCACC region downstream of dps