Open Access

Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression

  • Marie-Laure Rosso1, 6,
  • Sylvie Chauvaux2,
  • Rodrigue Dessein1,
  • Caroline Laurans1, 7,
  • Lionel Frangeul3,
  • Céline Lacroix4,
  • Angèle Schiavo4,
  • Marie-Agnès Dillies4,
  • Jeannine Foulon2,
  • Jean-Yves Coppée4,
  • Claudine Médigue5,
  • Elisabeth Carniel2,
  • Michel Simonet1 and
  • Michaël Marceau1Email author
BMC Microbiology20088:211

DOI: 10.1186/1471-2180-8-211

Received: 02 July 2008

Accepted: 03 December 2008

Published: 03 December 2008

Abstract

Background

In man, infection by the Gram-negative enteropathogen Yersinia pseudotuberculosis is usually limited to the terminal ileum. However, in immunocompromised patients, the microorganism may disseminate from the digestive tract and thus cause a systemic infection with septicemia.

Results

To gain insight into the metabolic pathways and virulence factors expressed by the bacterium at the blood stage of pseudotuberculosis, we compared the overall gene transcription patterns (the transcriptome) of bacterial cells cultured in either human plasma or Luria-Bertani medium. The most marked plasma-triggered metabolic consequence in Y. pseudotuberculosis was the switch to high glucose consumption, which is reminiscent of the acetogenic pathway (known as "glucose overflow") in Escherichia coli. However, upregulation of the glyoxylate shunt enzymes suggests that (in contrast to E. coli) acetate may be further metabolized in Y. pseudotuberculosis. Our data also indicate that the bloodstream environment can regulate major virulence genes (positively or negatively); the yadA adhesin gene and most of the transcriptional units of the pYV-encoded type III secretion apparatus were found to be upregulated, whereas transcription of the pH6 antigen locus was strongly repressed.

Conclusion

Our results suggest that plasma growth of Y. pseudotuberculosis is responsible for major transcriptional regulatory events and prompts key metabolic reorientations within the bacterium, which may in turn have an impact on virulence.

Background

The Gram-negative bacterium Y. pseudotuberculosis is a human enteropathogen which is able to cross the intestinal mucosa through the M cells in Peyer's patches and thus infect the underlying tissues (causing ileitis and mesenteric lymphadenitis). However, in elderly or debilitated individuals (those suffering from malignancies, immunodeficiencies, chronic liver diseases or diabetes mellitus, for example), the organism frequently gains access to the bloodstream and can cause an often fatal septicemia [1, 2]. Known Y. pseudotuberculosis virulence genes are transcriptionally regulated by temperature – most probably in order to adapt to the bacterium's life cycle outside and inside the host. Regulation by the omnipresent thermal stimulus can be modulated (via a wide range of mechanisms) by signals such as pH, other ion concentrations and nutrient availability (reviewed in [3]). This allows bacterial pathogens to (i) adapt their gene transcription profiles in response to environmental cues sensed during the course of infection and (ii) express the most appropriate virulence factors at the expense of useless (or even detrimental) ones.

To date, the transcriptional gene regulation occurring when Y. pseudotuberculosis enters the human bloodstream has only been inferred indirectly from in vivo results in rodent models of infection [4, 5] and in vitro gene transcription studies. The in vitro regulation of certain Yersinia virulence loci has mainly been analyzed with respect to single growth parameter changes mimicking the environmental signals known (or assumed) to be detected by bacteria in blood, such as iron scarcity, oxygen tension and pH [6, 7]. In the present work, we have adopted an intermediate approach by comparing the overall gene expression profiles of Y. pseudotuberculosis grown in human plasma and in Luria-Bertani broth. We then compared the observed variations with those recently published for Y. pestis [8], an almost genetically identical pathogen which, however, causes plague – one of the most severe systemic infections in humans and other mammals.

Results and discussion

The genome of Y. pseudotuberculosis strain IP32953 has been recently deciphered: it contains 3,951 coding sequences (CDSs), of which 99 are borne by the virulence-associated plasmid pYV and 43 are carried by a 27-kb cryptic plasmid. Only around 49% of CDSs encode a product with a putative or proven function [9]. To gain insight into the transcriptional regulation of virulence and metabolism genes that takes place when Y. pseudotuberculosis enters and multiplies in the bloodstream, we compared the transcriptome of IP32953 grown in human plasma to the one of the same strain grown in Luria-Bertani (LB). To this end, we prepared macroarrays composed of 3,674 PCR fragments of ≈ 400-base pairs (bp), covering 96% of IP32953's CDSs and used them as described elsewhere [8] and in the Methods section. Briefly, in three independent cultures, total RNA was extracted from IP32953 cells grown in LB broth or human plasma, in the exponential or stationary phase and at 28°C or 37°C. Macroarray probing was performed three times with independently retrotranscribed and 33P-radiolabeled RNA samples from each of the eight growth combinations. After macroarray imaging, hybridization intensity data were log-transformed and normalized using a simple median normalization method. Relative data have been deposited in the Genoscript database http://genodb.pasteur.fr/cgi-bin/WebObjects/GenoScript in accordance with standards of the Microarray Gene Expression Data Society (MGED). An analysis of variance (ANOVA) was carried out independently for each gene, with the three biological factors of variation (medium, temperature and growth phase) as fixed effects. This statistical approach allowed us to evaluate the transcriptional variations induced by each factor for the dataset as a whole. Thus, three ratios (corresponding to each parameter) and associated p-values were calculated for each gene. Inter-condition transcriptional differences were considered to be statistically significant if the p-value was below 0.05. Representative macroarray hybridization results were confirmed by qRT-PCR on stored RNA samples, using the constitutively expressed YPTB0775 gene (spot ID YPO3356 and coding for the outer membrane lipoprotein NplD) as a reference (Additional file 1). Since the physiological status of the bacterium during host infection is unknown, we focused our analysis on genes regulated by the temperature and/or the medium in both the exponential and stationary phases. All Y. pseudotuberculosis transcriptional variations discussed herein were compared with those of their respective Y. pestis orthologs and are summarized in Table 1. Y. pseudotuberculosis IP32953 genes regulated at the transcriptional level by growth temperature and/or medium are listed in Tables 2 and 3.
Table 1

Y. pseudotuberculosis transcriptional variations discussed in this article compared with those recently published for Y. pestis [8]

Locus tags

  

gene transcription fold ratio human plasma/Luria Bertani broth (p-value)

Y. pseudotuberculosis

Y. pestis

Gene Name

Putative product/function

Y. pseudotuberculosis

Y. pestis

Iron uptake and storage

YPTB1659

YPO1783

ftnA

ferritin

0.180

(< 0.001)

0.341

(0.001)

YPTB0336

YPO0279

hmuV

ABC hemin transporter, ATP-binding subunit HmuV

1.665

(0.003)

1.499

(0.021)

YPTB0338

YPO0281

hmuT

ABC transporter, periplasmic hemin-binding protein HmuT

1.684

(0.016)

2.149

(0.001)

YPTB0339

YPO0282

hmuS

possible hemin degradation/transport protein HmuS

1.577

(0.022)

1.984

(< 0.001)

YPTB0340

YPO0283

hmuR

TonB-dependent outer membrane hemin receptor, HmuR

7.426

(< 0.001)

2.028

(< 0.001)

YPTB0739

YPO3392

fhuC

putative ABC type hydroxymate-dependent iron transport ATP binding protein

1.932

(0.047)

1.500

(0.258)

YPTB0740

YPO3391

fhuD

putative ABC type hydroxamate-dependent iron uptake ATP binding protein

1.836

(0.021)

1.174

(0.486)

YPTB1341

YPO1310

yiuA

putative ABC type periplasmic iron siderophore/cobalamin binding protein

3.085

(< 0.001)

1.737

(0.027)

YPTB1343

YPO1312

yiuC

putative siderophore/cobalamin ABC transporter, ATP-binding subunit

2.468

(< 0.001)

1.991

(0.012)

YPTB1512

YPO1496

 

putative heme-binding protein

2.456

(< 0.001)

0.921

(0.639)

YPTB1513

YPO1497

 

putative ABC transporter ATP-binding protein

1.877

(0.009)

1.408

(0.113)

YPTB1515

YPO1499

 

putative membrane protein

1.521

(0.045)

1.018

(0.921)

YPTB1540

YPO1528

ysuF

putative ferric iron reductase

4.019

(< 0.001)

3.137

(< 0.001)

YPTB1541

YPO1529

ysuJ

putative decarboxylase

2.092

(< 0.001)

1.246

(0.236)

YPTB1543

YPO1531

ysuH

putative siderophore biosynthetic enzyme

1.896

(0.021)

1.213

(0.387)

YPTB1544

YPO1532

ysuG

putative siderophore biosynthetic enzyme

2.403

(0.005)

1.830

(0.006)

YPTB1549

YPO1537

ysuR

putative OMR family iron-siderophore receptor

2.610

(< 0.001)

3.273

(0.001)

YPTB2117

YPO2193

tonB

TonB protein

5.464

(< 0.001)

2.563

(0.001)

YPTB2347

YPO2439

yfeA

ABC transporter, periplasmic iron siderophore-binding protein YfeA

11.88

(< 0.001)

10.22

(< 0.001)

YPTB2348

YPO2440

yfeB

ABC chelated iron transporter, ATP-binding subunit YfeB

3.141

(< 0.001)

2.772

(0.001)

YPTB2349

YPO2441

yfeC

ABC chelated iron transporter, permease subunit YfeC

4.375

(< 0.001)

1.817

(0.017)

YPTB2350

YPO2442

yfeD

ABC chelated iron transporter, permease subunit YfeD

2.103

(< 0.001)

1.369

(0.195)

YPTB2353

YPO2445

yfeE

putative yfeABCD locus regulator

1.527

(0.008)

2.085

(0.001)

YPTB3263

YPO0989

iucA

possible siderophore biosynthesis protein, IucA familly

3.789

(< 0.001)

2.059

(0.033)

YPTB3265

YPO0992

iucC

putative siderophore biosynthesis protein IucC

2.600

(< 0.001)

0.920

(0.711)

YPTB3266

YPO0993

iucD

putative siderophore biosynthesis protein IucD

2.151

(0.002)

0.631

(0.036)

YPTB3298

YPO1011

 

putative TonB-dependent O-M, iron siderophore receptor/tranporter

2.150

(0.005)

1.845

(0.018)

YPTB3383

YPO0682

exbB

possible MotA/TolQ/ExbB proton channel family protein

4.165

(< 0.001)

3.021

(< 0.001)

YPTB3382

YPO0683

exbD

pExbD/TolR-family transport protein

9.811

(< 0.001)

3.576

(< 0.001)

YPTB3701

YPO0205

bfd

putative bacterioferritin-associated ferredoxin

1.857

(0.002)

3.195

(< 0.001)

YPTB3700

YPO0206

bfr

bacterioferritin

1.153

(0.255)

4.483

(< 0.001)

YPTB3767

YPO0133

feoA

conserved hypothetical protein

1.510

(0.046)

1.081

(0.648)

YPTB3769

YPO0131

feoC

conserved hypothetical protein

1.900

(0.001)

1.964

(0.002)

YPTB3857

YPO4022

 

putative ABC transporter, periplasmic iron siderophore ferrichrome binding protein

3.127

(< 0.001)

2.157

(< 0.001)

YPTB3858

YPO4023

 

putative ABC iron siderophore transporter, permease subunit

2.236

(0.001)

1.214

(0.529)

YPTB3860

YPO4025

 

putative ABC iron siderophore transporter, ATP-binding subunit

2.216

(0.001)

1.417

(0.041)

YPTB1246

YPO1207

katA

putative catalase

0.324

(< 0.001)

0.556

(0.002)

YPTB0811

YPO3319

katY

putative catalase-hydroperoxidase HPI I

0.603

(0.009)

0.717

(0.342)

Biotin operon

YPTB1181

YPO1150

bioA

putative adenosylmethionine-8-amino-7-oxononanoate aminotransferase

3.377

(< 0.001)

2.512

(0.002)

YPTB1183

YPO1152

bioF

putative 8-amino-7-oxononanoate synthase

3.800

(< 0.001)

2.595

(< 0.001)

YPTB1184

YPO1153

bioC

putative biotin synthesis protein BioC

1.784

(0.004)

1.351

(0.374)

YPTB1185

YPO1154

bioD

putative dethiobiotin synthetase

2.499

(0.002)

1.780

(0.026)

Superoxyde dismutases

YPTB3925

YPO4061

sodA

putative superoxide dismutase [Mn]

3.101

(< 0.001)

1.796

(0.049)

YPTB2299

YPO2386

sodB

superoxide dismutase [Fe]

0.090

(< 0.001)

0.326

(< 0.001)

Ribonucleotides reductases (RNR)

YPTB2956

YPO2650

nrdI

probable NrdI protein homologue

2.842

(0.001)

8.784

(< 0.001)

YPTB2957

YPO2649

nrdE

putative ribonucleoside-diphosphate reductase 2 alpha chain

4.745

(< 0.001)

9.007

(< 0.001)

YPTB2958

YPO2648

nrdF

putative ribonucleoside-diphosphate reductase 2 beta chain

2.672

(0.002)

2.142

(0.011)

YPTB2955

YPO2651

nrdH

putative glutaredoxin

1.407

(0.152)

3.439

(< 0.001)

YPTB1254

YPO1214

nrdA

putative ribonucleoside-diphosphate reductase 1 alpha chain

0.329

(< 0.001)

0.668

(0.085)

YPTB1253

YPO1213

nrdB

putative ribonucleoside-diphosphate reductase 1 beta chain

0.815

(0.351)

0.579

(0.020)

YPTB0519

YPO3454

nrdD

putative anaerobic ribonucleoside-triphosphate reductase

0.614

(0.025)

0.373

(< 0.001)

YPTB0518

YPO3455

nrdG

putative anaerobic ribonucleotide reductase activating protein

0.440

(0.001)

0.508

(0.019)

Mannose and glucose uptake

YPTB1634

YPO1758

manX

probable PTS system, mannose-specific IIAB component

2.673

(< 0.001)

3.234

(< 0.001)

YPTB1633

YPO1757

manY

probable PTS system, mannose-specific IIC component

1.991

(0.006)

2.201

(< 0.001)

YPTB1632

YPO1756

manZ

probable PTS system, mannose-specific IID component

3.084

(< 0.001)

3.676

(< 0.001)

YPTB2463

YPO1608

ptsG,

putative PTS system, glucose-specific IIBC component

4.033

(< 0.001)

1.708

(0.027)

YPTB2715

YPO2993

ptsH

probable PTS system, phosphocarrier protein

1.697

(0.002)

1.422

(0.109)

YPTB2716

YPO2994

ptsI

putative PTS sytem, enzyme I component

1.946

(< 0.001)

1.351

(0.038)

YPTB2717

YPO2995

crr

putative PTS system, glucose-specific IIA component, permease

1.611

(0.002)

1.440

(0.117)

Sugar metabolism

YPTB0074

YPO0078

pfkA

putative 6-phosphofructokinase

1.594

(0.017)

1.430

(0.073)

YPTB3195

YPO0920

fbaA, fba, fda

possible fructose-bisphosphate aldolase class II

1.325

(0.049)

1.504

(0.104)

YPTB3196

YPO0921

pgk

putative phosphoglycerate kinase

1.365

(0.024)

1.365

(0.099)

YPTB1166

YPO1133

gpmA, gpm

putative phosphoglycerate mutase 1

3.179

(< 0.001)

3.650

(< 0.001)

YPTB2047

YPO2064

pykA

putative pyruvate kinase II

0.486

(0.001)

0.604

(0.013)

YPTB2306

YPO2393

pykF

probable pyruvate kinase I

2.282

(< 0.001)

1.322

(0.185)

YPTB3762

YPO0138

pck

putative phosphoenolpyruvate carboxykinase [ATP]

0.395

(0.001)

1.213

(0.460)

YPTB2103

YPO2180

adhE, ana

putative aldehyde-alcohol dehydrogenase

2.116

(0.001)

3.383

(< 0.001)

YPTB0460

YPO3516

mdh

putative malate dehydrogenase

0.665

(0.010)

0.394

(< 0.001)

YPTB0796

YPO3335

fumA, fumB

putative fumarase A fumarate hydratase class I, aerobic isozyme

0.351

(< 0.001)

0.501

(0.020)

YPTB0413

YPO0360

frdA

putative fumarate reductase flavoprotein subunit

0.156

(< 0.001)

0.299

(< 0.001)

YPTB0412

YPO0359

frdB

putative fumarate reductase iron-sulfur protein

0.127

(< 0.001)

0.217

(< 0.001)

YPTB0411

YPO0358

frdC

putative fumarate reductase hydrophobic protei

0.248

(< 0.001)

0.403

(< 0.001)

YPTB0410

YPO0357

frdD

putative fumarate reductase hydrophobic protein

0.393

(0.001)

0.372

(< 0.001)

YPTB1145

YPO1111

sdhA

putative succinate dehydrogenase flavoprotein subunit

0.497

(< 0.001)

0.124

(< 0.001)

YPTB1144

YPO1110

sdhD

putative succinate dehydrogenase hydrophobic membrane anchor protein

0.501

(< 0.001)

0.165

(< 0.001)

YPTB1143

YPO1109

sdhC

putative succinate dehydrogenase cytochrome b-556 subunit

0.553

(0.016)

0.241

(0.001)

YPTB1146

YPO1112

sdhB

putative succinate dehydrogenase iron-sulfur protein

0.592

(0.004)

0.196

(< 0.001)

YPTB1149

YPO1115

sucC

putative succinyl-CoA synthetase beta chain

0.419

(< 0.001)

0.205

(< 0.001)

YPTB1150

YPO1116

sucD

putative succinyl-CoA synthetase alpha chain

0.525

(< 0.001)

0.236

(0.001)

YPTB1148

YPO1114

sucB

putative dihydrolipoamide succinyltransferase component

0.610

(0.014)

0.267

(0.003)

YPTB1147

YPO1113

sucA

putative 2-oxoglutarate dehydrogenase E1 component

0.516

(0.007)

0.193

(< 0.001)

YPTB0716

YPO3415

acnB

putative aconitate hydratase 2

0.510

(< 0.001)

0.319

(< 0.001)

YPTB3656

YPO3725

aceA, icl

isocitrate lyase

2.068

(0.003)

1.298

(0.319)

YPTB3657

YPO3726

aceB, mas

malate synthase A

1.875

(0.053)

1.089

(0.710)

YPTB2222

YPO2300

fnr, nirR

putative fumarate and nitrate reduction regulatory protein

0.699

(0.002)

0.877

(0.621)

YPTB0601

YPO0458

arcA

probable response regulator (OmpR family)

0.464

(0.001)

0.705

(0.036)

Porins

YPTB1964

YPO1411

ompC2

putative outer membrane protein C2, porin

0.835

(0.447)

1.827

(0.001)

YPTB1261

YPO1222

ompC

putative outer membrane protein C, porin

0.285

(< 0.001)

0.659

(0.013)

YPTB1453

YPO1435

ompA

putative outer membrane porin A protein

1.085

(0.372)

0.587

(0.070)

Chromosomal virulence factors

YPTB1668

YPO3944

inv

putative invasin

0.501

(< 0.001)

0.993

(0.976)

YPTB1334

YPO1303

psaA

pH 6 antigen precursor

 

(< 0.001)

0.367

(0.154)

YPTB1335

YPO1304

psaB

chaperone protein PsaB precursor

0.216

(< 0.001)

0.700

(0.214)

YPTB1332

YPO1301

psaE

putative regulatory protein

1.987

(0.002)

2.619

(< 0.001)

pYV-encoded virulence factors – Type Three Secretion System

pYV0062

YPCD1.36c

yscX

YscX, putative type III secretion protein

1.629

(0.009)

0.873

(0.444)

pYV0014

YPCD1.89

 

possible transposase remnant (pseudogene)

1.789

(0.025)

0.786

(0.899)

pYV0076

YPCD1.49

lcrF

LcrF, VirF; putative thermoregulatory protein

1.441

(0.042)

1.311

(0.216)

pYV0058

YPCD1.32c

lcrG

LcrG, putative Yop regulator

1.713

(0.014)

0.941

(0.853)

pYV0056

YPCD1.30c

lcrH, sycD

LcrH, SycD; low calcium response protein H

3.522

(< 0.001)

0.898

(0.480)

pYV0059

YPCD1.33c

lcrR

LcrR, hypothetical protein

1.469

(0.001)

0.700

(0.129)

pYV0057

YPCD1.31c

lcrV

LcrV, putative V antigen, antihost protein/regulator

1.904

(< 0.001)

1.302

(0.051)

pYV0024

YPCD1.05c

sycE

SycE, yerA; putative yopE chaperone

5.781

(< 0.001)

1.344

(0.165)

pYV0020

YPCD1.95c

sycH

SycH, putative yopH targeting protein

5.088

(< 0.001)

2.029

(0.002)

pYV0017

YPCD1.91

 

putative resolvase

0.341

(< 0.001)

1.152

(0.705)

pYV0075

YPCD1.48

virG

VirG; putative Yop targeting lipoprotein

1.957

(0.015)

1.544

(0.023)

pYV0055

YPCD1.29c

yopB

YopB, putative Yop targeting protein

2.816

(< 0.001)

0.956

(0.758)

pYV0054

YPCD1.28c

yopD

YopD, putative Yop negative regulation/targeting component

2.933

(< 0.001)

0.950

(0.833)

pYV0047

YPCD1.26c

yopM

YopM, putative targeted effector protein

3.467

(< 0.001)

1.044

(0.845)

pYV0065

YPCD1.39c

yopN

YopN, LcrE; putative membrane-bound Yop targeting protein

2.612

(< 0.001)

0.878

(0.475)

pYV0078

YPCD1.51

 

hypothetical protein

3.037

(0.002)

1.056

(0.716)

pYV0079

YPCD1.52

yscC

YscC, putative type III secretion protein

2.383

(0.001)

0.715

(0.221)

pYV0080

YPCD1.53

yscD

YscD, putative type III secretion protein

2.541

(< 0.001)

0.715

(0.095)

pYV0081

YPCD1.54

yscE

YscE, putative type III secretion protein

2.710

(0.001)

0.543

(0.056)

pYV0082

YPCD1.55

yscF

YscF, putative type III secretion protein

2.116

(0.017)

0.616

(0.135)

pYV0083

YPCD1.56

yscG

YscG, putative type III secretion protein

2.462

(< 0.001)

0.905

(0.595)

pYV0085

YPCD1.58

yscI

YscI, LcrO; putative type III secretion protein

1.864

(0.003)

1.024

(0.906)

pYV0089

YPCD1.62

yscM, lcrQ

YscM, LcrQ, putative type III secretion regulatory

0.678

(0.036)

0.755

(0.052)

pYV0067

YPCD1.40

 

putative Yops secretion ATP synthase

2.855

(< 0.001)

0.971

(0.886)

pYV0068

YPCD1.41

yscO

YscO, putative type III secretion protein

3.087

(< 0.001)

0.974

(0.913)

pYV0070

YPCD1.43

yscQ

YscQ, putative type III secretion protein

1.635

(0.026)

1.214

(0.430)

pYV0071

YPCD1.44

yscR

YscR, putative Yop secretion membrane protein

1.948

(0.012)

1.296

(0.269)

pYV0072

YPCD1.45

yscS

YscS, putative type III secretion protein

2.331

(< 0.001)

1.218

(0.280)

pYV-encoded virulence factors – Others

pYV0013

YPCD1.88c

yadA

YadA, Yersinia adhesion

13.52

(< 0.001)

1.040

(0.861)

Table 2

Y. pseudotuberculosis IP32953 chromosomal genes (sorted by COG class [28]) that are transcriptionally regulated by growth medium and/or temperature.

COG class

Gene designation

Genoscript spot ID

Gene product/function

Fold ratio in gene transcription (p-value)

    

Human plasma/Luria Bertani Broth

37°C/28°C

C: energy production and conversion

 

YPTB0086 (glpK)

YPO0090

glycerol kinase

0.437

(0.002)

  
 

YPTB0108 (ppc)

YPO3929

phosphoenolpyruvate carboxylase

  

0.678

(0.045)

 

YPTB0118

YPO3917

putative pyridine nucleotide-disulphide oxidoreductase

  

1.559

(0.016)

 

YPTB0211 (glpC)

YPO3824

anaerobic glycerol-3-phosphate dehydrogenase subunit C

0.49

(0.003)

  
 

YPTB0374 (qor)

YPO0319

quinone oxidoreductase

1.393

(0.04)

  
 

YPTB0410 (frdD)

YPO0357

fumarate reductase hydrophobic protein

0.393

(0.001)

  
 

YPTB0411 (frdC)

YPO0358

fumarate reductase hydrophobic protein

0.248

(< 0.001)

  
 

YPTB0412 (frdB)

YPO0359

fumarate reductase iron-sulfur protein

0.128

(< 0.001)

  
 

YPTB0413 (frdA)

YPO0360

fumarate reductase flavoprotein subunit

0.157

(< 0.001)

  
 

YPTB0460 (mdh)

YPO3516

malate dehydrogenase

0.665

(0.01)

0.543

(< 0.001)

 

YPTB0714 (aceF)

YPO3418

pyruvate dehydrogenase. dihydrolipoyltransacetylase component

  

0.676

(0.03)

 

YPTB0715 (lpdA)

YPO3417

dihydrolipoamide dehydrogenase component of pyruvate dehydrogenase complex

  

0.657

(0.01)

 

YPTB0716 (acnB)

YPO3415

aconitate hydratase 2

0.51

(< 0.001)

0.492

(< 0.001)

 

YPTB0796 (fumA)

YPO3335

fumarate hydratase. class I

0.351

(< 0.001)

1.518

(0.049)

 

YPTB0887 (nqrA)

YPO3240

NADH-ubiquinone oxidoreductase subunit A

0.328

(< 0.001)

  
 

YPTB0888 (nqrB)

YPO3239

NADH-ubiquinone oxidoreductase subunit B

0.58

(0.002)

  
 

YPTB0889 (nqrC)

YPO3238

Na+-translocating NADH-quinone reductase subunit c

0.551

(0.021)

  
 

YPTB0892 (nqrF)

YPO3235

NADH-uniquinone oxidoreductase subunit F

0.661

(0.044)

  
 

YPTB0895

YPO3232

putative exported protein

  

0.6

(0.008)

 

YPTB0949 (cyoD)

YPO3167

cytochrome O ubiquinol oxidase subunit CyoD

  

0.534

(0.001)

 

YPTB0952 (cyoA)

YPO3164

cytochrome O ubiquinol oxidase subunit II

0.537

(< 0.001)

0.516

(< 0.001)

 

YPTB1125 (fldA)

YPO2635

flavodoxin 1

  

0.722

(0.033)

 

YPTB1143 (sdhC)

YPO1109

succinate dehydrogenase cytochrome b-556 subunit

0.552

(0.015)

0.622

(0.045)

 

YPTB1144 (sdhD)

YPO1110

succinate dehydrogenase hydrophobic membrane anchor protein

0.5

(< 0.001)

0.654

(0.014)

 

YPTB1145 (sdhA)

YPO1111

succinate dehydrogenase flavoprotein subunit

0.497

(< 0.001)

  
 

YPTB1146 (sdhB)

YPO1112

succinate dehydrogenase iron-sulfur protein

0.592

(0.003)

  
 

YPTB1147 (sucA)

YPO1113

2-oxoglutarate dehydrogenase E1 component

0.515

(0.006)

  
 

YPTB1148 (sucB)

YPO1114

dihydrolipoamide succinyltransferase component of 2-oxoglutarate dehydro

0.61

(0.013)

0.671

(0.04)

 

YPTB1149 (sucC)

YPO1115

succinyl-CoA synthetase beta chain

0.419

(< 0.001)

  
 

YPTB1150 (sucD)

YPO1116

succinyl-CoA synthetase alpha chain

0.524

(< 0.001)

  
 

YPTB1151 (cydA)

YPO1117

cytochrome D ubiquinol oxidase subunit I

0.442

(< 0.001)

  
 

YPTB1152 (cydB)

YPO1118

cytochrome D ubiquinol oxidase subunit II

0.565

(0.004)

  
 

YPTB1408 (pflB)

YPO1383

formate acetyltransferase 1

0.462

(< 0.001)

1.911

(< 0.001)

 

YPTB1723 (putA)

YPO1851

bifunctional PutA protein [includes: proline dehydrogenase and delta-1-p

0.643

(< 0.001)

0.642

(< 0.001)

 

YPTB1945

YPO1947

putative thioredoxin

1.646

(0.002)

  
 

YPTB2012

YPO2028

putative exported protein

  

0.6

(0.008)

 

YPTB2017

YPO2035

hypothetical protein

1.694

(0.045)

  
 

YPTB2089

YPO2163

putative nitroreductase

2.095

(< 0.001)

  
 

YPTB2103 (adhE)

YPO2180

aldehyde-alcohol dehydrogenase

2.115

(< 0.001)

  
 

YPTB2165

YPO2244

Fe-S binding NADH dehydrog. (pseudogene. F/S)

  

2.157

(< 0.001)

 

YPTB2224 (pntB)

YPO2302

NAD(P) transhydrogenase subunit beta

  

1.502

(0.037)

 

YPTB2248 (ldhA)

YPO2329

D-lactate dehydrogenase

0.615

(0.006)

  
 

YPTB2253 (nifJ)

YPO2334

putative pyruvate-flavodoxin oxidoreductase

  

1.697

(0.014)

 

YPTB2427 (icdA)

YPO1641

isocitrate dehydrogenase [NADP]

  

0.632

(0.013)

 

YPTB2529

YPO2492

putative dioxygenase beta subunit

0.535

(0.02)

  
 

YPTB2578 (nuoK)

or3622

NADH dehydrogenase i chain k

0.642

(0.001)

  
 

YPTB2581 (nuoH)

YPO2549

NADH dehydrogenase I chain H

0.745

(0.023)

  
 

YPTB2585 (nuoD)

YPO2553

NADH dehydrogenase I chain C/D

0.573

(0.003)

  
 

YPTB2587 (nuoA)

YPO2555

NADH dehydrogenase I chain A

0.62

(< 0.001)

  
 

YPTB2597 (ackA)

YPO2566

acetate kinase

0.652

(0.001)

  
 

YPTB2598 (pta)

YPO2567

phosphate acetyltransferase

0.667

(0.017)

  
 

YPTB2689 (dmsB)

YPO2966

putative dimethyl sulfoxide reductase chain B protein

0.598

(0.031)

  
 

YPTB2703

YPO2980

putative ion channel protein

0.565

(0.01)

  
 

YPTB2758 (napC)

YPO3036

cytochrome C-type protein NapC

  

0.636

(0.015)

 

YPTB3469 (fadH)

YPO0589

2.4-dienoyl-CoA reductase

0.465

(0.002)

1.713

(0.024)

 

YPTB3539

YPO3694

putative cytochrome

  

0.544

(< 0.001)

 

YPTB3592

YPO3637

putative carbohydrate kinase

  

1.585

(0.031)

 

YPTB3656 (aceA)

YPO3725

isocitrate lyase

2.069

(0.002)

1.963

(0.004)

 

YPTB3762 (pckA)

YPO0138

phosphoenolpyruvate carboxykinase [ATP]

0.395

(0.001)

  
 

YPTB3782 (glpD)

YPO3937

aerobic glycerol-3-phosphate dehydrogenase

0.409

(0.02)

  
 

YPTB3927 (fdoG)

or2536

formate dehydrogenase-O. major subunit

0.208

(< 0.001)

0.712

(0.029)

 

YPTB3928 (fdoH)

YPO4057

formate dehydrogenase-O. iron-sulfur subunit

0.187

(< 0.001)

0.698

(0.03)

 

YPTB3929 (fdoI)

YPO4056

formate dehydrogenase. cytochrome b556 protein

0.372

(< 0.001)

0.551

(< 0.001)

 

YPTB3967 (atpD)

YPO4121

ATP synthase beta subunit protein

  

0.679

(0.025)

 

YPTB3968 (atpG)

YPO4122

ATP synthase gamma subunit protein

  

0.658

(0.011)

 

YPTB3970 (atpH)

or2565

ATP synthase delta subunit protein

  

0.7

(0.005)

 

YPTB3971 (atpF)

YPO4125

ATP synthase subunit B protein

  

0.616

(0.002)

 

YPTB3972 (atpE)

or2563

ATP synthase subunit C protein

  

0.656

(0.037)

 

YPTB3973 (atpB)

YPO4127

ATP synthase subunit B protein

0.667

(0.004)

0.732

(0.021)

D: cell division and chromosome partitioning

 

YPTB0222 (ftsE)

YPO3813

cell division ATP-binding protein

  

0.595

(0.019)

 

YPTB1430 (mukB)

YPO1405

cell division protein

  

0.62

(0.006)

 

YPTB2923

YPO2686

putative membrane protein

0.358

(< 0.001)

  
 

YPTB3126

or3195

possible bacteriophage protein

1.616

(0.029)

  
 

YPTB3976 (gidA)

YPO4130

glucose inhibited division protein A

0.607

(0.007)

 

(0.007)

E: amino acid transport and metabolism

 

YPTB0003 (asnA)

YPO0003

aspartate-ammonia ligase

  

1.531

(0.042)

 

YPTB0024 (glnA)

YPO0024

glutamine synthetase

0.49

(< 0.001)

0.448

(< 0.001)

 

YPTB0057 (tdh)

YPO0060

threonine 3-dehydrogenase

0.663

(0.041)

  
 

YPTB0066 (cysE)

YPO0070

serine acetyltransferase

1.669

(0.016)

  
 

YPTB0106 (metL)

YPO0116

bifunctional aspartokinase/homoserine dehydrogenase II

1.565

(0.045)

  
 

YPTB0111 (argB)

YPO3925

acetylglutamate kinase

1.495

(0.016)

  
 

YPTB0112 (argH)

YPO3924

putative argininosuccinate lyase

1.779

(0.007)

  
 

YPTB0134 (ilvG)

YPO3901

acetolactate synthase isozyme II large subunit

  

0.627

(0.039)

 

YPTB0203 (rhtC)

YPO3832

threonine efflux protein

  

0.597

(0.024)

 

YPTB0210 (glpB)

YPO3825

putative anaerobic glycerol-3-phosphate dehydrogenase subunit B

0.554

(0.01)

  
 

YPTB0226 (livK)

YPO3808

branched-chain amino acid-binding protein

1.49

(0.032)

  
 

YPTB0245

or0170

conserved hypothetical protein

0.662

(0.031)

  
 

YPTB0248 (metE)

YPO3788

5-methyltetrahydropteroyltriglutamate – homocystei ne methyltransferase

  

2.813

(0.001)

 

YPTB0345

YPO0287

putative methylenetetrahydrofolate reductase

2.947

(< 0.001)

  
 

YPTB0402 (aspA)

YPO0348

aspartate ammonia-lyase

0.224

(< 0.001)

  
 

YPTB0407

YPO0353

conserved hypothetical protein

  

0.687

(0.03)

 

YPTB0521

YPO3452

putative ABC transporter transporter. ATP-binding protein

1.679

(0.029)

  
 

YPTB0524

YPO3448

(7G) putative extracellular solute-binding protein (pseudogene. F/S)

  

1.553

(0.046)

 

YPTB0557

or0391

possible conserved cysteine desulfurase

   

(< 0.001)

 

PTB0602 (arcA)

YPO0459

aerobic respiration control protein

0.465

(0.001)

  
 

YPTB0604 (thrB)

YPO0461

homoserine kinase

1.411

(0.03)

  
 

YPTB0623 (carA)

YPO0481

carbamoyl-phosphate synthase small chain

0.609

(< 0.001)

0.747

(0.028)

 

YPTB0624 (carB)

YPO0482

carbamoyl-phosphate synthase large chain

0.621

(0.022)

0.546

(0.005)

 

YPTB0676 (ilvH)

YPO0540

acetolactate synthase isozyme III small subunit

1.68

(0.006)

  
 

YPTB0711 (aroP)

YPO3421

aromatic amino acid transport protein

1.68

(0.006)

  
 

YPTB0761 (cysH)

YPO3370

phosphoadenosine phosphosulfate reductase (pseudogene. F/S)

  

1.593

(0.002)

 

YPTB0789

YPO3343

probable extracellular solute-binding protein

0.462

(0.001)

  
 

YPTB0911 (aroL)

YPO3215

shikimate kinase II

0.601

(0.03)

  
 

YPTB0920 (brnQ)

YPO3202

branched-chain amino acid transport system II carrier protein

1.481

(0.033)

  
 

YPTB1108 (glnH)

YPO2615

putative amino acid-binding protein precursoR

0.564

(0.005)

  
 

YPTB1186

YPO1155

putative amino acid transporteR

  

1.736

(0.017)

 

YPTB1240

YPO1200

putative amino acid permease

  

0.637

(0.025)

 

YPTB1241

YPO1201

putative amino acid decarboxylase

  

0.557

(0.024)

 

YPTB1346

YPO1315

putative hydrolase (pseudogene. stop)

1.578

(< 0.001)

0.669

(0.001)

 

YPTB1352 (sdaC)

YPO1321

serine transporteR

0.526

(0.028)

  
 

YPTB1362 (potG)

YPO1332

putrescine transport ATP-binding protein

0.728

(0.035)

  
 

YPTB1375 (artM)

YPO1349

arginine transport system permease protein

1.648

(0.014)

0.572

(0.007)

 

YPTB1384 (poxB)

YPO1358

pyruvate dehydrogenase [cytochrome]

  

1.521

(0.009)

 

YPTB1411 (ansB)

YPO1386

putative L-asparaginase II precursoR

  

1.869

(0.013)

 

YPTB1434 (aspC)

YPO1410

aspartate aminotransferase

1.447

(0.004)

  
 

YPTB1438 (pepN)

YPO1414

putative aminopeptidase N

1.432

(0.041)

  
 

YPTB1541 (ysuJ)

YPO1529

putative decarboxylase

2.092

(< 0.001)

  
 

YPTB1621 (aroP)

YPO1743

aromatic amino acid transport protein

1.68

(0.006)

  
 

YPTB1641 (hpaF)

YPO1765

5-carboxymethyl-2-hydroxymuconate delta-isomerase

1.812

(0.015)

  
 

YPTB1656 (ptrB)

YPO1780

oligopeptidase B

1.695

(0.006)

  
 

YPTB1889 (lysA)

or1363

possible diaminopimelate decarboxylase

1.621

(0.01)

0.45

(< 0.001)

 

YPTB2001 (prsA)

YPO2013

ribose-phosphate pyrophosphokinase

0.55

(< 0.001)

  
 

YPTB2019

YPO2037

conserved hypothetical protein

1.56

(0.021)

  
 

YPTB2067

YPO2138

putative aminotransferase

  

1.978

(< 0.001)

 

YPTB2105 (oppA)

YPO2182

periplasmic oligopeptide-binding protein precursoR

  

0.466

(< 0.001)

 

YPTB2108 (oppD)

YPO2185

oligopeptide transport ATP-binding protein

 

(< 0.001)

  
 

YPTB2126 (trpB)

YPO2204

tryptophan synthase beta chain

2.22

(< 0.001)

  
 

YPTB2258 (mppA)

YPO2339

putative periplasmic murein peptide-binding protein

1.376

(0.039)

  
 

YPTB2262 (tyrR)

YPO2344

transcriptional regulatory protein

0.486

(< 0.001)

  
 

YPTB2295 (gloA)

YPO2381

lactoylglutathione lyase

1.666

(< 0.001)

1.229

(0.042)

 

YPTB2437 (pepT)

YPO1631

peptidase T

0.488

(0.007)

  
 

YPTB2548 (glnH)

YPO2511

putative glutamine-binding periplasmic protein

  

1.797

(0.014)

 

YPTB2549 (glnP)

YPO2512

putative glutamine transport system permease

  

1.704

(0.024)

 

YPTB2550 (glnQ)

YPO2513

putative glutamine transport ATP-binding protein

  

1.56

(0.027)

 

YPTB2632 (aroC)

YPO2751

chorismate synthase

0.675

(0.031)

  
 

YPTB2698

YPO2975

putative aminotransferase

2.151

(< 0.001)

  
 

YPTB2714 (cysK)

YPO2992

cysteine synthase A

2.108

(0.005)

  
 

YPTB2723

YPO3002

putative permease

1.328

(0.036)

  
 

YPTB2725

YPO3004

putative aminopeptidase (pseudogene. F/S)

1.526

(0.022)

1.685

(0.006)

 

YPTB2784 (gcvR)

YPO3063

glycine cleavage system transcriptional repressoR

2.302

(<0.001)

  
 

YPTB2869 (glyA)

YPO2907

serine hydroxymethyltransferase

  

1.783

(0.001)

 

YPTB2882 (yfhB)

YPO2924

putative membrane protein

  

1.737

(0.006)

 

YPTB2909

YPO2699

conserved hypothetical protein

1.513

(0.017)

  
 

YPTB2942 (ureC)

YPO2667

urease alpha subunit

0.333

(<0.001)

  
 

YPTB2943 (ureB)

YPO2666

urease beta subunit

0.2

(<0.001)

  
 

YPTB2944 (ureA)

YPO2665

urease gamma subunit

0.324

(<0.001)

  
 

YPTB2961 (proX)

YPO2645

glycine betaine-binding periplasmic protein

  

0.637

(0.009)

 

YPTB2986

YPO1061

conserved hypothetical protein

  

0.551

(0.031)

 

YPTB3006 (dapD)

YPO1041

2.3.4.5-tetrahydropyridine-2-carboxylate N-succinyltransferase

0.398

(< 0.001)

1.445

(0.005)

 

YPTB3181 (gcsH)

YPO0906

glycine cleavage system H protein

0.377

(< 0.001)

  
 

YPTB3182 (gcvT)

YPO0907

aminomethyltransferase

0.526

(0.022)

  
 

YPTB3189 (serA)

YPO0914

D-3-phosphoglycerate dehydrogenase

1.582

(0.04)

0.517

(0.005)

 

YPTB3214 (proC)

YPO0942

putative pyrroline-5-carboxylate reductase

  

0.647

(0.038)

 

YPTB3474

YPO0584

putative symporter protein

0.61

(0.007)

  
 

YPTB3570 (aroQ)

YPO3660

putative class II dehydroquinase

  

0.721

(0.036)

 

YPTB3658 (metA)

YPO3727

homoserine O-succinyltransferase

1.776

(0.018)

  
 

YPTB3749 (aroB)

YPO0152

3-dehydroquinate synthase

0.612

(0.039)

  
 

YPTB3813 (gdhA)

YPO3971

NADP-specific glutamate dehydrogenase

1.671

(0.005)

  
 

YPTB3853 (cysM)

or2495

pyridoxal-phosphate dependent protein (pseudogene. partial)

  

0.415

(< 0.001)

 

YPTB3957

YPO4111

putative periplasmic solute-binding protein

1.59

(0.006)

  

F: nucleotide transport and metabolism

 

YPTB0250 (udp)

YPO3786

uridine phosphorylase

0.486

(0.005)

  
 

YPTB0519 (nrdD)

YPO3454

anaerobic ribonucleoside-triphosphate reductase

0.614

(0.024)

  
 

YPTB0584 (deoD)

YPO0440

purine nucleoside phosphorylase

  

0.607

(0.025)

 

YPTB0623 (carA)

YPO0481

carbamoyl-phosphate synthase small chain

0.609

(< 0.001)

0.747

(0.028)

 

YPTB0624 (carB)

YPO0482

carbamoyl-phosphate synthase large chain

0.621

(0.022)

0.546

(0.005)

 

YPTB0754 (pyrG)

YPO3377

CTP synthase

0.469

(< 0.001)

  
 

YPTB0901 (gpt)

YPO3225

xanthine-guanine phosphoribosyltransferase

0.68

(0.035)

  
 

YPTB0991 (apt)

YPO3123

adenine phosphoribosyltransferase

1.447

(0.042)

  
 

YPTB1253 (nrdB)

YPO1213

ribonucleoside-diphosphate reductase 1 beta chain

  

0.489

(0.003)

 

YPTB1254 (nrdA)

YPO1214

ribonucleoside-diphosphate reductase 1 alpha chain

0.328

(< 0.001)

0.707

(0.014)

 

YPTB1439 (pyrD)

YPO1415

dihydroorotate dehydrogenase

  

1.331

(0.037)

 

YPTB2001 (prsA)

YPO2013

ribose-phosphate pyrophosphokinase

0.55

(< 0.001)

  
 

YPTB2102 (tdk)

YPO2176

thymidine kinase

0.75

(0.034)

  
 

YPTB2706 (nupC)

YPO2983

nucleoside permease

1.674

(0.018)

  
 

YPTB2781 (purC)

YPO3059

phosphoribosylaminoimidazole-succinocarboxamide synthase (pseudogene. IS

0.598

(0.009)

  
 

YPTB2794 (upp)

YPO2827

uracil phosphoribosyltransferase

0.515

(0.002)

  
 

YPTB2796 (purN)

YPO2829

putative phosphoribosylglycinamide formyltransferase

  

1.842

(0.038)

 

YPTB2803 (ppx)

YPO2837

putative exopolyphosphatase

  

0.564

(< 0.001)

 

YPTB2956 (nrdI)

YPO2650

NrdI protein homologue

2.842

(< 0.001)

  
 

YPTB2957 (nrdE)

YPO2649

ribonucleoside-diphosphate reductase 2 alpha chain

4.745

(< 0.001)

  
 

YPTB2958 (nrdF)

YPO2648

ribonucleoside-diphosphate reductase 2 beta chain

2.671

(0.002)

  
 

YPTB3544

YPO3689

putative ribonuclease

  

1.543

(0.022)

 

YPTB3854

YPO4019

putative phosphoribosyl transferase protein

  

0.487

(0.001)

G: carbohydrate transport and metabolism

 

YPTB0074 (pfkA)

YPO0078

6-phosphofructokinase

1.593

(0.017)

  
 

YPTB0087 (glpF)

YPO0091

glycerol uptake facilitator protein

0.488

(0.041)

  
 

YPTB0241 (ugpC)

YPO3793

sn-glycerol-3-phosphate transport. ATP-binding protein

1.725

(0.001)

  
 

YPTB0542

YPO0402

PTS system. IIB component

  

0.565

(0.023)

 

YPTB0548

YPO0408

putative aldolase

  

1.968

(0.021)

 

YPTB0550

YPO0410

putative ABC transporter permease protein

0.573

(0.033)

  
 

YPTB0569

YPO0424

putative pectinesterase

0.268

(< 0.001)

  
 

YPTB0583 (deoB)

YPO0439

phosphopentomutase

1.651

(0.03)

  
 

YPTB0782 (dhaK)

YPO3350

putative dihydroxyacetone kinase

  

0.683

(0.028)

 

YPTB0799

YPO3332

putative sugar ABC transporter. permease protein

1.787

(0.018)

1.912

(0.01)

 

YPTB0803 (fucR)

YPO3327

putative deoR-family regulatory protein

0.435

(< 0.001)

1.521

(0.007)

 

YPTB0804 (araD)

YPO3326

L-ribulose-5-phosphate 4-epimerase

0.537

(< 0.001)

  
 

YPTB0874

or0625

probable sugar aldolase

1.455

(0.042)

1.627

(0.011)

 

YPTB1079

YPO2586

conserved hypothetical protein

0.559

(0.025)

  
 

YPTB1080

YPO2587

conserved hypothetical protein

0.644

(0.026)

  
 

YPTB1119 (nagB)

YPO2627

putative glucosamine-6-phosphate isomerase

0.654

(0.027)

  
 

YPTB1140

YPO1106

conserved hypothetical protein

0.705

(0.034)

  
 

YPTB1166 (gpmA)

YPO1133

phosphoglycerate mutase 1

3.178

(< 0.001)

  
 

YPTB1290 (bglA)

YPO1254

6-phospho-beta-glucosidase

1.802

(0.008)

  
 

YPTB1327

YPO1295

putative ABC transport integral membrane subunit

1.976

(0.009)

  
 

YPTB1381

YPO1355

conserved hypothetical protein

0.683

(0.031)

  
 

YPTB1522 (mglB)

YPO1507

galactose-binding protein

0.56

(0.002)

1.47

(0.029)

 

YPTB1581

YPO1572

putative sugar transporteR

0.587

(0.023)

  
 

YPTB1600 (ybtX)

YPO1915

putative signal transduceR

1.766

(0.003)

  
 

YPTB1632 (manZ)

YPO1756

PTS system. mannose-specific IID component

3.084

(< 0.001)

  
 

YPTB1633 (manY)

YPO1757

PTS system. mannose-specific IIC component

1.991

(0.005)

  
 

YPTB1634 (manX)

YPO1758

PTS system. mannose-specific IIAB component

2.674

(< 0.001)

  
 

YPTB1687

YPO1814

putative sugar ABC transporter. ATP-binding protein

1.865

(0.016)

  
 

YPTB1930

YPO1932

putative sugar transporteR

1.963

(0.002)

  
 

YPTB1975

YPO1982

putative dehydrogenase

  

0.63

(0.012)

 

YPTB2047 (pykA)

YPO2064

pyruvate kinase II

0.486

(< 0.001)

  
 

YPTB2082

YPO2156

conserved hypothetical protein

0.538

(0.002)

1.487

(0.03)

 

YPTB2083 (gapA)

YPO2157

glyceraldehyde 3-phosphate dehydrogenase A

  

0.712

(0.027)

 

YPTB2147

YPO2225

conserved hypothetical protein

  

1.297

(0.041)

 

YPTB2190 (mlc)

YPO2268

putative ROK family transcriptional regulatory protein

1.417

(0.037)

  
 

YPTB2205

or3894

ABC sugar/ribose transporter. permease subunit

  

1.61

(0.036)

 

YPTB2306 (pykF)

YPO2393

pyruvate kinase I

2.282

(< 0.001)

  
 

YPTB2318 (ppsA)

YPO2409

phosphoenolpyruvate synthase

0.463

(0.008)

  
 

YPTB2356 (kduI)

YPO1725

4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase

  

1.444

(0.047)

 

YPTB2360

YPO1721

putative sugar ABC transporter (permease)

1.901

(0.032)

  
 

YPTB2463 (ptsG)

YPO1608

PTS system. glucose-specific IIBC component

4.033

(< 0.001)

1.607

(0.002)

 

YPTB2515

YPO2474

conserved hypothetical protein

0.593

(0.036)

  
 

YPTB2518

YPO2477

putative solute-binding protein

0.62

(0.029)

  
 

YPTB2535 (rbsC)

YPO2499

putative sugar transport system. permease protein

1.7

(0.013)

  
 

YPTB2715 (ptsH)

YPO2993

PTS system. phosphocarrier protein

1.697

(0.001)

  
 

YPTB2716 (ptsI)

YPO2994

PTS sytem. enzyme I component

1.945

(< 0.001)

  
 

YPTB2717 (crr)

YPO2995

PTS system. glucose-specific IIA component

1.611

(0.002)

0.731

(0.028)

 

YPTB2962

YPO2644

conserved hypothetical protein (pseudogene. IS100)

2.68

(< 0.001)

  
 

YPTB3078

YPO0834

putative PTS transport protein

  

1.742

(0.025)

 

YPTB3190 (rpiA)

YPO0915

ribose 5-phosphate isomerase A

0.601

(0.021)

0.641

(0.039)

 

YPTB3195 (fbaA)

YPO0920

fructose-bisphosphate aldolase class II

1.325

(0.048)

0.699

(0.015)

 

YPTB3196 (pgk)

YPO0921

phosphoglycerate kinase

1.366

(0.024)

  
 

YPTB3229

YPO0957

putative sugar transport system permease protein

0.626

(0.018)

  
 

YPTB3230 (mglA)

YPO0958

putative sugar transport ATP-binding protein

0.624

(0.005)

  
 

YPTB3262

YPO0988

putative membrane protein

2.167

(< 0.001)

  
 

YPTB3268

YPO0995

Sodium:galactoside symporter family protein

  

1.764

(0.014)

 

YPTB3479 (exuT)

YPO0577

ExuT transport protein

1.866

(0.001)

  
 

YPTB3495

YPO3550

probable phosphosugar isomerase

  

0.736

(0.042)

 

YPTB3536 (treB)

YPO3697

PTS system. trehalose-specific IIBC component

0.34

(< 0.001)

1.832

(0.015)

 

YPTB3537 (treC)

YPO3696

putative trehalose-6-phosphate hydrolase

0.279

(< 0.001)

  
 

YPTB3609

YPO3620

putative carbohydrate transport protein

  

1.459

(0.02)

 

YPTB3642 (lamB)

YPO3711

maltoporin

0.419

(< 0.001)

  
 

YPTB3779 (glpR)

YPO0120

glycerol-3-phosphate repressor protein

  

1.398

(0.043)

 

YPTB3783 (glgP)

YPO3938

glycogen phosphorylase

1.516

(0.021)

1.484

(0.028)

 

YPTB3787 (glgB)

YPO3942

1.4-alpha-glucan branching enzyme

0.603

(0.001)

  

H: coenzyme metabolism

 

YPTB0014 (mobA)

or5120

molybdopterin-guanine dinucleotide biosynthesis protein A

  

0.703

(0.032)

 

YPTB0056 (kbl)

YPO0059

2-amino-3-ketobutyrate coenzyme A ligase

0.639

(0.02)

  
 

YPTB0134 (ilvG)

YPO3901

acetolactate synthase isozyme II large subunit

  

0.627

(0.039)

 

YPTB0182 (hemX)

YPO3851

putative uroporphyrin-III C-methyltransferase

  

0.695

(0.033)

 

YPTB0264

YPO3769

conserved hypothetical protein

  

0.695

(0.01)

 

YPTB0290 (thiC)

YPO3739

thiamine biosynthesis protein ThiC

2.329

(0.012)

  
 

YPTB0344

YPO0286

putative coproporphyrinogen III oxidase

1.636

(0.015)

  
 

YPTB0463 (ispB)

YPO3513

octaprenyl-diphosphate synthase

0.731

(0.03)

0.614

(0.002)

 

YPTB0559

or0393

hypothetical protein

1.723

(0.007)

 

(< 0.001)

 

YPTB0561

or0395

putative protein involved in molybdopterin biosynthesis

1.802

(0.004)

 

(< 0.001)

 

YPTB0616 (rpsT)

YPO0474

30S ribosomal protein S20

  

0.59

(0.002)

 

YPTB0664

or0477

hypothetical protein

0.754

(0.035)

1.423

(0.01)

 

YPTB0731 (folK)

YPO3400

2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase

0.572

(0.009)

  
 

YPTB0739 (fhuC)

YPO3392

ferrichrome transport ATP-binding protein FhuC

1.932

(0.046)

  
 

YPTB0758 (ygcM)

YPO3373

putative 6-pyruvoyl tetrahydrobiopterin synthase family protein

0.556

(0.002)

0.629

(0.011)

 

YPTB0761 (cysH)

YPO3370

phosphoadenosine phosphosulfate reductase (pseudogene. F/S)

  

1.593

(0.002)

 

YPTB0935 (ribH)

YPO3182

6.7-dimethyl-8-ribityllumazine synthase

  

0.695

(0.01)

 

YPTB0940 (ispA)

YPO3176

geranyltranstransferase

0.635

(0.026)

  
 

YPTB1003 (wbyH)

YPO3111

putative exported protein

  

0.727

(0.039)

 

YPTB1091 (lipA)

YPO2598

lipoic acid synthetase

0.558

(0.002)

  
 

YPTB1163 (pnuC)

YPO1128

intergral membrane NMN transport protein PnuC

  

1.675

(0.004)

 

YPTB1181 (bioA)

YPO1150

adenosylmethionine-8-amino-7-oxononanoate aminotransferase

3.377

(< 0.001)

1.592

(0.038)

 

YPTB1183 (bioF)

YPO1152

8-amino-7-oxononanoate synthase

3.799

(< 0.001)

  
 

YPTB1184 (bioC)

YPO1153

biotin synthesis protein BioC

1.784

(0.004)

1.636

(0.011)

 

YPTB1185 (bioD)

YPO1154

dethiobiotin synthetase

2.499

(0.002)

  
 

YPTB1343

YPO1312

putative siderophore ABC transporter. ATP-binding subunit

2.467

(< 0.001)

  
 

YPTB1384 (poxB)

YPO1358

pyruvate dehydrogenase [cytochrome]

  

1.521

(0.009)

 

YPTB1885

or1359

possible ThiF family

   

(< 0.001)

 

YPTB1886

or1360

conserved hypothetical protein

   

(< 0.001)

 

YPTB1888

or1362

conserved hypothetical protein

1.886

(0.001)

0.314

(< 0.001)

 

YPTB2033

YPO2050

conserved hypothetical protein

0.542

(0.002)

  
 

YPTB2136 (btuR)

YPO2214

cob(I)alamin adenosyltransferase

1.975

(0.002)

  
 

YPTB2191

YPO2269

putative dethiobiotin synthetase

0.3

(< 0.001)

  
 

YPTB2304 (ribE)

YPO2391

riboflavin synthase alpha chain

1.44

(0.012)

  
 

YPTB2459

or3719

hypothetical

0.379

(< 0.001)

  
 

YPTB2561 (menF)

YPO2528

menaquinone-specific isochorismate synthase

  

0.522

(0.011)

 

YPTB3574

YPO3657

putative sodium/panthothenate symporter

  

0.634

(0.01)

I: lipid metabolism

 

YPTB0416 (psd)

YPO0364

phosphatidylserine decarboxylase proenzyme

  

1.846

(0.024)

 

YPTB0434 (aidB)

YPO0383

putative acyl-CoA dehydrogenase

1.613

(0.049)

  
 

YPTB0558

or0392

possible acyl-CoA dehydrogenase

1.628

(0.042)

 

(< 0.001)

 

YPTB0674

YPO0537

putative AMP-binding enzyme-family protein

0.616

(0.047)

  
 

YPTB0883 (yafH)

YPO3244

probable acyl-CoA dehydrogenase

2.292

(< 0.001)

  
 

YPTB1355

YPO1324

putative permease

  

0.499

(< 0.001)

 

YPTB1450 (fabA)

YPO1430

3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase

  

0.685

(0.033)

 

YPTB1480

YPO1462

putative acyl carrier protein

  

1.669

(0.048)

 

YPTB2242 (acpD)

YPO2323

acyl carrier protein phosphodiesterase

  

0.703

(0.013)

 

YPTB2470 (acpP)

YPO1600

acyl carrier protein

  

0.661

(0.002)

 

YPTB2473 (fabH)

YPO1597

3-oxoacyl-[acyl-carrier-protein] synthase III

0.757

(0.047)

0.708

(0.017)

 

YPTB2626 (fabB)

YPO2757

3-oxoacyl-[acyl-carrier-protein] synthase I

  

0.605

(0.009)

 

YPTB2993 (lpxD)

YPO1054

UDP-3-o-[3-hydroxymyristoyl] glucosamine N-acyltransferase

1.258

(0.018)

0.761

(0.007)

 

YPTB3849

YPO4014

putative membrane protein

  

1.549

(0.012)

 

YPTB3856

YPO4021

hypothetical protein

  

0.58

(0.012)

J: translation, ribosomal structure and biogenesis

 

YPTB0034 (trmH)

YPO0037

tRNA (guanosine-2'-O-)-methyltransferase

  

1.673

(0.023)

 

YPTB0041 (rph)

YPO0044

ribonuclease PH

  

0.667

(0.005)

 

YPTB0276 (tufA)

or0197

elongation factor Tu

  

0.624

(0.001)

 

YPTB0279 (rplK)

YPO3751

50S ribosomal protein L11

0.703

(0.027)

0.682

(0.018)

 

YPTB0280 (rplA)

YPO3750

50S ribosomal protein L1

0.681

(0.027)

0.689

(0.031)

 

YPTB0281 (rplJ)

YPO3749

50S ribosomal protein L10

  

0.612

(0.017)

 

YPTB0282 (rplL)

YPO3748

50S ribosomal protein L7/L12

  

0.58

(0.014)

 

YPTB0408 (efp)

YPO0354

elongation factor P

1.7

(0.018)

  
 

YPTB0438 (rpsF)

YPO3539

30S ribosomal protein S6

0.597

(0.018)

0.501

(0.003)

 

YPTB0441 (rplI)

YPO3536

50S ribosomal protein L9

  

0.476

(< 0.001)

 

YPTB0464 (rplU)

YPO3512

50S ribosomal protein L21

  

0.539

(0.006)

 

YPTB0465 (rpmA)

YPO3511

50S ribosomal protein L27

0.538

(0.002)

0.66

(0.026)

 

YPTB0480 (infB)

YPO3496

translation initiation factor IF2-2 (pseudogene. inframe deletion)

0.598

(< 0.001)

0.661

(< 0.001)

 

YPTB0483 (rpsO)

YPO3493

30S ribosomal protein S15

  

0.647

(0.004)

 

YPTB0484 (pnp)

YPO3490

polyribonucleotide nucleotidyltransferase

0.642

(0.006)

  
 

YPTB0529 (valS)

YPO3443

valyl-tRNA synthetase

  

0.648

(0.004)

 

YPTB0575 (prfC)

YPO0430

peptide chain release factor 3

0.536

(0.014)

0.611

(0.046)

 

YPTB0732 (pcnB)

YPO3399

poly(A) polymerase

0.74

(0.025)

  
 

YPTB0794 (map)

YPO3337

methionine aminopeptidase

3.582

(< 0.001)

  
 

YPTB0834 (rpsP)

YPO3295

30S ribosomal protein S16

  

0.682

(0.044)

 

YPTB0835 (rimM)

YPO3294

16S rRNA processing protein

0.628

(0.003)

0.68

(0.011)

 

YPTB0836 (trmD)

YPO3293

tRNA (guanine-N1)-methyltransferase

  

0.596

(0.004)

 

YPTB0844 (yfiA)

YPO3279

putative sigma 54 modulation protein

0.141

(< 0.001)

2.388

(0.03)

 

YPTB0846 (rluD)

YPO3277

ribosomal large subunit pseudouridine synthase d

  

0.718

(0.04)

 

YPTB1058

or0769

conserved hypothetical protein

  

1.626

(0.021)

 

YPTB1138

YPO1104

conserved hypothetical protein

1.634

(0.005)

  
 

YPTB1366

YPO1336

putative RNA methyltransferase

  

0.588

(0.018)

 

YPTB1411 (ansB)

YPO1386

putative L-asparaginase II precursoR

  

1.869

(0.013)

 

YPTB1417 (rpsA)

YPO1392

30S ribosomal protein S1

  

0.427

(< 0.001)

 

YPTB1436 (asnS)

YPO1412

asparaginyl-tRNA synthetase

1.628

(0.022)

  
 

YPTB1953

YPO1955

putative acetyltransferase

  

0.594

(0.017)

 

YPTB2005 (prfA)

YPO2017

peptide chain release factor 1

0.665

(0.008)

0.733

(0.035)

 

YPTB2135

YPO2213

putative RNA pseudouridylate synthase-family protein

0.691

(0.032)

  
 

YPTB2150

YPO2228

translation initiation factor SUI1 family protein

1.574

(0.008)

  
 

YPTB2328

YPO2420

probable formyl transferase

  

0.578

(0.015)

 

YPTB2336 (pheT)

YPO2428

phenylalanyl-tRNA synthetase beta chain

1.646

(0.003)

  
 

YPTB2337 (pheS)

YPO2429

phenylalanyl-tRNA synthetase alpha chain

  

0.615

(0.016)

 

YPTB2339 (rplT)

or3807

50S ribosomal protein L20

  

0.719

(0.017)

 

YPTB2618 (truA)

YPO2766

tRNA pseudouridine synthase A

  

0.52

(0.01)

 

YPTB2861

YPO2898

putative SpoU-family rRNA methylase

0.586

(< 0.001)

  
 

YPTB3000 (frr)

YPO1047

ribosome recycling factoR

  

0.609

(0.026)

 

YPTB3002 (tsf)

YPO1045

elongation factor Ts

  

0.611

(0.047)

 

YPTB3003 (rpsB)

YPO1044

30S ribosomal protein S2

  

0.464

(< 0.001)

 

YPTB3009

YPO1038

Conserved hypothetical protein

  

0.761

(0.039)

 

YPTB3126

or3195

Possible bacteriophage protein

1.616

(0.029)

  
 

YPTB3507 (rpsI)

YPO3562

30S ribosomal protein S9

0.723

(0.037)

0.582

(0.001)

 

YPTB3674 (rpsD)

YPO0233

30S ribosomal protein S4

  

0.576

(0.002)

 

YPTB3675 (rpsK)

YPO0232

30S ribosomal protein S11

  

0.594

(0.017)

 

YPTB3676 (rpsM)

YPO0231

30S ribosomal protein S13

  

0.518

(0.005)

 

YPTB3679 (rplO)

YPO0228

50S ribosomal protein L15

  

0.593

(0.008)

 

YPTB3682 (rplR)

YPO0225

50S ribosomal protein L18

  

0.563

(0.005)

 

YPTB3684 (rpsH)

or2793

30S ribosomal protein S8

0.638

(0.042)

0.619

(0.032)

 

YPTB3687 (rplX)

YPO0221

50S ribosomal protein L24

  

0.574

(0.005)

 

YPTB3688 (rplN)

YPO0220

50S ribosomal protein L14

  

0.634

(0.015)

 

YPTB3689 (rpsQ)

YPO0219

30S ribosomal protein S17

  

0.58

(0.016)

 

YPTB3691 (rplP)

YPO0217

50S ribosomal protein L16

  

0.511

(< 0.001)

 

YPTB3692 (rpsC)

YPO0216

30S ribosomal protein S3

  

0.642

(0.028)

 

YPTB3693 (rplV)

YPO0215

50S ribosomal protein L22

  

0.466

(0.003)

 

YPTB3694 (rpsS)

YPO0214

30S ribosomal protein S19

  

0.612

(0.013)

 

YPTB3695 (rplB)

YPO0213

50S ribosomal protein l2

0.555

(< 0.001)

0.596

(< 0.001)

 

YPTB3696 (rplW)

YPO0212

50S ribosomal protein L23

  

0.509

(0.001)

 

YPTB3698 (rplC)

YPO0210

50S ribosomal protein L3

  

0.465

(0.001)

 

YPTB3699 (rpsJ)

YPO0209

30S ribosomal protein S10

0.654

(0.049)

0.579

(0.014)

 

YPTB3702 (tufA,tufB)

or2775

elongation factor EF-Tu

  

0.672

(0.003)

 

YPTB3703 (fusA)

YPO0202

elongation factor G

  

0.536

(0.002)

 

YPTB3946 (rnpA)

YPO4101

ribonuclease P protein

0.58

(0.005)

  

K: transcription

 

YPTB0035 (spoT)

YPO0038

guanosine-3'.5'-bisbis(diphosphate) 3'-pyrophosphydrolase

0.684

(0.011)

  
 

YPTB0100 (cytR)

YPO0108

transcriptional repressoR

0.572

(0.014)

  
 

YPTB0167 (rho)

YPO3867

transcription termination factoR

0.467

(< 0.001)

  
 

YPTB0263 (rfaH)

YPO3770

putative regulatory protein

  

0.552

(0.001)

 

YPTB0278 (nusG)

YPO3752

transcription antitermination protein

  

0.57

(0.001)

 

YPTB0284 (rpoC)

YPO3746

DNA-directed RNA polymerase beta' chain

  

0.556

(0.019)

 

YPTB0291 (rsd)

YPO3737

regulator of sigma D

1.963

(< 0.001)

0.632

(0.002)

 

YPTB0333

YPO0276

putative LysR-family transcriptional regulatoR

  

0.62

(0.044)

 

YPTB0387 (rhaR)

YPO0333

L-rhamnose operon transcriptional activatoR

0.546

(0.025)

  
 

YPTB0479 (nusA)

YPO3497

N utilization substance protein A

0.653

(0.006)

0.595

(0.001)

 

YPTB0599 (rob)

YPO0456

putative right origin-binding protein

  

0.588

(0.012)

 

YPTB0601 (arcA)

YPO0458

aerobic respiration control protein

0.465

(0.001)

  
 

YPTB0658 (rapA)

YPO0517

RNA polymerase associated helicase

0.547

(0.004)

  
 

YPTB0712 (pdhR)

YPO3420

pyruvate dehydrogenase complex repressoR

0.808

(0.004)

0.695

(< 0.001)

 

YPTB0776 (rpoS)

YPO3355

RNA polymerase sigma factor RpoS

  

0.559

(0.001)

 

YPTB0803 (fucR)

YPO3327

putative deoR-family regulatory protein

0.435

(< 0.001)

1.521

(0.007)

 

YPTB0820

YPO3310

putative transcriptional regulatory protein

0.712

(0.022)

  
 

YPTB0857 (emrR)

YPO3266

MarR-family transcriptional regulatory protein

0.662

(0.029)

  
 

YPTB1088 (cspE)

YPO2595

putative cold shock protein

0.579

(0.005)

  
 

YPTB1258 (rcsB)

YPO1218

probable two component response regulator component B

  

0.693

(0.016)

 

YPTB1332 (psaE)

YPO1301

putative regulatory protein

1.986

(0.001)

0.474

(< 0.001)

 

YPTB1392 (cspD)

YPO1366

cold shock-like protein

0.46

(0.008)

  
 

YPTB1423 (cspE)

YPO1398

putative cold shock protein

0.579

(0.005)

  
 

YPTB1610 (thuR)

or1188

putative ThuR. regulatory protein for trehalosemaltose transp...

  

1.403

(0.025)

 

YPTB1721

YPO1849

conserved hypothetical (pseudogene. F/S)

1.366

(0.025)

  
 

YPTB1967 (hutC)

YPO1973

putative GntR-family transcriptional regulatory protein

0.739

(0.018)

  
 

YPTB2048 (hexR)

YPO2065

hex regulon repressoR

  

1.51

(0.013)

 

YPTB2072 (fadR)

YPO2144

fatty acid metabolism regulatory protein

  

1.494

(0.01)

 

YPTB2177 (araC)

YPO2258

arabinose operon regulatory protein

  

1.591

(0.002)

 

YPTB2190 (mlc)

YPO2268

putative ROK family transcriptional regulatory protein

1.417

(0.037)

  
 

YPTB2230 (rstA)

YPO2308

two-component regulatory system. response regulator protein

0.658

(0.024)

  
 

YPTB2262 (tyrR)

YPO2344

transcriptional regulatory protein

0.486

(< 0.001)

  
 

YPTB2288 (rovA)

YPO2374

MarR-family transcriptional regulatory protein

  

0.415

(< 0.001)

 

YPTB2367 (kdgR)

YPO1714

IclR-family transcriptional regulatory protein

  

0.75

(0.029)

 

YPTB2414 (cspC)

or3750

cold shock protein

  

0.685

(0.014)

 

YPTB2418

YPO1651

AsnC-family transcriptional regulatory protein

0.435

(< 0.001)

  
 

YPTB2534

YPO2498

putative LacI-family transcriptional regulatory protein

  

2.012

(0.005)

 

YPTB2737

YPO3017

putative rpiR-family transcriptional regulatory protein

1.601

(0.036)

  
 

YPTB2763 (narP)

YPO3041

nitrate/nitrite response regulator protein NarP

  

0.715

(0.043)

 

YPTB2860

YPO2897

conserved hypothetical protein

1.578

(0.011)

0.632

(0.01)

 

YPTB2865

YPO2903

putative RNA-binding protein

  

0.652

(0.035)

 

YPTB2890 (rnc)

YPO2718

ribonuclease III

  

0.673

(0.013)

 

YPTB2897 (rpoE)

YPO2711

RNA polymerase sigma E factoR

  

1.827

(< 0.001)

 

YPTB2939 (ureG)

YPO2670

urease accessory protein

0.293

(< 0.001)

  
 

YPTB3017 (gcvA)

YPO1029

glycine cleavage system transcriptional activatoR

1.634

(0.049)

  
 

YPTB3490

YPO3545

lysR-family transcriptional regulatory protein

1.503

(0.036)

1.518

(0.032)

 

YPTB3514

YPO3570

BolA-like protein

1.315

(0.035)

  
 

YPTB3538 (rnk)

YPO3695

regulator of nucleoside diphosphate kinase

0.564

(0.016)

  
 

YPTB3577 (fiS)

or2359

DNA-binding protein Fis

0.611

(0.034)

0.58

(0.02)

 

YPTB3579

YPO3651

Transcriptional regulator (pseudogene. inframe deletion)

  

0.675

(0.017)

 

YPTB3764 (greB)

YPO0136

transcription elongation factor

  

0.69

(0.004)

 

YPTB3779 (glpR)

YPO0120

glycerol-3-phosphate repressor protein

  

1.398

(0.043)

 

YPTB3798 (gntR)

YPO3955

gluconate utilization system Gnt-I transcriptional repressoR

  

1.589

(0.042)

 

YPTB3847 (uhpA)

YPO4012

two-component system response regulatoR

  

2.004

(0.006)

 

YPTB3887

YPO4034

putative AraC-family transcriptional regulatory protein

  

1.495

(0.04)

L: DNA replication, recombination and repair

 

YPTB0046 (radC)

YPO0049

putative DNA repair protein

1.544

(0.026)

0.575

(0.006)

 

YPTB0261

or0185

cytoplasmic Dnase (function similar to TatD)

0.569

(< 0.001)

  
 

YPTB0292

YPO3736

conserved hypothetical protein

  

1.453

(0.017)

 

YPTB0297 (hupA)

YPO3731

DNA-binding protein HU-alpha

  

0.455

(< 0.001)

 

YPTB0302 (or0218)

or0218

putative transposase

1.478

(0.046)

1.834

(0.004)

 

YPTB0439 (priB)

YPO3538

primosomal replication protein n

  

0.557

(0.045)

 

YPTB0498

YPO3475

conserved hypothetical protein

0.554

(0.013)

  
 

YPTB0579

YPO0434

putative metalloenzyme

0.64

(0.023)

  
 

YPTB0658 (rapA)

YPO0517

RNA polymerase associated helicase

0.547

(0.004)

  
 

YPTB0913 (rdgC)

YPO3212

possible recombination associated protein RdgC

1.82

(0.047)

  
 

YPTB0941 (xseB)

YPO3175

exodeoxyribonuclease VII small subunit

0.647

(0.044)

  
 

YPTB0962 (hupB)

YPO3154

DNA-binding protein HU-beta

1.674

(< 0.001)

0.727

(0.015)

 

YPTB0964 (ybaV)

YPO3152

putative exported protein

0.625

(0.02)

  
 

YPTB1418 (ihfB)

YPO1393

integration host factor beta-subunit

  

0.46

(0.003)

 

YPTB1799

or1306

putative modification methylase

1.94

(0.026)

  
 

YPTB2040 (ruvA)

YPO2057

Holliday junction DNA helicase

1.225

(0.04)

  
 

YPTB2140 (topA)

YPO2218

DNA topoisomerase I

1.654

(0.012)

0.548

(0.004)

 

YPTB2221 (ogt)

YPO2299

putative methylated-DNA – protein-cysteine methyltransferase

0.611

(0.017)

  
 

YPTB2335 (ihfA)

YPO2427

integration host factor alpha-subunit

1.626

(0.001)

0.623

(0.001)

 

YPTB2458

or3720

hypothetical

0.501

(< 0.001)

  
 

YPTB2792

YPO3071

conserved hypothetical protein

  

1.337

(0.026)

 

YPTB2834 (xseA)

YPO2872

exodeoxyribonuclease VII large subunit

  

0.639

(0.01)

 

YPTB3389

YPO0674

putative MutT-family protein

1.299

(0.044)

  
 

YPTB3577 (fiS)

or2359

DNA-binding protein Fis

0.611

(0.034)

0.58

(0.02)

 

YPTB3757

YPO0144

putative hydrolase

1.58

(0.013)

  

M: cell envelope biogenesis, outer membrane

 

YPTB0051 (kdtX)

YPO0054

lipopolysaccharide core biosynthesis glycosyl transferase

0.592

(0.001)

  
 

YPTB0173 (rffH)

YPO3861

glucose-1-phosphate thymidylyltransferase

  

1.604

(0.028)

 

YPTB0415

YPO0363

putative membrane transport protein

  

1.853

(0.003)

 

YPTB0491

YPO3483

multidrug efflux protein

  

1.833

(0.032)

 

YPTB0493 (ibeB)

YPO3481

probable outer membrane efflux lipoprotein

1.863

(0.015)

  
 

YPTB0694 (lpxC)

YPO0561

UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase

0.787

(0.04)

  
 

YPTB0775 (nlpD)

YPO3356

lipoprotein

1.345

(0.019)

0.732

(0.015)

 

YPTB0906

YPO3220

conserved hypothetical protein

  

0.651

(0.038)

 

YPTB0955 (yajG)

YPO3161

putative lipoprotein

1.48

(0.021)

  
 

YPTB0987 (kefA)

YPO3129

putative potassium efflux system

0.626

(0.001)

  
 

YPTB1002 (prt)

YPO3112

paratose synthase

  

0.706

(0.013)

 

YPTB1008 (wbyK)

YPO3104

putative mannosyltransferase

0.527

(0.001)

0.669

(0.03)

 

YPTB1014 (wzz)

YPO3096

O-antigen chain length determinant

  

0.577

(0.019)

 

YPTB1109 (cutE)

YPO2616

putative apolipoprotein N-acyltransferase

0.669

(0.029)

  
 

YPTB1160 (pal)

YPO1125

peptidoglycan-associated lipoprotein Pal

1.649

(< 0.001)

0.553

(< 0.001)

 

YPTB1217 (pbpG)

YPO1176

penicillin-binding protein 7 precursoR

0.565

(0.009)

  
 

YPTB1261 (ompC)

YPO1222

outer membrane protein C. porin

0.284

(< 0.001)

1.371

(0.034)

 

YPTB1266 (pla2)

YPO1231

putative outer membrane-associated protease

0.569

(0.015)

  
 

YPTB1309 (spr)

YPO1275

putative lipoprotein

0.499

(< 0.001)

0.646

(0.002)

 

YPTB1381

YPO1355

conserved hypothetical protein

0.683

(0.031)

  
 

YPTB1435

YPO1411

putative outer membrane porin C protein

   

(< 0.001)

 

YPTB1453 (ompA)

YPO1435

putative outer membrane porin A protein

  

0.355

(< 0.001)

 

YPTB1514

YPO1498

putative exported protein

  

0.301

(< 0.001)

 

YPTB1528 (yohK)

YPO1513

putative membrane protein

1.513

(0.043)

  
 

YPTB1731

YPO1860

attachment invasion locus protein

  

1.634

(< 0.001)

 

YPTB1819

or1328

hypothetical phage protein

1.902

(0.025)

  
 

YPTB1964

or1419

putative outer membrane porin C protein

   

(< 0.001)

 

YPTB1975

YPO1982

putative dehydrogenase

  

0.63

(0.012)

 

YPTB2081

YPO2155

putative exported protein

0.796

(0.009)

  
 

YPTB2113

YPO2190

attachment invasion locus protein precursoR

1.511

(0.012)

 

(< 0.001)

 

YPTB2117 (tonB)

YPO2193

TonB

5.465

(< 0.001)

  
 

YPTB2123 (ompW)

YPO2201

putative exported protein

0.165

(< 0.001)

  
 

YPTB2233 (sepC)

YPO2312

insecticidal toxin (pseudogene. inframe insertion)

1.424

(0.045)

  
 

YPTB2294 (sepC)

YPO2380

insecticidal toxin (pseudogene. inframe insertion)

1.424

(0.045)

  
 

YPTB2323 (nlpC)

YPO2415

putative lipoprotein

1.388

(0.025)

  
 

YPTB2979 (cutF)

YPO1067

putative copper homeostasis lipoprotein

1.794

(0.001)

  
 

YPTB2994 (ompH)

YPO1053

cationic 19 kDa outer membrane protein precursoR

1.69

(< 0.001)

0.538

(< 0.001)

 

YPTB2995

YPO1052

putative surface antigen

  

0.745

(0.016)

 

YPTB2996

YPO1051

putative membrane protein

1.531

(0.03)

  
 

YPTB3194

YPO0919

putative membrane protein

1.569

(0.024)

  
 

YPTB3277

or3091

Conserved hypothetical protein

  

1.57

(0.026)

 

YPTB3282

or3086

Conserved hypothetical protein (partial. c-term)

1.529

(0.025)

  
 

YPTB3285

or3082

Putative autotransporter secreted protein

  

1.593

(0.028)

 

YPTB3313 (slyB)

YPO0752

putative lipoprotein

1.452

(0.003)

  
 

YPTB3407 (rfaE)

YPO0654

ADP-heptose synthase

0.709

(0.042)

  
 

YPTB3438

YPO0617

putative membrane protein

1.993

(0.004)

  
 

YPTB3497 (mtgA)

YPO3552

monofunctional biosynthetic peptidoglycan transglycosylase

  

1.736

(0.008)

 

YPTB3513 (murA)

YPO3569

UDP-N-acetylglucosamine1-carboxyvinyltransferase

  

0.775

(0.034)

 

YPTB3717

YPO0187

putative glycosyl transferase

0.657

(0.013)

  
 

YPTB3958

YPO4112

putative membrane protein

1.69

(0.004)

  
 

YPTB3965 (glmU)

YPO4119

UDP-N-acetylglucosamine pyrophosphorylase

1.572

(0.042)

  

N: cell motility and secretion

 

YPTB0071 (cpxP)

YPO0075

putative exported protein

  

0.337

(< 0.001)

 

YPTB0156

YPO3881

putative chaperone protein

0.657

(0.01)

  
 

YPTB0158

YPO3879

putative outer membrane usher protein

  

1.626

(0.016)

 

YPTB0359

YPO0302

putative outer membrane fimbrial usher protein

1.398

(0.049)

  
 

YPTB0706 (hofB)

YPO3426

putative type II secretion system protein

0.711

(0.043)

  
 

YPTB1335 (psaB)

YPO1304

chaperone protein PsaB precursoR

0.216

(< 0.001)

  
 

YPTB1680 (flgJ)

YPO1807

flagellar protein FlgJ

  

1.906

(0.01)

 

YPTB1681 (flgK)

YPO1808

flagellar hook-associated protein 1

0.616

(0.01)

0.682

(0.034)

 

YPTB1682 (flgL)

YPO1809

flagellar hook-associated protein 3

1.514

(0.041)

  
 

YPTB1693

YPO1820A

   

2.053

(0.011)

 

YPTB1695 (fliN)

YPO1822

flagellar motor switch protein FliN

  

1.79

(0.021)

 

YPTB1698 (fliK)

YPO1825

flagellar hook-length control protein FliK

  

1.941

(0.006)

 

YPTB1919

YPO1920

probable fimbrial usher protein

  

1.461

(0.019)

 

YPTB2396 (cheZ)

YPO1681

chemotaxis protein CheZ

  

1.477

(0.027)

 

YPTB2405 (cheA)

YPO1666

chemotaxis protein CheA

1.725

(0.015)

  
 

YPTB2843

YPO2881

putative fimbrial biogenesis protein

  

0.686

(0.022)

 

YPTB3347 (fliG)

YPO0715

puative flagellar motor switch protein

1.68

(0.03)

1.722

(0.024)

 

YPTB3357

YPO0704

flagellar assembly protein

0.611

(0.049)

  
 

YPTB3896

YPTB3896

fimbrial protein

  

1.644

(0.021)

No COG

 

YPTB0092

YPO0100

hypothetical protein

1.623

(0.025)

0.434

(< 0.001)

 

YPTB0094

YPO0102

putative exported protein

  

0.503

(< 0.001)

 

YPTB0123 (yijD)

YPO3912

putative membrane protein

  

0.669

(0.033)

 

YPTB0139

YPO3895

putative membrane protein

  

0.717

(0.036)

 

YPTB0141

YPTB0141

putative membrane protein

1.774

(0.026)

  
 

YPTB0148

or0096

colicin (pseudogene. partial)

1.493

(0.013)

  
 

YPTB0149

or0097

putative colicin immunity protein

  

1.605

(0.045)

 

YPTB0151 (imm2)

or0099

pyocin S2 immunity protein

1.549

(0.013)

0.486

(< 0.001)

 

YPTB0212 (dcrB)

YPO3823

putative lipoprotein

0.758

(0.028)

  
 

YPTB0237

or5000

putative exported protein

  

1.357

(0.048)

 

YPTB0244

or0169

hypothetical

0.517

(< 0.001)

  
 

YPTB0362

YPO0306

conserved hypothetical protein (pseudogene. F/S)

  

0.66

(0.036)

 

YPTB0391

YPO0337

putative exported protein

  

0.527

(< 0.001)

 

YPTB0406

YPO0352

putative lipoprotein

1.294

(0.042)

  
 

YPTB0449

YPO3527

conserved hypothetical protein

  

2

(< 0.001)

 

YPTB0499

YPO3474

hypothetical protein

  

1.509

(0.036)

 

YPTB0505

YPO3468

hypothetical protein

  

1.632

(0.026)

 

YPTB0546

YPO0406

putative exported protein

2.397

(< 0.001)

  
 

YPTB0560

or0394

hypothetical protein

1.636

(0.028)

0.271

(< 0.001)

 

YPTB0593

YPO0450

putative membrane protein

0.736

(0.025)

1.464

(0.007)

 

YPTB0651

YPO0511

hypothetical protein

  

0.576

(0.02)

 

YPTB0657

YPO0516

hypothetical protein

  

0.457

(0.001)

 

YPTB0666

or4788

putative IS1400 transposase B

2.101

(< 0.001)

  
 

YPTB0678

YPO0544

putative membrane protein

  

0.631

(0.009)

 

YPTB0768 (ygbE)

YPO3363

putative membrane protein

1.735

(0.007)

  
 

YPTB0793

YPO3339

hypothetical protein

1.679

(0.023)

1.94

(0.005)

 

YPTB0795

YPO3336

conserved hypothetical protein

3

(< 0.001)

  
 

YPTB0903 (crl)

YPO3223

curlin genes regulatory protein

2.098

(< 0.001)

  
 

YPTB0957

YPO3159

hypothetical protein

  

1.521

(0.034)

 

YPTB0978 (ymoA)

YPO3138

modulating protein YmoA (histone-like protein)

0.509

(< 0.001)

  
 

YPTB0979

YPO3137

conserved hypothetical protein

0.469

(< 0.001)

  
 

YPTB0980

YPO3136

hypothetical protein

0.587

(0.01)

  
 

YPTB1004 (wzx)

or0734

putative O-unit flippase

  

0.642

(0.007)

 

YPTB1018 (ushB)

or0747

5'-nucleotidase/UDP-sugar diphosphatase

  

1.34

(0.031)

 

YPTB1041

YPO2820

hypothetical protein

1.394

(0.029)

  
 

YPTB1042 (int)

or4598

phage integrase (pseudogene. Partial)

  

1.483

(0.046)

 

YPTB1043

or0754

hypothetical

0.569

(0.002)

  
 

YPTB1130 (trp1400A)

or4531

IS1400 transposase A

  

2.136

(< 0.001)

 

YPTB1167 (psiF)

YPO1134

putative starvation-inducible protein

2.04

(0.014)

  
 

YPTB1202 (xapB)

YPO1172

xanthosine permease (pseudogene. IS1541)

1.381

(0.03)

1.499

(0.009)

 

YPTB1220

YPO1179

conserved hypothetical protein

0.702

(0.038)

  
 

YPTB1287

or0929

putative bacteriophage tail fiber protein

1.853

(0.01)

  
 

YPTB1291

YPO1255

hypothetical protein

0.361

(< 0.001)

  
 

YPTB1303

YPO1269

conserved hypothetical protein

1.754

(0.008)

  
 

YPTB1334 (psaA)

YPO1303

pH 6 antigen precursor (antigen 4) (adhesin)

 

(< 0.001)

  
 

YPTB1359

YPO1328

putative membrane protein

1.723

(0.003)

  
 

YPTB1515

YPO1499

putative membrane protein

1.521

(0.045)

  
 

YPTB1543 (ysuH)

YPO1531

putative siderophore biosynthetic enzyme

1.896

(0.02)

  
 

YPTB1583

YPO1574

putative exported protein

0.605

(< 0.001)

  
 

YPTB1602 (int)

or4274

integrase

0.592

(0.026)

  
 

YPTB1616

or1193

conserved hypothetical protein

0.677

(0.016)

1.488

(0.014)

 

YPTB1619

YPO1741

hypothetical protein

  

1.496

(0.025)

 

YPTB1622

YPO1744

putative exported protein

1.671

(0.019)

  
 

YPTB1663

YPO1788

putative acyl carrier protein

1.57

(0.049)

  
 

YPTB1664

YPO1789

putative membrane protein

1.638

(0.031)

  
 

YPTB1668 (invA)

or1234

putative invasin

0.5

(< 0.001)

0.397

(< 0.001)

 

YPTB1705

YPTB1705

putative phage minor tail protein

1.794

(0.002)

  
 

YPTB1722

YPO1850

hypothetical protein

  

1.593

(0.045)

 

YPTB1734

YPO1864

conserved hypothetical protein

0.679

(0.003)

  
 

YPTB1752

or4178

O protein [Enterobacteria phage 186] gb|AAC34159.1| (U32222)...

0.49

(0.01)

  
 

YPTB1785

or4145

hypothetical protein

0.453

(< 0.001)

  
 

YPTB1786

or4144

hypothetical protein

  

1.605

(0.042)

 

YPTB1798 (yfdM)

or1305

conserved hypothetical protein

1.506

(0.043)

  
 

YPTB1801

or1309

hypothetical protein

0.279

(< 0.001)

  
 

YPTB1802

or1310

hypothetical protein

0.449

(0.01)

  
 

YPTB1815

or1324

putative phage protein

1.57

(0.037)

  
 

YPTB1821

YPTB1821

putative acyl carrier protein

1.57

(0.049)

  
 

YPTB1822

or4135

putative membrane protein

1.638

(0.031)

  
 

YPTB1826

or1333

bacteriophage hypothetical protein

  

1.754

(0.04)

 

YPTB1850

or4114

gpR [Enterobacteria phage P2] sp|P36933|VPR_BPP2 tAIL COMPLE...

  

1.779

(0.024)

 

YPTB1858

or4106

similar to V protein phage 186

  

1.743

(0.024)

 

YPTB1862

or4102

putative phage replication protein

0.536

(0.011)

  
 

YPTB1884

or1358

possible MFS Superfamliy multidrug-efflux transporter

   

(< 0.001)

 

YPTB1887

or1361

hypothetical protein

   

(< 0.001)

 

YPTB1893

YPO1874

conserved hypothetical protein

1.593

(0.034)

  
 

YPTB1980

YPO1987

hypothetical protein (pseudogene. IS285)

  

1.485

(0.047)

 

YPTB1986

YPO1994

hypothetical protein

0.649

(0.039)

  
 

YPTB1987

YPO1995

hypothetical protein

0.57

(0.047)

  
 

YPTB1996

YPO2004

putative membrane protein

  

2.041

(0.002)

 

YPTB2000

YPO2012

putative membrane protein

0.256

(< 0.001)

  
 

YPTB2092

YPO2166

putative exported protein

0.671

(0.027)

  
 

YPTB2114

YPO2191

hypothetical protein

0.28

(< 0.001)

  
 

YPTB2148

YPO2226

hypothetical protein

1.855

(0.007)

  
 

YPTB2151 (osmB)

YPO2229

osmotically inducible lipoprotein B precursoR

2.229

(< 0.001)

1.413

(0.032)

 

YPTB2219

YPO2297

hypothetical protein

  

1.576

(0.031)

 

YPTB2227

YPO2305

putative exported protein

1.37

(0.015)

0.774

(0.042)

 

YPTB2229

YPO2307

conserved hypothetical protein

0.708

(0.026)

  
 

YPTB2237 (asr)

YPO2318

putative acid shock protein

  

0.654

(0.022)

 

YPTB2269 (pspB)

YPO2350

phage shock protein B

1.983

(0.018)

  
 

YPTB2334

YPO2426

putative exported protein

1.628

(0.015)

  
 

YPTB2353 (yfeE)

YPO2445

putative yfeABCD locus regulatoR

1.526

(0.008)

  
 

YPTB2358 (pelY)

YPO1723

periplasmic pectate lyase precursoR

  

2.081

(0.001)

 

YPTB2363

YPO1718

putative exported protein

  

1.804

(0.038)

 

YPTB2387

YPO1694

conserved hypothetical protein

1.794

(0.008)

  
 

YPTB2393

YPO1686

putative exported protein

  

1.442

(0.019)

 

YPTB2417 (ylaC)

YPO1652

putative membrane protein

  

1.559

(0.003)

 

YPTB2419

YPO1650

hypothetical protein

0.6

(0.026)

  
 

YPTB2420

YPO1649

conserved hypothetical protein

1.758

(0.004)

2.658

(< 0.001)

 

YPTB2421

YPO1648

probable histidine acid phosphatase

  

1.474

(0.045)

 

YPTB2425

YPO1643

hypothetical protein

1.662

(0.01)

  
 

YPTB2446

YPO1619

hypothetical protein

1.504

(0.019)

  
 

YPTB2483 (dinI)

YPO1586

DNA-damage-inducible protein I

1.646

(0.006)

  
 

YPTB2495

or1732

glucans biosynthesis protein (pseudogene. deletions)

1.503

(0.024)

  
 

YPTB2496

or1737

hypothetical

  

0.433

(0.001)

 

YPTB2540

or3654

conserved hypothetical protein

  

2.145

(0.008)

 

YPTB2552

YPO2515

hypothetical

1.46

(0.023)

1.396

(0.042)

 

YPTB2554

YPO2521

putative exported protein

0.648

(0.044)

  
 

YPTB2562

YPO2530

conserved hypothetical protein

  

0.527

(0.026)

 

YPTB2623 (flk)

YPO2760

putative flagellar assembly regulatory protein. flk

0.549

(0.008)

  
 

YPTB2699

YPO2976

conserved hypothetical protein

4.448

(< 0.001)

1.458

(0.016)

 

YPTB2704

YPO2981

putative exported protein

1.628

(0.015)

  
 

YPTB2744 (yfeY)

YPO3026

putative lipoprotein

  

1.604

(0.019)

 

YPTB2753

YPO3031

putative acetyltransferase

1.391

(0.02)

  
 

YPTB2750

or3477

hypothetical

  

0.688

(0.006)

 

YPTB2787

YPO3066

hypothetical protein

1.504

(0.019)

  
 

YPTB2822

YPO2857

putative exported protein

  

1.718

(0.031)

 

YPTB2877

YPO2918

putative exported protein

0.542

(0.024)

  
 

YPTB2893

YPO2715

putative membrane protein

1.565

(0.011)

  
 

YPTB2922

or3339

hypothetical

1.886

(0.001)

  
 

YPTB2935

YPO2674

putative exported protein

 

(< 0.001)

  
 

YPTB2951

YPO2657

putative mobilization protein

0.566

(< 0.001)

  
 

YPTB2953

YPO2653

conserved hypothetical protein

  

0.639

(0.027)

 

YPTB2954 (asr)

YPO2652

putative acid shock protein

1.815

(0.033)

  
 

YPTB3007

YPO1040

conserved hypothetical protein

0.728

(0.024)

0.73

(0.025)

 

YPTB3039

YPO0791

hypothetical protein

0.545

(0.007)

  
 

YPTB3041 (ygeD)

YPO0792

putative membrane protein

  

0.617

(0.015)

 

YPTB3071

YPO0822

putative exported protein

0.51

(0.002)

  
 

YPTB3111

YPO0867

putative membrane protein

0.675

(0.027)

  
 

YPTB3177

YPO0901

putative exported protein

  

1.442

(0.019)

 

YPTB3179

YPO0904

hypothetical protein

  

1.708

(0.002)

 

YPTB3220

YPO0948

conserved hypothetical protein

1.56

(0.021)

  
 

YPTB3256 (insA)

or3105

insertion element protein

  

1.939

(< 0.001)

 

YPTB3257

YPO0983

putative lipoprotein

  

2.06

(0.001)

 

YPTB3280

or3088

Hypothetical

0.606

(0.009)

  
 

YPTB3305

YPO1002

hypothetical protein

1.679

(0.023)

1.94

(0.005)

 

YPTB3342

YPO0720

putative flagellar regulatory protein

  

1.492

(0.007)

 

YPTB3343

YPO0719

hypothetical protein

  

1.563

(0.038)

 

YPTB3371

YPO0694

Putative membrane protein (pseudogene. inframe deletion)

0.653

(0.049)

  
 

YPTB3421

YPO0640

hypothetical protein

0.716

(0.028)

  
 

YPTB3454

or2954

Fragment of hemagglutinin/hemolysin-related protein

0.653

(0.025)

  
 

YPTB3458

or2950

hypothetical

  

1.92

(0.005)

 

YPTB3504

YPO3559

putative exported protein

0.483

(< 0.001)

  
 

YPTB3534

YPO3699

putative exported protein

  

0.676

(0.038)

 

YPTB3551

YPO3681

Insecticidal toxin TcaA

  

0.619

(0.047)

 

YPTB3556

YPO3675

putative exported protein

  

0.637

(0.043)

 

YPTB3627

YPO3601

conserved hypothetical protein

0.595

(0.006)

  
 

YPTB3641 (malM)

YPO3710

maltose operon periplasmic protein

0.379

(< 0.001)

  
 

YPTB3769 (feoC)

YPO0131

ferrous iron transport protein C

1.899

(< 0.001)

  
 

YPTB3770

YPO0130

putative exported protein

  

0.43

(< 0.001)

 

YPTB3781

YPO3935

putative membrane protein

  

0.717

(0.036)

 

YPTB3789

or2712

putative invasin

  

0.614

(0.01)

 

YPTB3811 (uspB)

YPO3969

universal stress protein B

  

0.665

(0.04)

 

YPTB3834 (pelY)

YPO3994

periplasmic pectate lyase precursoR

  

2.081

(0.001)

 

YPTB3835

YPO3995

putative exported protein

  

1.804

(0.038)

 

YPTB3855

YPO4020

putative membrane protein

  

0.422

(< 0.001)

 

YPTB3893

YPO4040

putative exported protein

  

0.487

(< 0.001)

 

YPTB3908

YPO4081

putative membrane protein

  

1.408

(0.01)

 

YPTB3917 (yiaF)

YPO4070

putative exported protein

1.554

(0.016)

0.701

(0.047)

 

YPTB3922

YPO4064

hypothetical protein

  

1.409

(0.046)

 

YPTB3923

YPO4063

putative membrane protein

  

1.53

(0.041)

 

YPTB3944

or2545

hypothetical protein_

0.593

(0.016)

  

O: posttranslational modification, protein turnover, chaperones

 

YPTB0404 (groES)

YPO0350

10 kDa chaperonin

0.683

(0.029)

1.445

(0.035)

 

YPTB0427 (hflK)

YPO0375

putative membrane protein (pseudogene. inframe deletion)

  

0.619

(0.033)

 

YPTB0494

YPO3480

conserved hypothetical protein

0.444

(< 0.001)

  
 

YPTB0495

YPO3479

putative protease

0.328

(< 0.001)

  
 

YPTB0518 (nrdG)

YPO3455

anaerobic ribonucleoside-triphosphate reductase Activating protein

0.439

(0.001)

  
 

YPTB0612 (dnaK)

YPO0469

chaperone protein DnaK

0.73

(0.049)

0.693

(0.025)

 

YPTB0647 (clpB)

YPO0506

putative Clp ATPase

1.481

(0.047)

0.402

(< 0.001)

 

YPTB0774 (pcm)

YPO3357

protein-L-isoaspartate O-methyltransferase

0.62

(0.014)

  
 

YPTB0925 (ahpC)

YPO3194

putative alkyl hydroperoxide reductase subunit c

  

0.545

(< 0.001)

 

YPTB0948 (cyoE)

YPO3168

protoheme IX farnesyltransferase

1.422

(0.039)

  
 

YPTB0958 (tig)

YPO3158

Trigger factoR

  

0.607

(0.008)

 

YPTB0995 (htpG)

YPO3119

heat shock protein HtpG

  

0.569

(0.004)

 

YPTB1025

YPO3083

conserved hypothetical protein

  

0.66

(0.014)

 

YPTB1026 (ybbN)

YPO3082

putative thioredoxin

  

0.715

(0.019)

 

YPTB1034 (ppiB)

YPO3074

peptidyl-prolyl cis-trans isomerase B

1.419

(0.013)

  
 

YPTB1141

YPO1107

heat shock protein GrpE

1.442

(0.048)

  
 

YPTB1406 (pflA)

YPO1381

pyruvate formate-lyase 1 activating enzyme

0.578

(0.004)

  
 

YPTB1871

or1348

similar to hypothetical bacteriophage P27 protein

0.58

(0.001)

  
 

YPTB1945

YPO1947

putative thioredoxin

1.646

(0.002)

  
 

YPTB2070 (dsbB)

YPO2141

disulfide bond formation protein B

1.636

(< 0.001)

0.757

(0.023)

 

YPTB2084

YPO2158

conserved hypothetical protein

0.683

(0.003)

  
 

YPTB2261 (tpx)

YPO2342

thiol peroxidase

2.414

(< 0.001)

0.527

(< 0.001)

 

YPTB2297

YPO2383

conserved hypothetical protein

  

0.741

(0.025)

 

YPTB2311

YPO2401

conserved hypothetical protein

1.822

(0.001)

  
 

YPTB2312

YPO2402

putative ATP-dependent transporteR

2.036

(0.006)

  
 

YPTB2313

YPO2403

conserved hypothetical protein

2.213

(0.002)

  
 

YPTB2734 (cysT)

YPO3014

sulfate transport system permease protein CysT

  

0.714

(0.029)

 

YPTB2785 (bcp)

YPO3064

bacterioferritin comigratory protein

1.417

(0.033)

  
 

YPTB2806

YPO2840

putative heat shock protein

0.674

(0.027)

  
 

YPTB2905 (pcp)

YPO2703

putative pyrrolidone-carboxylate peptidase

1.608

(0.016)

  
 

YPTB2938 (ureD)

YPO2671

urease accessory protein

0.377

(< 0.001)

  
 

YPTB2939 (ureG)

YPO2670

urease accessory protein

0.293

(< 0.001)

  
 

YPTB2940 (ureF)

YPO2669

urease accessory protein

0.268

(< 0.001)

  
 

YPTB2941 (ureE)

YPO2668

urease accessory protein

0.347

(< 0.001)

  
 

YPTB3408 (glnE)

YPO0653

glutamate-ammonia-ligase adenylyltransferase

1.792

(0.046)

  
 

YPTB3415 (gcp)

YPO0646

putative glycoprotease

0.568

(0.009)

  
 

YPTB3710 (fkpA)

YPO0195

peptidyl-prolyl cis-trans isomerase

  

0.571

(0.007)

 

YPTB3728

YPO0176

conserved hypothetical protein

1.988

(0.002)

  
 

YPTB3734 (ppiA)

YPO0167

peptidyl-prolyl cis-trans isomerase A

0.757

(0.015)

0.61

(< 0.001)

 

YPTB3930 (fdhE)

YPO4055

putative formate dehydrogenase formation protein

0.556

(< 0.001)

0.798

(0.031)

P: inorganic ion transport and metabolism

 

YPTB0071 (cpxP)

YPO0075

putative exported protein

  

0.337

(< 0.001)

 

YPTB0270 (trkH)

YPO3762

Trk system potassium uptake protein TrkH

0.634

(0.018)

  
 

YPTB0336 (hmuV)

YPO0279

hemin transport system ATP-binding protein

1.666

(0.003)

0.652

(0.01)

 

YPTB0338 (hmuT)

YPO0281

hemin-binding periplasmic protein

1.684

(0.015)

0.605

(0.019)

 

YPTB0339 (hmuS)

YPO0282

hemin transport protein

1.577

(0.021)

0.666

(0.038)

 

YPTB0340 (hmuR)

YPO0283

hemin receptor precursoR

7.426

(< 0.001)

  
 

YPTB0343

YPO0285

conserved hypothetical protein

1.774

(0.009)

  
 

YPTB0354 (terB)

YPO0296

tellurite resistance protein

  

0.504

(0.002)

 

YPTB0371

YPO0315

putative regulatory protein

0.409

(< 0.001)

  
 

YPTB0516 (phnG)

YPO3457

PhnG protein

1.713

(0.016)

  
 

YPTB0521

YPO3452

putative ABC transporter transporter. ATP-binding protein

1.679

(0.029)

  
 

YPTB0594

YPO0451

putative cation-transporting P-type ATPase

0.653

(0.046)

  
 

YPTB0662 (thiP)

YPO0521

thiamine transport system permease protein

1.973

(0.003)

1.574

(0.035)

 

YPTB0739 (fhuC)

YPO3392

ferrichrome transport ATP-binding protein FhuC

1.932

(0.046)

  
 

YPTB0740 (fhuD)

YPO3391

ferrichrome-binding periplasmic protein precursoR

1.835

(0.021)

  
 

YPTB0790 (yhjA)

YPO3342

putative cytochrome C peroxidase

0.479

(< 0.001)

  
 

YPTB0811 (katY)

YPO3319

catalase-peroxidase

0.602

(0.008)

2.344

(< 0.001)

 

YPTB0986

YPO3130

conserved hypothetical protein

  

1.749

(0.003)

 

YPTB1246 (katA)

YPO1207

catalase

0.324

(< 0.001)

  
 

YPTB1341

YPO1310

putative periplasmic substrate-binding transport protein

3.085

(< 0.001)

  
 

YPTB1343 (yiuC)

YPO1312

putative siderophore ABC transporter. ATP-binding subunit

2.467

(< 0.001)

  
 

YPTB1409 (focA)

YPO1384

putative formate transporter 1

0.563

(0.005)

1.638

(0.013)

 

YPTB1549 (ysuR)

YPO1537

putative iron-siderophore receptoR

2.609

(< 0.001)

0.669

(0.039)

 

YPTB1659 (ftnA)

YPO1783

ferritin

0.18

(< 0.001)

  
 

YPTB1725

YPO1854

putative membrane protein

2.084

(0.013)

  
 

YPTB1939

YPO1941

putative membrane protein

  

0.549

(< 0.001)

 

YPTB1940

YPO1942

putative exported protein

1.776

(0.003)

  
 

YPTB1947 (tehB)

YPO1949

putative tellurite resistance protein

1.722

(0.025)

  
 

YPTB2044 (znuA)

YPO2061

exported high-affinity zinc uptake system protein

  

1.693

(0.009)

 

YPTB2052

YPO2069

putative integral membrane protein

1.506

(0.041)

  
 

YPTB2108 (oppD)

YPO2185

oligopeptide transport ATP-binding protein

 

(< 0.001)

  
 

YPTB2299 (sodB)

YPO2386

superoxide dismutase [Fe]

 

(< 0.001)

  
 

YPTB2347 (yfeA)

YPO2439

periplasmic-binding protein

11.88

(< 0.001)

  
 

YPTB2348 (yfeB)

YPO2440

ATP-binding transport protein

3.141

(< 0.001)

  
 

YPTB2349 (yfeC)

YPO2441

chelated iron transport system membrane protein

4.375

(< 0.001)

  
 

YPTB2350 (yfeD)

YPO2442

chelated iron transport system membrane protein

2.104

(< 0.001)

  
 

YPTB2546 (dps)

YPO2509

putative DNA-binding protein

  

0.566

(< 0.001)

 

YPTB2682 (yfuA)

YPO2958

iron(III)-binding periplasmic protein

2.387

(< 0.001)

  
 

YPTB2743

YPO3025

conserved hypothetical protein

  

1.598

(0.049)

 

YPTB2769 (ydeN)

YPO3047

putative sulfatase

0.382

(< 0.001)

  
 

YPTB2771

YPO3049

putative binding protein-dependent transport system. inner-membrane comp

0.592

(0.026)

  
 

YPTB2803 (ppx)

YPO2837

putative exopolyphosphatase

  

0.564

(< 0.001)

 

YPTB2934

YPO2675

putative potassium channel protein

0.236

(< 0.001)

  
 

YPTB2936

YPO2673

putative nickel transport protein

0.398

(< 0.001)

  
 

YPTB2974

YPO1072

ABC transporter permease protein

1.328

(0.027)

  
 

YPTB2979 (cutF)

YPO1067

putative copper homeostasis lipoprotein

1.794

(0.001)

  
 

YPTB3068

YPO0819

putative carbonic anhydrase

0.344

(< 0.001)

  
 

YPTB3074

YPO0829

putative sulfatase

  

1.622

(0.023)

 

YPTB3227

YPO0955

putative periplasmic substrate-binding transport protein

3.085

(< 0.001)

  
 

YPTB3298

YPO1011

putative TonB-dependent outer membrane receptoR

2.15

(0.004)

0.554

(0.022)

 

YPTB3605 (ssuA)

YPO3624

aliphatic sulfonates binding protein (pseudogene. insertion)

1.534

(0.048)

  
 

YPTB3700 (bfr)

YPO0206

bacterioferritin

  

0.66

(0.003)

 

YPTB3701 (bfd)

or2776

putative bacterioferritin-associated ferredoxin

1.856

(0.002)

  
 

YPTB3706

YPO0199

conserved hypothetical protein

  

1.467

(0.009)

 

YPTB3737

YPO0164

putative membrane receptor protein (pseudogene. inframe insertion)

  

0.568

(0.001)

 

YPTB3767 (feoA)

YPO0133

hypothetical ferrous iron transport protein A

1.509

(0.045)

0.624

(0.025)

 

YPTB3857

YPO4022

putative iron transport protein

3.127

(< 0.001)

  
 

YPTB3858

YPO4023

putative iron transport permease

2.236

(< 0.001)

  
 

YPTB3860

YPO4025

putative iron ABC transporter. ATP-binding protein

2.216

(< 0.001)

  
 

YPTB3925 (sodA)

YPO4061

superoxide dismutase [Mn]

3.101

(< 0.001)

0.613

(0.017)

 

YPTB3963 (pstS)

YPO4117

putative phosphate-binding periplasmic protein

1.741

(< 0.001)

  

Q: secondary metabolite biosynthesis, transport and catabolism

 

YPTB1030 (ybbP)

YPO3078

putative permease

1.661

(0.022)

1.756

(0.012)

 

YPTB1480

YPO1462

putative acyl carrier protein

  

1.669

(0.048)

 

YPTB1544 (ysuG)

YPO1532

putative siderophore biosynthetic enzyme

2.403

(0.005)

  
 

YPTB1550

YPO1538

putative siderophore biosynthetic enzyme

8.255

(< 0.001)

0.649

(0.048)

 

YPTB1596 (irp2)

YPO1911

yersiniabactin biosynthetic protein

1.526

(0.029)

  
 

YPTB1966 (hutI)

YPO1972

imidazolonepropionase

0.632

(0.004)

  
 

YPTB2064

YPO2082

putative fumarylacetoacetate hydrolase family protein

  

0.73

(0.018)

 

YPTB2470 (acpP)

YPO1600

acyl carrier protein

  

0.661

(0.002)

 

YPTB2471 (fabG)

YPO1599

3-oxoacyl-[acyl-carrier protein] reductase

  

0.573

(0.002)

 

YPTB2561 (menF)

YPO2528

menaquinone-specific isochorismate synthase

  

0.522

(0.011)

 

YPTB2626 (fabB)

YPO2757

3-oxoacyl-[acyl-carrier-protein] synthase I

  

0.605

(0.009)

 

YPTB3258 (yspI)

YPO0984

N-acylhomoserine lactone synthase YspI

  

0.494

(0.032)

 

YPTB3263 (iucA)

YPO0989

aerobactin synthetase (subunit alpha)

3.789

(< 0.001)

  
 

YPTB3265 (iucC)

YPO0992

aerobactin synthetase (subunit beta)

2.601

(< 0.001)

  
 

YPTB3266 (iucD)

YPO0993

putative siderophore biosynthesis protein IucD

2.151

(0.002)

  
 

YPTB3297

YPO0777

putative peptide/polyketide synthase subunit

2.142

(< 0.001)

  

R: general function prediction only

 

YPTB0026

YPO0027

conserved hypothetical protein

  

0.616

(0.018)

 

YPTB0057 (tdh)

YPO0060

threonine 3-dehydrogenase

0.663

(0.041)

  
 

YPTB0063 (secB)

YPO0067

protein-export protein

  

0.683

(0.012)

 

YPTB0071 (cpxP)

YPO0075

putative exported protein

  

0.337

(< 0.001)

 

YPTB0156

YPO3881

putative chaperone protein

0.657

(0.01)

  
 

YPTB0158

YPO3879

putative outer membrane usher protein

  

1.626

(0.016)

 

YPTB0221 (ftsY)

YPO3814

cell division protein (pseudogene. inframe deletion)

  

0.71

(0.035)

 

YPTB0257 (aarF)

YPO3779

ubiquinone biosynthesis protein

0.68

(0.048)

  
 

YPTB0258 (tatA)

YPO3778

Sec-independent protein translocase protein tatA

0.685

(0.003)

  
 

YPTB0327

YPO0270

putative type III secretion apparatus protein

  

0.658

(0.014)

 

YPTB0331

YPO0274

putative integral membrane protein

  

2.083

(< 0.001)

 

YPTB0353 (terA)

YPO0295

putative tellurite resistance protein

  

0.565

(< 0.001)

 

YPTB0359

YPO0302

putative outer membrane fimbrial usher protein

1.398

(0.049)

  
 

YPTB0374 (qor)

YPO0319

quinone oxidoreductase

1.393

(0.04)

  
 

YPTB0448

YPO3528

putative exported protein

0.451

(< 0.001)

  
 

YPTB0466

YPO3510

putative membrane protein

1.768

(0.019)

  
 

YPTB0493 (ibeB)

YPO3481

probable outer membrane efflux lipoprotein

1.863

(0.015)

  
 

YPTB0576 (osmY)

YPO0431

osmotically inducible protein Y

3.79

(< 0.001)

0.421

(0.001)

 

YPTB0706 (hofB)

YPO3426

putative type II secretion system protein

0.711

(0.043)

  
 

YPTB0808

YPO3322

conserved hypothetical protein

0.555

(0.031)

  
 

YPTB0832 (corE)

YPO3297

putative membrane protein

1.401

(0.011)

  
 

YPTB0839 (dcuB)

YPO3288

anaerobic C4-dicarboxylate transporter (pseudogene. F/S)

0.442

(0.001)

  
 

YPTB0878

or0629

5-methylthioribose kinase

1.955

(0.029)

  
 

YPTB0929 (yajC)

YPO3190

putative membrane protein

1.526

(0.047)

  
 

YPTB0965

YPO3151

conserved hypothetical protein

  

1.553

(0.047)

 

YPTB1061 (yapC)

YPO2796

putaive autotransporter protein

1.82

(0.003)

  
 

YPTB1111

YPO2618

conserved hypothetical protein

0.577

(0.001)

  
 

YPTB1155

YPO1120

conserved hypothetical protein

1.404

(0.003)

  
 

YPTB1159 (tolB)

YPO1124

TolB colicin import protein

1.46

(0.025)

  
 

YPTB1194

YPO1163

putative membrane protein

  

0.678

(< 0.001)

 

YPTB1210

or4494

possible ABC transporter multidrug efflux pump. permease subunit

0.669

(0.03)

  
 

YPTB1321

YPO1289

conserved hypothetical protein

1.662

(0.026)

  
 

YPTB1335 (psaB)

YPO1304

chaperone protein PsaB precursoR

0.216

(< 0.001)

  
 

YPTB1512

YPO1496

putative heme-binding protein

2.456

(< 0.001)

  
 

YPTB1513

YPO1497

ABC transporter ATP-binding protein

1.878

(0.009)

0.453

(0.001)

 

YPTB1540 (ysuF)

YPO1528

putative ferric iron reductase

4.019

(< 0.001)

  
 

YPTB1646 (hpaC)

YPO1770

4-hydroxyphenylacetate 3-monooxygenase coupling protein

1.613

(0.023)

  
 

YPTB1660

YPO1784

putative copper resistance protein

3.934

(< 0.001)

0.703

(0.017)

 

YPTB1680 (flgJ)

YPO1807

flagellar protein FlgJ

  

1.906

(0.01)

 

YPTB1693

YPO1820A

   

2.053

(0.011)

 

YPTB1695 (fliN)

YPO1822

flagellar motor switch protein FliN

  

1.79

(0.021)

 

YPTB1728 (wrbA)

YPO1857

trp repressor binding protein

1.401

(0.006)

  
 

YPTB1733 (ydgC)

YPO1863

putative membrane protein

0.626

(0.001)

  
 

YPTB1919

YPO1920

probable fimbrial usher protein

  

1.461

(0.019)

 

YPTB1944

YPO1946

ABC transporter. ATP-binding protein

1.957

(0.003)

1.588

(0.03)

 

YPTB1985

YPO1993

putative dehydrogenase

  

1.586

(0.007)

 

YPTB2019

YPO2037

conserved hypothetical protein

1.56

(0.021)

  
 

YPTB2101 (hns)

YPO2175

Hns DNA binding protein

  

0.405

(0.001)

 

YPTB2169

or1554

putative toxin transport protein (pseudogene. F/S)

1.549

(0.027)

  
 

YPTB2289

YPO2375

putative aldo/keto reductase

1.508

(0.006)

  
 

YPTB2291

YPO2377

putative membrane protein

0.607

(0.018)

1.529

(0.038)

 

YPTB2345 (marC)

YPO2437

multiple antibiotic resistance protein

1.771

(0.022)

  
 

YPTB2368 (ogl)

YPO1713

oligogalacturonate lyase

0.699

(0.045)

  
 

YPTB2390

YPO1689

putative lipoprotein

1.312

(0.032)

  
 

YPTB2452 (ycfL)

YPO1612

putative lipoprotein

1.45

(0.046)

  
 

YPTB2459

or3719

hypothetical

0.379

(< 0.001)

  
 

YPTB2471 (fabG)

YPO1599

3-oxoacyl-[acyl-carrier protein] reductase

  

0.573

(0.002)

 

YPTB2488

YPO2451

conserved hypothetical protein

  

0.671

(0.026)

 

YPTB2492

or3693

conserved hypothetical protein

0.602

(0.009)

  
 

YPTB2553

or3647

conserved hypothetical protein

0.573

(0.006)

  
 

YPTB2604

or3598

conserved hypothetical (pseudogene. F/S)

1.86

(0.004)

  
 

YPTB2646 (ccmD)

or3557

putative heme exporter protein D

0.36

(< 0.001)

  
 

YPTB2722

YPO3001

putative pyridine nucleotide-disulphide oxidoreductase

  

1.897

(0.04)

 

YPTB2723

YPO3002

putative permease

1.328

(0.036)

  
 

YPTB2727

YPO3007

putative membrane protein

1.932

(0.008)

  
 

YPTB2753

YPO3031

putative acetyltransferase

1.391

(0.02)

  
 

YPTB2837 (engA)

YPO2875

putative GTP-binding protein

0.573

(0.015)

  
 

YPTB2843

YPO2881

putative fimbrial biogenesis protein

  

0.686

(0.022)

 

YPTB2891 (lepB)

YPO2717

signal peptidase I

1.527

(0.032)

1.518

(0.035)

 

YPTB2902

YPO2706

conserved hypothetical protein

0.549

(0.026)

1.898

(0.018)

 

YPTB3116

or3203

hypothetical protein

  

0.556

(0.022)

 

YPTB3176

YPO0900

putative hemolysin III

  

1.415

(0.038)

 

YPTB3223

YPO0951

Putative methyltransferase

  

0.612

(0.023)

 

YPTB3238

YPO0966

putative kinase

0.505

(0.032)

  
 

YPTB3285

or3082

Putative autotransporter secreted protein

  

1.593

(0.028)

 

YPTB3291

YPO0771

ABC-transporter transmembrane protein

1.705

(0.014)

  
 

YPTB3357

YPO0704

flagellar assembly protein

0.611

(0.049)

  
 

YPTB3381

YPO0684

putative membrane protein

  

1.67

(0.014)

 

YPTB3382 (exbD)

YPO0683

ExbD/TolR-family transport protein

9.812

(< 0.001)

  
 

YPTB3383 (exbB)

YPO0682

MotA/TolQ/ExbB proton channel family protein

4.164

(< 0.001)

  
 

YPTB3388

YPO0676

putative aldo/keto reductase family protein

  

1.632

(0.042)

 

YPTB3438

YPO0617

putative membrane protein

1.993

(0.004)

  
 

YPTB3464

YPO0595

conserved hypothetical protein

0.528

(0.005)

  
 

YPTB3493

YPO3548

putative exported protein

0.602

(0.005)

  
 

YPTB3496

YPO3551

putative exported protein

  

0.553

(< 0.001)

 

YPTB3558 (tldD)

YPO3672

putative modulator of DNA gyrase

  

0.702

(0.025)

 

YPTB3568

YPO3662

conserved hypothetical protein

  

1.489

(0.008)

 

YPTB3659

YPO0247

putative transferase

1.289

(0.029)

  
 

YPTB3745 (gph)

YPO0156

phosphoglycolate phosphatase

0.596

(0.022)

  
 

YPTB3757

YPO0144

putative hydrolase

1.58

(0.013)

  
 

YPTB3879

or2640

possible type I restriction enzyme (restriction subunit)

1.554

(0.044)

  
 

YPTB3896

YPO4044

fimbrial protein

  

1.644

(0.021)

 

YPTB3939

YPO4093

putative haloacid dehalogenase-like hydrolase

1.753

(0.02)

  
 

YPTB3948 (yidC)

YPO4102

probable membrane protein

0.666

(0.024)

0.645

(0.016)

 

YPTB3953 (yieG)

YPO4107

Xanthine/uracil permeases family protein

0.638

(0.046)

1.583

(0.042)

S: function unknown

 

YPTB0015 (mobA)

YPO0013A

molybdopterin-guanine dinucleotide biosynthesis protein A

  

0.703

(0.032)

 

YPTB0020

YPO0020

conserved hypothetical protein

0.493

(< 0.001)

  
 

YPTB0040

YPO0043

conserved hypothetical protein

0.705

(0.029)

0.656

(0.011)

 

YPTB0089

YPO0093

conserved hypothetical protein

1.682

(< 0.001)

0.681

(0.008)

 

YPTB0196

or0133

conserved hypothetical protein

  

3.061

(< 0.001)

 

YPTB0219

YPO3816A

   

1.383

(0.046)

 

YPTB0296

YPO3732

conserved hypothetical protein

  

0.558

(< 0.001)

 

YPTB0378

YPO0323

conserved hypothetical protein

1.483

(0.016)

  
 

YPTB0454

YPO3522

conserved hypothetical protein

1.472

(0.03)

  
 

YPTB0478

YPO3498

conserved hypothetical protein

0.734

(0.038)

  
 

YPTB0506

or0367

conserved hypothetical protein

0.541

(0.013)

  
 

YPTB0547

YPO0407

conserved hypothetical protein

  

1.999

(< 0.001)

 

YPTB0589

YPO0445

conserved hypothetical protein

  

1.579

(0.007)

 

YPTB0600 (creA)

YPO0457

putative exported protein

1.924

(< 0.001)

  
 

YPTB0627

YPO0485

putative membrane protein

  

1.523

(0.018)

 

YPTB0639

YPO0498

hypothetical protein

  

0.302

(< 0.001)

 

YPTB0640

YPO0499

hypothetical protein

   

(< 0.001)

 

YPTB0641

YPO0500

conserved hypothetical protein

   

(< 0.001)

 

YPTB0642

YPO0501

conserved hypothetical protein

  

0.346

(< 0.001)

 

YPTB0643

YPO0502

conserved hypothetical protein

   

(< 0.001)

 

YPTB0644

YPO0503

conserved hypothetical protein

  

0.702

(0.012)

 

YPTB0646

YPO0505

conserved hypothetical protein

  

0.355

(< 0.001)

 

YPTB0648

YPO0507

conserved hypothetical protein

  

0.679

(0.044)

 

YPTB0649a

YPO0508

hypothetical protein

  

0.56

(0.031)

 

YPTB0650

YPO0510

hypothetical protein

1.447

(0.043)

0.368

(< 0.001)

 

YPTB0653

YPO0512

putative lipoprotein

1.45

(0.035)

0.618

(0.009)

 

YPTB0654

YPO0513

conserved hypothetical protein

  

0.364

(0.002)

 

YPTB0655

YPO0514

putative OmpA-family membrane protein

  

0.383

(< 0.001)

 

YPTB0679

YPO0546

conserved hypothetical protein

1.35

(0.036)

  
 

YPTB0701

YPO3431

conserved hypothetical protein

0.663

(< 0.001)

  
 

YPTB0744

YPO3387

conserved hypothetical protein

2.792

(< 0.001)

  
 

YPTB0876

or0627

methionine salvage pathway enzyme E-2/E-2'

  

1.533

(0.007)

 

YPTB0976 (ybaY)

YPO3140

putative lipoprotein

  

1.504

(0.043)

 

YPTB1021

YPO3087

conserved hypothetical protein

  

1.394

(0.029)

 

YPTB1057

YPO2801

putative membrane protein

1.682

(0.044)

  
 

YPTB1078

YPO2585

putative carbohydrate kinase

  

1.704

(0.035)

 

YPTB1085

YPO2592

putative membrane protein

  

0.609

(0.015)

 

YPTB1161

YPO1126

putative exported protein

  

0.596

(0.004)

 

YPTB1215

YPO1174

hypothetical protein

  

1.527

(0.047)

 

YPTB1222

YPO1181

putative membrane protein

  

0.697

(0.032)

 

YPTB1227

YPO1186

conserved hypothetical protein

0.634

(0.005)

  
 

YPTB1297

YPO1261

conserved hypothetical protein

  

0.659

(0.014)

 

YPTB1387

YPO1361

putative membrane protein

1.593

(0.003)

  
 

YPTB1389

YPO1363

putative virulence factoR

0.632

(0.043)

  
 

YPTB1422

YPO1397

conserved hypothetical protein (pseudogene. inframe deletion)

  

1.803

(0.012)

 

YPTB1432

YPO1408

putative exported protein

0.671

(0.044)

  
 

YPTB1499

YPO1483

hypothetical protein

1.491

(0.029)

  
 

YPTB1504

YPO1487

conserved hypothetical protein

2.062

(0.005)

  
 

YPTB1571

YPO1560

conserved hypothetical protein

1.34

(0.036)

  
 

YPTB1640 (hpaD)

YPO1764

3.4-dihydroxyphenylacetate 2.3-dioxygenase

0.625

(0.046)

  
 

YPTB1729

YPO1858

putative exported protein

0.704

(0.037)

  
 

YPTB1901

or1366

conserved hypothetical protein

1.511

(0.01)

  
 

YPTB1902

YPO1882

conserved hypothetical protein

1.552

(< 0.001)

  
 

YPTB1941

YPO1943

putative membrane protein

2.118

(0.004)

  
 

YPTB2085

YPO2159

conserved hypothetical protein

0.606

(0.032)

  
 

YPTB2146

YPO2224

putative membrane protein

  

1.568

(0.018)

 

YPTB2214

YPO2291

putative virulence factoR

0.638

(0.023)

  
 

YPTB2234

YPO2315

putative exported protein

1.503

(0.008)

  
 

YPTB2265

YPO2347

putative membrane protein

1.284

(0.04)

  
 

YPTB2314

YPO2404

conserved hypothetical protein

2.602

(< 0.001)

  
 

YPTB2352

YPO2444

conserved hypothetical protein

0.704

(0.017)

  
 

YPTB2388

YPO1693

conserved hypothetical protein

1.569

(0.038)

  
 

YPTB2444 (ycfJ)

YPO1624

putative exported protein

2.296

(0.001)

  
 

YPTB2481

YPO1588

conserved hypothetical protein

  

0.759

(0.035)

 

YPTB2526

YPO2489

conserved hypothetical protein

  

1.361

(0.02)

 

YPTB2547

YPO2510

putative exported protein

0.31

(< 0.001)

  
 

YPTB2594

YPO2563

conserved hypothetical protein

0.563

(< 0.001)

  
 

YPTB2638

YPO2745

conserved hypothetical protein

0.483

(0.001)

  
 

YPTB2651 (lemA)

YPO2732

putative exported protein

0.381

(< 0.001)

  
 

YPTB2660

YPO2724

putative membrane protein

1.486

(0.038)

  
 

YPTB2661

YPO2723

possible OmpA family (pseudogene. IS100 insertion)

  

1.796

(0.048)

 

YPTB2674

YPO2949

hypothetical protein

1.753

(0.045)

  
 

YPTB2693

YPO2970

putative lipoprotein

  

0.65

(0.049)

 

YPTB2694

YPO2971

putative lipoprotein

  

0.454

(< 0.001)

 

YPTB2745 (ygiW)

YPO3027

putative exported protein

  

0.648

(0.002)

 

YPTB2907

YPO2701

putative membrane protein

  

0.658

(0.038)

 

YPTB2981

YPO1065

conserved hypothetical protein

  

0.721

(0.035)

 

YPTB3117

YPO0874

hypothetical protein

0.675

(0.039)

  
 

YPTB3161

or2087

Hypothetical bacteriophage protein.

  

0.64

(0.033)

 

YPTB3186

YPO0911

putative exported protein

  

1.578

(0.023)

 

YPTB3187

YPO0912

conserved hypothetical protein

  

0.612

(0.006)

 

YPTB3206

YPO0934

conserved hypothetical protein

0.69

(0.039)

  
 

YPTB3222

YPO0950

conserved hypothetical protein

  

0.547

(0.006)

 

YPTB3301

or2158

putative antigenic leucine-rich repeat protein

  

0.581

(0.004)

 

YPTB3403

YPO0659

conserved hypothetical protein

0.768

(0.028)

0.753

(0.019)

 

YPTB3429

YPO0626

Conserved hypothetical

0.619

(0.034)

  
 

YPTB3468 (hdeD)

YPO0590

putative membrane protein

0.209

(< 0.001)

  
 

YPTB3484

YPO0572

putative exported protein

  

0.533

(0.013)

 

YPTB3485 (yqjD)

YPO0570

putative membrane protein

0.674

(0.02)

0.576

(0.002)

 

YPTB3486

YPO0569A

 

0.606

(0.026)

  
 

YPTB3510

YPO3565

putative membrane protein

  

0.745

(0.02)

 

YPTB3573 (panF)

YPO3657A

sodium/pantothenate symporteR

  

0.732

(0.028)

 

YPTB3581

YPO3649

putative gamma carboxymuconolactone decarboxylase

0.573

(0.01)

  
 

YPTB3617

or2852

putative Rhs accessory genetic element

0.632

(0.037)

  
 

YPTB3622

YPO3607

conserved hypothetical protein

  

0.589

(0.014)

 

YPTB3748

YPO0153

conserved hypothetical membrane protein

  

0.614

(0.033)

 

YPTB3773

YPO0127

conserved hypothetical protein

2.928

(< 0.001)

  
 

YPTB3897

YPO4045

putative membrane protein

  

0.609

(0.015)

T: signal transduction mechanisms

 

YPTB0022 (ntrC)

YPO0022

nitrogen regulation protein

  

0.723

(0.037)

 

YPTB0035 (spoT)

YPO0038

guanosine-3'.5'-bisbis(diphosphate) 3'-pyrophosphydrolase

0.684

(0.011)

  
 

YPTB0071 (cpxP)

YPO0075

putative exported protein

  

0.337

(< 0.001)

 

YPTB0356 (terD)

YPO0298

tellurium resistance protein

1.485

(0.034)

  
 

YPTB0357 (terE)

YPO0299

tellurium resistance protein

1.501

(0.005)

0.72

(0.019)

 

YPTB0468 (basS)

YPO3508

two-component system sensor protein

  

2.184

(0.001)

 

YPTB0541

YPO0401

putative transcriptional regulatoR

0.652

(0.035)

  
 

YPTB0570 (hmsT)

YPO0425

HmsT protein

0.574

(0.014)

1.64

(0.026)

 

YPTB0592

YPO0449

putative exported protein

  

0.591

(0.022)

 

YPTB0601 (arcA)

YPO0458

aerobic respiration control protein

0.465

(0.001)

  
 

YPTB0734 (dksA)

YPO3397

DnaK suppressor protein homologue

  

0.508

(< 0.001)

 

YPTB0789

YPO3343

probable extracellular solute-binding protein

0.462

(0.001)

  
 

YPTB1108 (glnH)

YPO2615

putative amino acid-binding protein precursoR

0.564

(0.005)

  
 

YPTB1258 (rcsB)

YPO1218

probable two component response regulator component B

  

0.693

(0.016)

 

YPTB1259

YPO1219

putative two component sensor kinase

  

0.696

(0.041)

 

YPTB1922

YPO1923

Putative sensor protein

  

1.451

(0.044)

 

YPTB1957 (narX)

YPO1959

nitrate/nitrite sensor protein

1.83

(0.031)

  
 

YPTB2099

YPO2173

probable response regulatoR

  

1.533

(0.043)

 

YPTB2156 (cstA)

YPO2234

putative carbon starvation protein A

0.544

(0.012)

0.624

(0.045)

 

YPTB2222 (fnr)

YPO2300

fumarate and nitrate reduction regulatory protein

0.699

(0.001)

1.584

(< 0.001)

 

YPTB2230 (rstA)

YPO2308

two-component regulatory system. response regulator protein

0.658

(0.024)

  
 

YPTB2378

YPO1703

conserved hypothetical protein

  

0.711

(0.022)

 

YPTB2396 (cheZ)

YPO1681

chemotaxis protein CheZ

  

1.477

(0.027)

 

YPTB2405 (cheA)

YPO1666

chemotaxis protein CheA

1.725

(0.015)

  
 

YPTB2435 (phoQ)

YPO1633

sensor protein kinase

0.527

(< 0.001)

  
 

YPTB2548 (glnH)

YPO2511

putative glutamine-binding periplasmic protein

  

1.797

(0.014)

 

YPTB2635 (sixA)

YPO2748

putative phosphohistidine phosphatase

  

1.508

(0.002)

 

YPTB2763 (narP)

YPO3041

nitrate/nitrite response regulator protein NarP

  

0.715

(0.043)

 

YPTB2894 (rseC)

YPO2714

sigma E factor regulatory protein

  

1.431

(0.034)

 

YPTB2895 (rseB)

YPO2713

sigma E factor regulatory protein

  

1.466

(0.04)

 

YPTB2896 (rseA)

YPO2712

sigma E factor negative regulatory protein

  

1.652

(< 0.001)

 

YPTB3350 (fleR)

YPO0712

sigma-54 transcriptional regulatory protein

2.134

(0.004)

  
 

YPTB3408 (glnE)

YPO0653

glutamate-ammonia-ligase adenylyltransferase

1.792

(0.046)

  
 

YPTB3410

YPO0651

putative exported protein

1.988

(< 0.001)

  
 

YPTB3463 (terX)

YPO0596

putative tellurium resistance protein

0.522

(< 0.001)

  
 

YPTB3500 (arcB)

YPO3555

aerobic respiration control sensor/response regulatory protein

0.674

(0.012)

  
 

YPTB3566 (yhdA)

YPO3664

putative exported protein

  

1.836

(< 0.001)

 

YPTB3729 (crp)

YPO0175

cAMP-regulatory protein

  

0.641

(< 0.001)

 

YPTB3812 (uspA)

YPO3970

universal stress protein A

0.291

(< 0.001)

1.554

(0.038)

 

YPTB3847 (uhpA)

YPO4012

two-component system response regulatoR

  

2.004

(0.006)

 

YPTB3957

YPO4111

putative periplasmic solute-binding protein

1.59

(0.006)

  
 

YPTB2341 (infC)

YPO2432

translation initiation factor IF-3

  

0.539

(< 0.001)

Table 3

Y. pseudotuberculosis IP32953 pYV plasmid-harbored genes that are transcriptionally regulated by growth medium and/or temperature.

   

Fold ratio in gene transcription (p-value)

Gene designation

Genoscript spot ID

Gene product/function

Human plasma/Luria Bertani Broth

37°C/28°C

pYV0013

pCD1-yadA

hypothetical protein

13.528

(< 0.001)

1.577

(0.046)

pYV0014

pCD1-AAC62595

possible transposase remnant

1.789

(0.025)

1.884

(0.016)

pYV0017

pCD1-tnpR

putative resolvase

0.341

(< 0.001)

  

pYV0020

pCD1-sycH

putative YopH targeting protein

5.088

(< 0.001)

2.715

(< 0.001)

pYV0024

pCD1-sycE

putative YopE chaperone

5.781

(< 0.001)

2.403

(0.005)

pYV0040

pCD1-yopK/yopQ

Yop targeting protein YopK, YopQ

  

1.666

(0.019)

pYV0047

pCD1-yopM

putative targeted effector protein

3.468

(< 0.001)

2.252

(0.002)

pYV0054

pCD1-yopD

putative Yop negative regulation/targeting component

2.933

(< 0.001)

2.211

(0.004)

pYV0055

pCD1-yopB

putative Yop targeting protein

2.816

(< 0.001)

2.196

(< 0.001)

pYV0056

pCD1-lcrH

low calcium response protein H

3.522

(< 0.001)

1.851

(0.021)

pYV0057

pCD1-lcrV

putative V antigen, antihost protein/regulator

1.904

(< 0.001)

1.637

(0.003)

pYV0058

pCD1-lcrG

putative Yop regulator

1.713

(0.014)

  

pYV0059

pCD1-lcrR

hypothetical protein LcrR

1.469

(0.001)

1.849

(< 0.001)

pYV0062

pCD1-yscX

putative type III secretion protein

1.629

(0.009)

1.533

(0.020)

pYV0065

pCD1-yopN

putative membrane-bound Yop targeting protein

2.612

(< 0.001)

1.549

(0.049)

pYV0067

pCD1-yscN

putative Yops secretion ATP synthase

2.856

(< 0.001)

1.717

(0.002)

pYV0068

pCD1-yscO

putative type III secretion protein

3.088

(< 0.001)

  

pYV0069

pCD1-yscP

putative type III secretion protein

  

1.593

(0.018)

pYV0070

pCD1-yscQ

putative type III secretion protein

1.635

(0.026)

  

pYV0071

pCD1-yscR

putative Yop secretion membrane protein

1.949

(0.012)

  

pYV0072

pCD1-yscS

putative type III secretion protein

2.331

(< 0.001)

1.897

(0.002)

pYV0075

pCD1-virG

putative Yop targeting lipoprotein

1.957

   

pYV0076

pCD1-lcrF/virF

putative thermoregulatory protein

1.441

(0.042)

  

pYV0078

pCD1-yscB

hypothetical protein

3.038

(0.002)

  

pYV0079

pCD1-yscC

putative type III secretion protein

2.384

(0.001)

2.713

(< 0.001)

pYV0080

pCD1-yscD

putative type III secretion protein

2.542

(< 0.001)

1.990

(0.005)

pYV0081

pCD1-yscE

putative type III secretion protein

2.711

(0.001)

1.809

(0.032)

pYV0082

pCD1-yscF

putative type III secretion protein

2.117

(0.017)

  

pYV0083

pCD1-yscG

putative type III secretion protein

2.463

(< 0.001)

  

pYV0085

pCD1-yscI

putative type III secretion protein

1.864

(0.003)

  

pYV0089

pCD1-yscM

putative type III secretion regulatory protein

0.679

(0.036)

  
Free iron limitation is a well-known stimulus encountered by bacteria in plasma [10, 11]. As expected, IP32953 genes required for iron storage (such as the ferritin-encoding gene ftnA [12] (Fig. 1)) were found to be downregulated in plasma. Transcriptional upregulation of most iron uptake systems (along with accessory protein-encoding genes tonB, exbB and exbD) (Fig. 1) is also consistent with this condition and is in agreement with the recent findings in Y. pestis [8]. As iron is used as a cofactor by numerous enzymes (mostly when complexed with sulfur), the metal is essential for a broad range of metabolic processes. Besides activation of iron homeostasis systems, lack of iron is also expected to be associated with a dramatic decrease in the transcription of genes encoding such enzymes, with the underlying goal of lowering iron consumption. This situation is exemplified by the katA gene that encodes catalase (a ferric enzyme involved in oxidative stress defense), whose transcription is decreased in both Y. pestis and Y. pseudotuberculosis during growth in plasma (Fig. 1). However, the increase in transcription of the bio locus (required for biotin synthesis [13]) and observed in both species) suggests that differential genetic control of a subset of iron-dependent enzymes may favor supply of this metal to the pathways that are most important for bacterial survival (and thus presumably at the expense of other, less critical ones). Furthermore, the impact of transcriptional downregulation on reorientation of metabolic fluxes may be minimized by the concomitant activation of genes coding for isoenzymes that are better suited to this situation.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-8-211/MediaObjects/12866_2008_Article_644_Fig1_HTML.jpg
Figure 1

Medium- and temperature-dependent differential expression of Y. pseudotuberculosis chromosomal genes involved in virulence and/or iron uptake & storage. Significant (p < 0.05) upshifts (yellow to red scale) or downshifts (blue scale) in individual gene transcription levels when bacteria were grown in human plasma versus LB (triangles) and/or at 37°C versus 28°C (squares) are indicated by the color scale bar. Genes encoding iron uptake/storage systems, virulence factors and their regulators are symbolized by gray, white and black arrows, respectively. Nomenclature used for gene designation correspond to the Y. pseudotuberculosis IP32953 genome annotation. Mean fold changes in transcription and p-values are indicated in Table 2.

One example is that of the manganese- and iron-dependent superoxide dismutase genes (i.e sodA and sodB), which are Fur-activated and -repressed, respectively (Fig. 1) in both Y. pestis and Y. pseudotuberculosis. Similarly, the class Ib ribonucleotide reductase (RNR)-encoding genes (nrdHIEF) are probably important for bacterial life in plasma, since they were found to be upregulated at the expense of those in classes III (nrdDG) and Ia (nrdAB) (Table 2) – even though all three classes are equally involved in generating the synthetic precursors for DNA. The fact that only the first class is Fur-activated [14] is consistent with this observation. Similar variations have also been recorded in Y. pestis [8]. However, whereas purine/pyrimidine metabolism has been shown to be essential for Y. pestis virulence [15], the role of this metabolic pathway in the physiopathology of Y. pseudotuberculosis has not yet been investigated. Along with class 1b RNRs, more than half of the enzymes in the tricarboxylic acid cycle (TCA) are known to be catalytically iron-dependent and/or believed to be transcriptionally activated by Fur [16]. Accordingly, and in line with transcriptome data from Y. pestis, we observed that transcription of these genes fell significantly when Y. pseudotuberculosis was grown in plasma.

In contrast to the low availability of iron in blood, glucose is readily available in this biological fluid and at a higher concentration (approx. 7 mM) than in LB broth. When Y. pseudotuberculosis was cultured in plasma, genes involved in glycolysis and the upstream, sugar-supplying, phosphoenolpyruvate-dependent systems were found to be upregulated, as depicted in Fig. 2. This finding is reminiscent of an aerobic phenomenon referred to as "glucose overflow metabolism"; this consists in channeling the carbon flow towards acetate formation instead of citrate formation, in order to prevent the excessive accumulation of NADH that would otherwise result from very high glucose consumption rates [17]. However, one main feature of glucose overflow in E. coli is acetate accumulation due to a strong transcriptional repression of the glyoxylate shunt aceBAK operon [18]. Interestingly, at least the first two of these genes are not down- but are up-regulated in Y. pseudotuberculosis (Fig. 2, Additional file 1), suggesting a need for this species to limit acetate overloads. The continuous de-repression of these genes (due to inactivation of the IclR repressor) suggests that this might also be the case in Y. pestis. These pathways are controlled by complex and finely balanced networks involving numerous pleiotropic regulators, including Fur, Crp, Fnr and ArcA [16, 19]. This unexpected upregulation may well result from the combination of both high glucose and low iron levels in plasma. Whether this occurs through the strong transcriptional repression observed with both fnr and arcA remains to be addressed in future experiments.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-8-211/MediaObjects/12866_2008_Article_644_Fig2_HTML.jpg
Figure 2

Medium-dependent differential expression of genes coding for enzymes putatively involved in Y. pseudotuberculosis glycolysis and the tricarboxylic acid cycle (TCA cycle). Significant (p < 0.05) upshifts (yellow to red scale) or downshifts (blue scale) in individual gene transcription levels in human plasma versus LB is indicated by the color scale bar. Open boxes indicate genes whose expression levels did not vary significantly (p > 0.05). Although considered as not significant by statistical analysis of macroarray data (p = 0.053), transcriptional upregulation of aceB in human plasma was confirmed by qRT-PCR. Abbreviations: Ac-CoA: acetyl coenzyme A; PEP: phosphoenolpyruvate. Mean fold changes in transcription and p-values are indicated in Table 2.

Temperature upshift is typically considered to be the main signal indicating to bacteria that they have entered the host; this hypothesis is supported by the thermal dependency of almost all Y. pseudotuberculosis virulence genes and also many of the latter's regulators [3]. Several of these genes were also found to be influenced by growth in plasma and the changes were sometimes in the opposite direction to those seen with temperature upshifts: whereas expression of the invasin-encoding gene inv was significantly repressed during bacterial growth under both conditions, transcription of psaA (coding for the pH6 antigen) was promoted by temperature upshifts [6, 20], but was one of the most strongly repressed in plasma. Interestingly, the impact of this medium on psaA transcription was not considered to be significant in Y. pestis and suggests that the pH6 antigen does not have the same importance in blood dissemination in the two species. In contrast to the latter two adhesins, transcriptional activation of yadA (harbored by the pYV plasmid and involved in adhesion) was found to be the highest of all the Y. pseudotuberculosis genes induced under plasma growth conditions. This observation is consistent with YadA's involvement in microbial resistance to complement [21, 22]. Similarly, ompC whose product is believed to be targeted by lactoferricin [23], a bactericidal peptide derived from lactoferrin by enzymatic cleavage [24], is strongly repressed, whilst no significant modification was observed for the outer membrane-encoding genes ompA and ompC 2.

Lastly, an essential determinant of bacterial virulence is the plasmid-encoded type III secretion system (TTSS) which performs intracellular delivery of a set of Yersinia outer proteins (Yops) that subvert the host's defenses [25]. Interestingly, Y. pseudotuberculosis growth in plasma induced the upregulation of 25 genes required for secretion, translocation and chaperoning of the Yop effector proteins in a similar fashion to that observed upon temperature upshift (Fig. 3). Furthermore, the apparently coordinated regulation of yadA and the TTSS-encoding genes by temperature and growth in plasma suggests the involvement of a common means of genetic control. YmoA (a chromatin-associated (histone-like) protein which is very similar in structure and function to the haemolysin expression modulating protein Hha from Escherichia coli) was shown to negatively influence YadA and Yop expression by favoring supercoiling of the pYV plasmid [26]. A two-fold reduction in ymoA transcription in plasma may be enough to contribute to the TTSS upregulation recorded in Y. pseudotuberculosis. Strikingly, this plasma-induced TTSS activation was not observed in Y. pestis, since only 3 out of the 25 genes mentioned above were found to be upregulated (in line with the statistically non-significant downregulation of ymoA); this raises the possibility that these two pathogenic Yersinia species may differ in their transcriptional regulation of pYV-harbored virulence genes.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-8-211/MediaObjects/12866_2008_Article_644_Fig3_HTML.jpg
Figure 3

Medium- and temperature-dependent differential expression of genes harbored by the Y. pseudotuberculosis virulence plasmid pYV. Significant (p < 0.05) upshifts (yellow to red scale) or downshifts (blue scale) in individual gene transcription levels when bacteria were grown in human plasma versus LB (triangles) and/or at 37°C versus 28°C (squares) are indicated by the color scale bar. Only genes spotted on the macroarray (56 out of 99 pYV-borne genes) are shown and those encoding the secretion apparatus and Yop effectors are represented by grey and black boxes, respectively. Mean fold changes in transcription and p-values are indicated in Table 3.

Conclusion

Overall transcription profiling of Y. pseudotuberculosis grown in an environment mimicking the blood stage of the infectious process revealed gene regulations that could not be anticipated from the results of previously reported single-stimulus studies. Our findings thus provide insight into how a number of simultaneously sensed environmental cues may be taken into account by the bacterium in a hierarchical manner. Furthermore, comparison of our analyses with those previously performed in Y. pestis suggests that transcription of common critical virulence factors may be differently influenced (at least in part) by the plasma environment in these two species.

Methods

DNA macroarray construction

Pairs of specific oligonucleotide primers were designed with the Primer 3 software for each of the 3,951 Y. pseudotuberculosis IP32953 CDSs. In order to avoid cross-hybridization, the specificity of the PCR products relative to the complete genome sequence was tested with CAAT-box software [27]. Primers purchased from Eurogentec were chosen in order to specifically amplify a ≈ 400 to 500 base pair (bp) fragment of each open reading frame (ORF), with a melting temperature of 51 to 60°C. Amplification reactions were performed in 96-well plates (Perkin-Elmer) in a 100 μl reaction volume containing 100 ng of Y. pseudotuberculosis IP32953 DNA, DNA polymerase (Dynazyme, New England Biolabs), 10 μM of each primer and 2 mM dNTPs (Perkin-Elmer). Reactions were cycled 45 times (94°C for 30 s; 60°C for 30 s; 72°C for 60 s) with a final cycle of 72°C for 7 min in a thermocycler. Each PCR product was checked by agarose gel electrophoresis and when DNA amplification was unsuccessful, PCR was repeated with another primer set. Overall, 3,951 of the 3,994 CDSs (98%) identified in the Y. pseudotuberculosis IP32953 genome were successfully amplified under our experimental conditions. ORF-specific PCR products, luciferase DNA (10 to 100 ng) and total genomic DNA from strain IP32953 were spotted onto 22 × 7-cm nylon membranes (Genetix) using a Qpix robot (Genetix). Immediately following spot deposition, membranes were immersed for 15 min in 0.5 M NaOH and 1.5 M NaCl, washed three times with distilled water and stored at -20°C until use. To ensure that DNA samples were successfully deposited on the membranes, 33P-labeled genomic DNA was hybridized to the macroarray before transcriptome analysis.

Bacterial culture

The Y. pseudotuberculosis transcriptome was studied in three independent cultures of strain IP32953 in media aliquoted from a single batch. After storage in Luria-Bertani (LB) broth with 40% glycerol at -80°C, the strain was thawed and then grown on LB agar supplemented with 20 μg ml-1 hemin for 48 h at 28°C. From this culture, 8 × 106 cells were inoculated into 40 ml of either LB broth or pooled human plasma from healthy donors (heated at 56°C for 30 min to ensure complement inactivation). Media were then incubated at 28°C or 37°C with shaking and Yersinia growth was monitored by absorbance at 600 nm.

RNA and cDNA probe preparation

Cells were harvested from exponential-phase cultures (A600 of 0.2–0.4 and 0.1–0.2 for LB and human plasma, respectively) by centrifugation at 4°C and the pelleted bacteria were disrupted with RNAwiz reagent (Ambion). After mixing the lysate with chloroform (0.2 v), total RNA was precipitated from the aqueous phase with glycogen (1/50 v) and isopropanol (1 v). The RNA pellet was washed with 70% ethanol and then dissolved in sterile, DNase- and RNase-free water. Contaminating DNA was removed using the DNA-free kit from Ambion. Nucleic acid purity and integrity was checked with a BioAnalyzer 2100 (Agilent) according to the supplier's instructions. After quantification by spectrophotometry at 260 and 280 nm, the RNA solution was stored at -80°C until use. cDNA was further generated from 10 μg of total RNA incubated (in a total volume reaction of 45 μl) for 3 h at 42°C with 50 U AMV reverse transcriptase (Roche), 0.35 pmol. of each amplified CDS-specific 3' oligonucleotide primer, 222 μM dATP, dGTP & dTTP, 2.2 μM dCTP and 50 μCi 33P-labelled dCTP (Amersham Biosciences). Labeled cDNA was purified to remove unincorporated nucleotides using DyeEx 2.0 spin column (Qiagen).

DNA macroarray hybridization

Macroarrays were prewetted in 2 × SSPE (0.18 M NaCl, 10 mM NaH2PO4, 1 mM EDTA, pH 7.7) and prehybridized for 1 h in 13 ml of hybridization solution (5 × SSPE, 2% SDS, 1× Denhardt's reagent, 0.1 mg of sheared salmon sperm DNA ml-1) at 65°C in roller bottles. Hybridization was carried out for 20 h at 65°C with 15 ml of hybridization solution containing the purified cDNA probe. After hybridization, membranes were washed three times at room temperature and three times at 65°C for 20 min in 0.5 × SSPE and 0.2% SDS. Probed macroarrays were exposed to a phosphor screen (Molecular Dynamics) for 24–72 h and imaged using a STORM 860 phosphorimager (Amersham Biosciences). The intensity of all of the pixels associated with each spot was further quantified using ArrayVision software (Imaging Research, Grinnel, IA, USA). The experiment design included three biological replicates for each combination of conditions. Data were analyzed using the SAS software (SAS Institute Inc, Cary, NC, USA). They were first log-transformed and normalized with a median normalization. A linear model was then applied on each gene with the temperature, phase and growth medium as fixed effects. The significance level alpha was set to 0.05.

Real-Time Quantitative PCR

Messenger RNAs (mRNAs) were reverse transcribed from 1 μg of nucleic acid by using the High-Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. The resulting cDNA was amplified by the SYBR Green Real-Time PCR Kit and detected on a Prism 7000 detection system (Applied Biosystems). The forward and reverse primers used were as follows: 5'CGCCATCAAATGCGCTAAT3' and 5'TGAGCGGGATCGTGTTCAA3' for yfeA, 5'TCAAGCAGGGAAACACATTCC3' and 5'GGCTGTTTACCCGCAAAAATC3' for psaA, 5'GGTTAGCCGCGAACAGGATA3' and 5'CGCTCGCCAGAACAAGGTT3' for aceB, 5'TCGATGCTCGCGCTAAGG3' and 5'GCTGGTTTCGCTGCTTCAG3' for yadA, 5'GATCCTGGTTCCATAAAAATTATTCAC3' and 5'ATTGTTCGCCTGGATTACCAA3' for yopJ, 5'GAGAATCCCAGTCGGGTGTTAA3' and 5'TCACTGCATCGCGGTAGGT3' for yopN, 5'GACACCAGTGGGACGCAACT3' and 5'GGGTTCACAAGAAAGAGTAACAGCTT3' for sycH, 5'GGTTACGCGCGGGTATCA3' and 5'CCGCGTCTTTGAGTGTTTTG3' for tnpR, 5'TTCTCGTGGGCAACCTATCC3' and 5'TGCGTTCCCAGCATACACAA3' for nlpD. On completion of the PCR amplification, a DNA melting curve analysis was performed to confirm the presence of a single amplicon. Relative mRNA levels (2ΔΔC) were determined by comparing the PCR cycle thresholds (Ct) for the gene of interest and the constitutively expressed YPTB0775 gene (spot ID YPO3356) coding for the outer membrane lipoprotein NlpD.

Abbreviations

qRT-PCR: 

quantitative Real Time Reverse Transcription PCR.

Declarations

Acknowledgements

This work was funded by grant 02 34 021 from the "Délégation Générale pour l'Armement" and grant PTR88 from the Institut Pasteur and the Institut Pasteur de Lille. We gratefully thank Sandrine Rousseau-Moreira (Plate-Forme 4, Institut Pasteur, Paris, France) for technical assistance during the Genoscript data upload process.

Authors’ Affiliations

(1)
Inserm U801, Lille, F-59019, France; Université Lille II (Faculté de Médecine Henri Warembourg)
(2)
Yersinia research Unit, Institut Pasteur
(3)
Plate-Forme 4, Institut Pasteur
(4)
Plate-Forme 2, Institut Pasteur
(5)
Génoscope, 2 rue Gaston Crémieux
(6)
Unité de Prévention et Thérapies Moléculaires des Maladies Humaines, Centre National de Référence de la coqueluche et autres bordetelloses
(7)
Fédération de Biologie, Centre Hospitalier de Roubaix

References

  1. Vincent P, Leclerc A, Martin L, Yersinia Surveillance Network, Duez J-M, Simonet M, Carniel E: Sudden onset of pseudotuberculosis in humans, France, 2004–05. Emerg Infect Dis. 2008Google Scholar
  2. Putzker M, Sauer H, Sobe D: Plague and other human infections caused by Yersinia species. Clin Lab. 2001, 47 (9–10): 453-466.PubMedGoogle Scholar
  3. Marceau M: Transcriptional regulation in Yersinia: an update. Curr Issues Mol Biol. 2005, 7 (2): 151-177.PubMedGoogle Scholar
  4. Darwin AJ: Genome-wide screens to identify genes of human pathogenic Yersinia species that are expressed during host infection. Curr Issues Mol Biol. 2005, 7 (2): 135-149.PubMedGoogle Scholar
  5. Revell PA, Miller VL: Yersinia virulence: more than a plasmid. FEMS Microbiol Lett. 2001, 205 (2): 159-164. 10.1111/j.1574-6968.2001.tb10941.x.View ArticlePubMedGoogle Scholar
  6. Price SB, Freeman MD, Yeh KS: Transcriptional analysis of the Yersinia pestis pH 6 antigen gene. J Bacteriol. 1995, 177 (20): 5997-6000.PubMed CentralPubMedGoogle Scholar
  7. Collyn F, Lety MA, Nair S, Escuyer V, Ben Younes A, Simonet M, Marceau M: Yersinia pseudotuberculosis harbors a type IV pilus gene cluster that contributes to pathogenicity. Infect Immun. 2002, 70 (11): 6196-6205. 10.1128/IAI.70.11.6196-6205.2002.PubMed CentralView ArticlePubMedGoogle Scholar
  8. Chauvaux S, Rosso ML, Frangeul L, Lacroix C, Labarre L, Schiavo A, Marceau M, Dillies MA, Foulon J, Coppée JY, Médigue C, Simonet M, Carniel E: Transcriptome analysis of Yersinia pestis in human plasma: an approach for discovering bacterial genes involved in septicaemic plague. Microbiology. 2007, 153 (9): 3112-3124. 10.1099/mic.0.2007/006213-0.View ArticlePubMedGoogle Scholar
  9. Chain PS, Carniel E, Larimer FW, Lamerdin J, Stoutland PO, Regala WM, Georgescu AM, Vergez LM, Land ML, Motin VL, Brubaker RR, Fowler J, Hinnebusch J, Marceau M, Médigue C, Simonet M, Chenal-Francisque V, Souza B, Dacheux D, Elliott JM, Derbise A, Hauser LJ, Garcia E: Insights into the evolution of Yersinia pestis through whole-genome comparison with Yersinia pseudotuberculosis. Proc Natl Acad Sci USA. 2004, 101 (38): 13826-13831. 10.1073/pnas.0404012101.PubMed CentralView ArticlePubMedGoogle Scholar
  10. Andrews SC, Robinson AK, Rodriguez-Quinones F: Bacterial iron homeostasis. FEMS Microbiol Rev. 2003, 27 (2–3): 215-237. 10.1016/S0168-6445(03)00055-X.View ArticlePubMedGoogle Scholar
  11. Schaible UE, Kaufmann SH: Iron and microbial infection. Nat Rev Microbiol. 2004, 2 (12): 946-953. 10.1038/nrmicro1046.View ArticlePubMedGoogle Scholar
  12. Abdul-Tehrani H, Hudson AJ, Chang YS, Timms AR, Hawkins C, Williams JM, Harrison PM, Guest JR, Andrews SC: Ferritin mutants of Escherichia coli are iron deficient and growth impaired, and fur mutants are iron deficient. J Bacteriol. 1999, 181 (5): 1415-1428.PubMed CentralPubMedGoogle Scholar
  13. Sanyal I, Cohen G, Flint DH: Biotin synthase: purification, characterization as a [2Fe-2S]cluster protein, and in vitro activity of the Escherichia coli bioB gene product. Biochemistry. 1994, 33 (12): 3625-3631. 10.1021/bi00178a020.View ArticlePubMedGoogle Scholar
  14. Nordlund P, Reichard P: Ribonucleotide reductases. Annu Rev Biochem. 2006, 75: 681-706. 10.1146/annurev.biochem.75.103004.142443.View ArticlePubMedGoogle Scholar
  15. Munier-Lehmann H, Chenal-Francisque V, Ionescu M, Chrisova P, Foulon J, Carniel E, Barzu O: Relationship between bacterial virulence and nucleotide metabolism: a mutation in the adenylate kinase gene renders Yersinia pestis avirulent. Biochem J. 2003, 373 (2): 515-522. 10.1042/BJ20030284.PubMed CentralView ArticlePubMedGoogle Scholar
  16. Zhang Z, Gosset G, Barabote R, Gonzalez CS, Cuevas WA, Saier MH: Functional interactions between the carbon and iron utilization regulators, Crp and Fur, in Escherichia coli. J Bacteriol. 2005, 187 (3): 980-990. 10.1128/JB.187.3.980-990.2005.PubMed CentralView ArticlePubMedGoogle Scholar
  17. Vemuri GN, Altman E, Sangurdekar DP, Khodursky AB, Eiteman MA: Overflow metabolism in Escherichia coli during steady-state growth: transcriptional regulation and effect of the redox ratio. Appl Environ Microbiol. 2006, 72 (5): 3653-3661. 10.1128/AEM.72.5.3653-3661.2006.PubMed CentralView ArticlePubMedGoogle Scholar
  18. Veit A, Polen T, Wendisch VF: Global gene expression analysis of glucose overflow metabolism in Escherichia coli and reduction of aerobic acetate formation. Appl Microbiol Biotechnol. 2007, 74 (2): 406-421. 10.1007/s00253-006-0680-3.View ArticlePubMedGoogle Scholar
  19. Perrenoud A, Sauer U: Impact of global transcriptional regulation by ArcA, ArcB, Cra, Crp, Cya, Fnr, and Mlc on glucose catabolism in Escherichia coli. J Bacteriol. 2005, 187 (9): 3171-3179. 10.1128/JB.187.9.3171-3179.2005.PubMed CentralView ArticlePubMedGoogle Scholar
  20. Lindler LE, Klempner MS, Straley SC: Yersinia pestis pH 6 antigen: genetic, biochemical, and virulence characterization of a protein involved in the pathogenesis of bubonic plague. Infect Immun. 1990, 58 (8): 2569-2577.PubMed CentralPubMedGoogle Scholar
  21. El Tahir Y, Skurnik M: YadA, the multifaceted Yersinia adhesin. Int J Med Microbiol. 2001, 291 (3): 209-218. 10.1078/1438-4221-00119.View ArticlePubMedGoogle Scholar
  22. China B, Sory MP, Nguyen BT, Debruyere M, Cornelis GR: Role of the YadA protein in prevention of opsonization of Yersinia enterocolitica by C3b molecules. Infect Immun. 1993, 61 (8): 3129-3136.PubMed CentralPubMedGoogle Scholar
  23. Sallmann FR, Baveye-Descamps S, Pattus F, Salmon V, Branza N, Spik G, Legrand D: Porins OmpC and PhoE of Escherichia coli as specific cell-surface targets of human lactoferrin. Binding characteristics and biological effects. J Biol Chem. 1999, 274 (23): 16107-16114. 10.1074/jbc.274.23.16107.View ArticlePubMedGoogle Scholar
  24. Orsi N: The antimicrobial activity of lactoferrin: current status and perspectives. Biometals. 2004, 17 (3): 189-196. 10.1023/B:BIOM.0000027691.86757.e2.View ArticlePubMedGoogle Scholar
  25. Cornelis GR: The Yersinia Ysc-Yop 'type III' weaponry. Nat Rev Mol Cell Biol. 2002, 3 (10): 742-752. 10.1038/nrm932.View ArticlePubMedGoogle Scholar
  26. Cornelis GR, Sluiters C, Delor I, Geib D, Kaniga K, Lambert de Rouvroit C, Sory MP, Vanooteghem JC, Michiels T: ymoA, a Yersinia enterocolitica chromosomal gene modulating the expression of virulence functions. Mol Microbiol. 1991, 5 (5): 1023-1034. 10.1111/j.1365-2958.1991.tb01875.x.View ArticlePubMedGoogle Scholar
  27. Frangeul L, Glaser P, Rusniok C, Buchrieser C, Duchaud E, Dehoux P, Kunst F: CAAT-Box, Contigs-Assembly and Annotation Tool-Box for genome sequencing projects. Bioinformatics. 2004, 20 (5): 790-797. 10.1093/bioinformatics/btg490.View ArticlePubMedGoogle Scholar
  28. Tatusov RL, Galperin MY, Natale DA, Koonin EV: The COG database: a tool for genome-scale analysis of protein functions and evolution. Nucleic Acids Res. 2000, 28 (1): 33-36. 10.1093/nar/28.1.33.PubMed CentralView ArticlePubMedGoogle Scholar

Copyright

© Rosso et al; licensee BioMed Central Ltd. 2008

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.