Open Access

Real-time PCR assays for genotyping of Cryptococcus gattii in North America

  • Erin J Kelley1Email author,
  • Elizabeth M Driebe1,
  • Kizee Etienne2,
  • Mary E Brandt2,
  • James M Schupp1,
  • John D Gillece1,
  • Jesse S Trujillo1,
  • Shawn R Lockhart2,
  • Eszter Deak2, 3,
  • Paul S Keim1, 4 and
  • David M Engelthaler1
BMC Microbiology201414:125

DOI: 10.1186/1471-2180-14-125

Received: 17 December 2013

Accepted: 6 May 2014

Published: 13 May 2014

Abstract

Background

Cryptococcus gattii has been the cause of an ongoing outbreak starting in 1999 on Vancouver Island, British Columbia and spreading to mainland Canada and the US Pacific Northwest. In the course of the outbreak, C. gattii has been identified outside of its previously documented climate, habitat, and host disease. Genotyping of C. gattii is essential to understand the ecological and geographical expansion of this emerging pathogen.

Methods

We developed and validated a mismatch amplification mutation assay (MAMA) real-time PCR panel for genotyping C. gattii molecular types VGI-VGIV and VGII subtypes a,b,c. Subtype assays were designed based on whole-genome sequence of 20 C. gattii strains. Publically available multilocus sequence typing (MLST) data from a study of 202 strains was used for the molecular type (VGI-VGIV) assay design. All assays were validated across DNA from 112 strains of diverse international origin and sample types, including animal, environmental and human.

Results

Validation revealed each assay on the panel is 100% sensitive, specific and concordant with MLST. The assay panel can detect down to 0.5 picograms of template DNA.

Conclusions

The (MAMA) real-time PCR panel for C. gattii accurately typed a collection of 112 diverse strains and demonstrated high sensitivity. This is a time and cost efficient method of genotyping C. gattii best suited for application in large-scale epidemiological studies.

Keywords

Cryptococcus gattii Genotyping Real-time PCR Epidemiology

Background

Cryptococcosis, a potentially fatal fungal disease, has primarily been observed in immune-compromised individuals and mainly associated with Cryptococcus neoformans infection. It is now recognized that Cryptococcus gattii, once considered to be a variety of the Cryptococcus neoformans complex, is also capable of causing serious disease in immunocompetent individuals and animals [1, 2]. C. gattii has been associated with a number of tree species in tropical and subtropical regions [3]. More recently, C. gattii caused an outbreak that began in 1999 on Vancouver Island, British Columbia and has spread to mainland Canada and the US Pacific Northwest [4]. This outbreak is unique in that it marked the identification of a Cryptococcus species in a new climatic region (from tropical to temperate), habitat (from tropical trees to temperate; e.g., Douglas Fir) and host disease (from primary neurologic to primary pulmonary) [3, 5].

Recent epidemiological studies of C. gattii in North America provide insight into the organism’s geographical expansion as well as the distribution of molecular genotypes [69]. C. gattii has been classically classified into four molecular types by MLST/AFLP, VGI/AFLP4, VGII/AFLP6, VGIII/AFLP5, VGIV/AFLP7 [3, 5], with additional molecular types recently identified [10]. Interestingly, molecular types have been associated with significant differences in disease type [3, 5], antifungal susceptibilities [3, 5, 10], and severity and outcome [3, 5].

Contemporary methods for genotyping C. gattii are PCR-restriction fragment length polymorphism (PCR-RFLP), amplified fragment length polymorphism (AFLP), multilocus microsatellite typing (MLMT), multilocus sequence typing (MLST), and most recent, matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS) [1114]. High resolution melting (HRM) is a method that has been used to identify the Cryptococcus neoformans-Cryptococcus gattii complex, though it has not been employed for genotyping within either species [15]. PCR-RFLP and AFLP require extensive lab work involving restriction enzyme digestion and gel electrophoresis [11]. Results are based on interpretation of gel electrophoresis profiles and as such, are not readily transferred or analyzed between laboratories. MLST, which requires DNA sequencing of seven housekeeping genes, is the preferred genotyping method for C. gattii and is easily transferrable between laboratories [16]. MLMT allows for finer genotype resolution than MLST and has high reproducibility between laboratories [14]. In some laboratories, real-time PCR is a preferable option to methods involving DNA sequencing (MLMT and MLST), which require either out-sourcing to a sequencing capable laboratory or investment in, and the maintenance of, an in-house instrument. Although MALDI-TOF MS shows promise as a new genotyping method, instrumentation is expensive and thus prohibitive for many public health laboratories. Conversely, real-time PCR instruments are becoming ubiquitous, easily maintained, and the use of unlabeled primers and no probe makes reagents inexpensive [17]. Therefore, real-time PCR is an accessible and increasing popular technology for widespread molecular epidemiological efforts.

Here, we present a panel of real-time PCR assays, based on mismatch amplification mutation assay (MAMA) methodology, for rapid and sensitive molecular genotyping of Cryptococcus gattii molecular types (VGI-VGIV) and the dominant North American VGII subtypes (VGIIa-c) [18, 19]. MAMA, a form of allele-specific PCR (ASPCR), employs primers that are designed for SNP genotyping. We use known MLST sequences for the VGI-VGIV molecular type assay design and whole genome sequences of 20 strains to identify SNPs specific to each of the targeted VGII subtypes [9, 20].

Methods

SYBR MAMA design

MAMA primers have an intentional penultimate mismatch nucleotide at the 3′ end; the ultimate base is always the SNP assay target and is a perfect match for the target SNP [18]. Mismatches decrease the efficiency of primer extension by Taq polymerase, such that if two mismatches are found together under the 3′ end of the primer, the efficiency of the PCR is significantly reduced. However, if a single mismatch at the penultimate base is present, extension occurs from the 3′ matched base, and efficiency of the PCR remains relatively high. Costly fluorogenic oligonucleotide probes are not needed to discriminate SNPs with this method. This discriminatory design results in a cost-efficient, powerful and simple method of SNP genotyping [17, 21]. Separate PCR reactions are performed with a MAMA primer specific for only one of the two target SNPs and with one universal primer for amplification from the alternate direction. Comparison of cycle threshold (Ct) values will reveal which reaction is more efficient (has the smaller Ct value). The more efficient reaction corresponds to the SNP that is present in the sample.

MAMA design for MLST groups VGI, VGII, VGIII, and VGIV

The MLST SYBR MAMA design was informed by MLST data collected for 202 C. gatii strains from a worldwide collection [20]. The MLST library included sequences from 77, 75, 26, and 24 isolates of the VGI, VGII, VGIII, VGIV molecular types, respectively. The gene encoding mannitol-1-phosphate dehydrogenase (MPD1) was selected as the best candidate for assay design based on its sequence conservation within each of the four molecular types that allowed for design of assay primers with a minimum number of degenerate bases. All 15 of the known MPD1 allele sequences were aligned with SeqMan Pro v.9.0.4 (DNASTAR, Madison, WI). SNPs specific for each of the molecular types were identified in the sequence alignment. MAMA primers were manually designed in Primer Express 3.0 (Life Technologies, Carlsbad, CA) software with optimal mismatches chosen as suggested by Li et. al. [19] (Table 1).
Table 1

MAMA real-time PCR assay sequences and targets for genotyping C. gattii

Genotype

Assay Name

Gene (SNP position)

Base call match/mismatch

Universal Primer sequence 5′ -- > 3′

Match MAMA Primer sequence 5′ -- > 3′

Mismatch MAMA Primer sequence 5′ -- > 3′

VGI

VGI-MPD471

MPD1 (471)

G/A

AGACTGTCCCAATGTCAAGCTTTC

GCCTTGTATGTGGTAACACCAGTG

GWGCCTTGTATGTGGTAACACCAGTA

VGII

VGII-MPD495

MPD1 (495)

T/A

AGACTGTCCCAATGTCAAGCTTTC

ATTAACCTTAGTGTTGGAGACCTTGACT

AACCTTAGTGTTGGAGACCTTGACA

VGIIa

VGIIa-45211

hypothetical protein

A/C

CCCAGCAACCTTGATCTGGA

AGCTGCTCTAAGAGACACATCATCA

AGCTGCTCTAAGAGACACATCATCC

VGIIb

VGIIb-502129

not annotated

G/A

AATCGCTCGTCCTCATATGACA

GTAGGCGGTGGGATAAGGTG

GGTAGGCGGTGGGATAAGGTA

VGIIc

VGIIc-257655

non-coding region

C/T

CGTTAATTTGGTTGTTTGACAACCT

AGCAACTCACGCAGAAACAGAC

GAGCAACTCACGCAGAAACAGAT

VGIII

VGIII-MPD198

MPD1 (198)

T/A

TGACATTGGGACAGTCTGCAAT

ACTGCTGCTTCTCCCGTTGT

CTGCTGCTTCTCCCGTTGA

VGIV

VGIV-MPD423

MPD1 (423)

A/C

ACCCAGTCATTAACCTTAGTGTTGGA

CTCGTTCGTCAAYCACGTTAGA

TCGTTCGTCAAYCACGTTAGC

MAMA design for VGIIa, VGIIb, and VGIIc subtypes

Whole genome sequence typing (WGST) analysis of 20 C. gattii strains from a previous study revealed canonical SNPs specific for each of the VGII a, b and c subtypes (n = 2720, 3547, and 3819, respectively) [9]. In order to minimize interference of adjacent mutations with primer design, the genotype-specific SNPs were sorted according to nearest neighboring mismatch within the sequence alignment; in short, the SNPs with the most-conserved flanking regions were the top candidates for assay design. Sequence from the R265 strain reference genome [GenBank: CH408164] [2] surrounding the genotype-specific SNPs was used for assay design. SYBR MAMA primers were designed using the same criteria as previously described for the MLST MAMA (Table 1).

Isolate selection

Initially, assays were validated with genomic DNA extracted from 57 C. gattii strains of North American origin and some historical isolates. The panel of isolates including: 13 VGIIa, 4 VGIIb, and 24 VGIIc, and 8 each of VGI and VGIII, was analyzed using each of the assays (Table 2). All DNAs were genotyped by MLST prior to screening. Further validation of the assays was accomplished by employing a more diverse isolate collection of 55 strains including isolates of international origin; this panel was comprised of 10 VGI, 10 VGIIa, 9 VGIIb, 8 VGIIc, 8 VGIII, and 10 VGIV molecular types (Table 3). The strains came from a variety of environmental, human and animal sources, including cats, a dog, an alpaca, a porpoise, a sheep and a cow.
Table 2

C. gattii strains for initial assay validation

Isolate ID

MLST

Year

Geographic origin

Source

B7488

VGI

2009

Oregon

Human

B7496

VGI

2009

Hawaii

Dolphin

B8551

VGI

2010

Oregon

Human

B8852

VGI

2010

Oregon

Human

B8886

VGI

2010

Oregon

Soil

B8887

VGI

2010

Oregon

Soil

B8990

VGI

2010

California

Human

B9009

VGI

2011

Washington

Human

B6864

VGIIa

2004

Oregon

Human

B7395

VGIIa

2008

Washington

Dog

B7422

VGIIa

2009

Oregon

Cat

B7436

VGIIa

2009

California

Alpaca

B7467

VGIIa

2009

Oregon

Porpoise

B8555

VGIIa

2006

Washington

Human

B8577

VGIIa

2009

British Columbia

Soil

B8793

VGIIa

2010

Oregon

Canine

B8849

VGIIa

2010

Oregon

Environmental

CA-1014

VGIIa

unknown

California

Human

CBS-7750

VGIIa

1990

California

Environmental

ICB-107

VGIIa

unknown

Brazil

Human

NIH-444

VGIIa

1972

Washington

Human

B7394

VGIIb

2008

Washington

Cat

B7735

VGIIb

2009

Oregon

Human

B8554

VGIIb

2010

Oregon

Dog

B8828

VGIIb

2010

Washington

Porpoise

B6863

VGIIc

2005

Oregon

Human

B7390

VGIIc

2008

Idaho

Human

B7432

VGIIc

2009

Oregon

Human

B7434

VGIIc

2008

Oregon

Human

B7466

VGIIc

2008

Oregon

Cat

B7491

VGIIc

2009

Oregon

Human

B7493

VGIIc

2009

Oregon

Sheep

B7641

VGIIc

2008

Oregon

Cat

B7737

VGIIc

2009

Oregon

Human

B7765

VGIIc

2009

Oregon

Dog

B8210

VGIIc

2008

Oregon

Human

B8214

VGIIc

2009

Oregon

Human

B8510

VGIIc

2009

Oregon

Human

B8549

VGIIc

unknown

Oregon

Human

B8552

VGIIc

unknown

Oregon

Human

B8571

VGIIc

2009

Washington

Human

B8788

VGIIc

2010

Oregon

Human

B8798

VGIIc

2005

Oregon

Human

B8821

VGIIc

2010

Oregon

Human

B8825

VGIIc

2009

Oregon

Human

B8833

VGIIc

2010

Oregon

Cat

B8838

VGIIc

2010

Washington

Human

B8843

VGIIc

2010

Oregon

Human

B8853

VGIIc

2010

Oregon

Cat

B7415

VGIII

2009

California

Alpaca

B7495

VGIII

2009

California

Human

B8212

VGIII

2007

Oregon

Human

B8260

VGIII

2009

Washington

Cat

B8262

VGIII

1992

California

Human

B8516/B8616

VGIII

2009

Oregon

Cat

B9143

VGIII

2011

California

Human

B9146

VGIII

2011

California

Human

Table 3

C. gattii strains for additional assay validation

Culture collection ID

Geographic origin

Sample type

MLST

Year of isolation

B4501

Australia

Human

VGI

unknown

B4503

Australia

Human

VGI

unknown

B4504

Australia

Human

VGI

unknown

B4516

Australia

Human

VGI

unknown

B5765

India

Environmental

VGI

unknown

B9018

California

Human

VGI

2011

B9019

New Mexico

Human

VGI

2011

B9021

Rhode Island

Human

VGI

2011

B9142

Georgia

Human

VGI

2011

B9149

California

Human

VGI

2011

B8508

Oregon

Human

VGIIa

2009

B8512

Oregon

Alpaca

VGIIa

2009

B8558

Washington

Human

VGIIa

2010

B8561

Washington

Human

VGIIa

2010

B8563

Washington

Human

VGIIa

2010

B8567

Washington

Dog

VGIIa

2010

B8854

Washington

Human

VGIIa

2010

B8889

Oregon

Environmental

VGIIa

2010

B9077

Washington

Environmental

VGIIa

2011

B9296

British Columbia

Environmental

VGIIa

2011

B8211

Oregon

Human

VGIIb

2009

B8966

Oregon

Horse

VGIIb

2010

B9076

Washington

Environmental

VGIIb

2011

B9157

Washington

Horse

VGIIb

2011

B9170

Washington

Porpoise

VGIIb

2011

B9234

Washington

Cat

VGIIb

2011

B9290

British Columbia

Cat

VGIIb

2011

B9241

Oregon

Human

VGIIb

2011

B9428

Washington

Cat

VGIIb

2012

B9159

Washington

Sheep

VGIIc

2011

B9227

Oregon

Cat

VGIIc

2011

B9235

Oregon

Human

VGIIc

2011

B9244

Oregon

Human

VGIIc

2011

B9245

Oregon

Human

VGIIc

2011

B9295

British Columbia

Environmental

VGIIc

2011

B9302

Oregon

Environmental

VGIIc

2011

B9374

Oregon

Human

VGIIc

2011

B8965

New Mexico

Human

VGIII

2010

B9148

California

Human

VGIII

2011

B9151

Michigan

Human

VGIII

2011

B9163

New Mexico

Human

VGIII

2011

B9237

New Mexico

Cat

VGIII

2011

B9372

California

Cow

VGIII

2011

B9422

Oregon

Cat

VGIII

2012

B9430

Alaska

Cat

VGIII

2012

B7238

Botswana

Human

VGIV

2005

B7240

Botswana

Human

VGIV

2005

B7243

Botswana

Human

VGIV

2005

B7247

Botswana

Human

VGIV

2005

B7249

Botswana

Human

VGIV

2005

B7260

Botswana

Human

VGIV

2006

B7262

Botswana

Human

VGIV

2006

B7263

Botswana

Human

VGIV

2006

B7264

Botswana

Human

VGIV

2006

B7265

Botswana

Human

VGIV

2006

Isolate culturing and DNA extraction

Isolates were grown on Yeast Peptone Glucose (YPD) agar plus 0.5% NaCl at 37°C for 24 hours; and DNA was prepared using an UltraClean DNA Isolation Kit as described by the manufacturer, with some modifications (MO BIO Laboratories, Carlsbad, CA). Briefly, ~0.5 grams of microbial cells were suspended in lysis solution in a MicroBead tube and heated to 65°C for 15 minutes to increase lysis efficiency. The MicroBead tube was then secured horizontally using the MO BIO vortex adapter tube holder (MO BIO Laboratories, Carlsbad, CA) and vortexed at maximum speed for 10 minutes; post cell lysis, microtubes were immediately placed on ice for 5 minutes. After the lysis steps, DNA extraction was completed per manufacturer’s instructions. DNA was stored at −20°C.

Real-time PCR

Real-time PCR was performed on the ABI 7900HT real-time PCR System (Life Technologies, Carlsbad, CA). Reactions for both perfect match and mismatch primer sets were conducted in separate wells of a 384-well optical plate, and reactions for each primer set were run in triplicate. Reactions were 10 μL total volume composed of 1X Platinum SYBR Green qPCR SuperMix-UDG with ROX (Invitrogen, Grand Island, NY), 200 nM each of forward and reverse primers, and 1 μL DNA extract (diluted 1:10). Reactions were incubated for 3 min at 50°C for UDG digest followed by 3 min at 95°C for Taq polymerase activation. PCR consisted of 45 cycles of 15 s at 95°C for denaturation followed by 1 min at 60°C annealing and extension. Dissociation of PCR product was performed for 15 sec at 95°C, 15 sec at 60°C and 15 sec at 95°C as a quality assurance step to inspect reactions for primer-dimer. Dissociation curves were not used for isolate genotyping, rather to ensure amplification was specific for the targeted sequence and to preclude non-specific amplification associated with the ability of SYBR Green chemistry to bind any double-stranded DNA. Data were analyzed in Sequence Detection Systems 2.3 software (Life Technologies, Carlsbad, CA) for calculation of cycle threshold (Ct) values and interpretation of dissociation curves.

For MAMA results, the perfect match primer set will amplify earlier and yield the lowest Ct value, corresponding to the SNP genotype of the isolate; secondary delayed amplification plots with a higher Ct value, if present, are due to mismatch priming (Figure 1). An algorithm for genotype calling was implemented to expedite data analysis. The delta Ct value was calculated by subtracting the match primer mean Ct from the mismatch primer mean Ct. If the mismatch priming fails to yield a Ct value because it is beyond the instrument range, a Ct value = 40 is assigned in order to calculate a ΔCt.
Δ Ct = mismatch mean Ct perfect match mean Ct
https://static-content.springer.com/image/art%3A10.1186%2F1471-2180-14-125/MediaObjects/12866_2013_Article_2271_Fig1_HTML.jpg
Figure 1

VGIIb MAMA plots with VGII DNA show the specificity of VGIIb MAMA for VGIIb DNA. (A) The VGIIb match primers amplify VGIIb DNA efficiently and yield a lower Ct value than the VGIIb mismatch primers, resulting in a VGIIb genotype call. (B) The VGIIb mismatch primers amplify VGIIa DNA more efficiently than the VGIIb match primers, resulting in a non-VGIIb genotype call. (C) VGIIb mismatch primers amplify VGIIc DNA more efficiently than the VGIIb match primers, again resulting in a non-VGIIb genotype call.

A negative ΔCt value indicates a mismatch allele, whereas a positive ΔCt indicates a match allele. A stringent threshold of |ΔCt| ≥ 3.3, approximately equivalent to one log10 difference in the dynamic range, was established to ensure accuracy of allele calls. If |ΔCt| < 3.3 is below the stringent threshold, this could result in an inaccurate genotype call. In this case, it is advisable to re-screen the sample across the failed assays.

Sensitivity and specificity of the assay panel were calculated as well as concordance with the known MLST type as determined by sequencing the MLST house keeping genes. Assay repeatability and reproducibility were tested by screening nine replicate reactions with the matching primer sets and DNA for each assay on three separate days. The lower limit of detection for each assay and its matching template pair was tested. Each matching template and assay pair was tested using six log10 serial dilutions of a single template DNA, starting with 0.5 ng/μl. Template DNA was quantified in triplicate by NanoDrop 3300 fluorospectrometer (NanoDrop Technologies, Wilmington, DE) using Quant-iT PicoGreen dsDNA Reagent (Life Technologies, Carlsbad, CA), according to manufacturer’s instructions. Real-time PCR reactions were performed in triplicate for each dilution.

Results

Initial validation revealed the assay panel was 100% sensitive; each assay appropriately identified the known isolate genotypes. The ΔCt values for our validation panel confirmed the stringent threshold ΔCt = 3.3 sufficient to discriminate the genotypes. In addition, the assay panel was 100% specific; no cross reactivity occurred between assays and non-matching genotypes. Further validation of the assay panel with additional strains revealed 100% sensitivity and specificity. A total of 112 strains were screened across the MLST assay panel and 100% sensitivity and specificity was observed (Table 4). A total of 68 previously genotyped strains were screened across the VGII subtyping assay panel with 100% sensitivity and specificity (Table 5). The assay coefficients of variation ranged from 0.22% to 4.33% indicating high assay repeatability and reproducibility within and between runs (Table 6). The assays were designed for genotyping of DNA from known C. gattii isolates, and are not validated for application to clinical specimens; they were able to detect DNA concentrations as low as 0.5 pg/μl (Table 7).
Table 4

MLST SYBR MAMA Ct values and genotype assignments for VGI-VGIV

 

VGI_MPD471

VGII_MPD495

VGIII_MPD198

VGIV_MPD423

Isolate ID

Strain type via MLST

VGI Ct Mean

non-VGI Ct Mean

Delta Ct

Type call via assay

VGII Ct Mean

non-VGII Ct Mean

Delta Ct

Type call via assay

VGIII Ct Mean

non-VGIII Ct Mean

Delta Ct

Type call via assay

VGIV Ct Mean

non-VGIV Ct Mean

Delta Ct

Type call via assay

Final Call

B7488

VGI

17.0

29.0

11.9

VGI

37.4

17.7

−19.7

non-VGII

28.4

14.9

−13.5

non-VGIII

32.4

16.3

−16.1

non-VGIV

VGI

B7496

VGI

18.2

28.0

9.8

VGI

35.3

19.0

−16.3

non-VGII

24.5

16.4

−8.1

non-VGIII

31.7

17.9

−13.8

non-VGIV

VGI

B8551

VGI

17.3

29.6

12.3

VGI

36.2

17.9

−18.3

non-VGII

28.7

15.3

−13.4

non-VGIII

39.0

16.7

−22.3

non-VGIV

VGI

B8852

VGI

21.1

30.9

9.8

VGI

36.5

21.9

−14.6

non-VGII

27.8

19.1

−8.8

non-VGIII

32.0

20.6

−11.4

non-VGIV

VGI

B8886

VGI

18.9

29.2

10.3

VGI

38.1

19.3

−18.8

non-VGII

26.7

16.4

−10.3

non-VGIII

32.3

17.9

−14.4

non-VGIV

VGI

B8887

VGI

15.9

28.3

12.4

VGI

23.6

15.5

−8.1

non-VGII

33.6

16.2

−17.4

non-VGIII

34.1

15.5

−18.7

non-VGIV

VGI

B8990

VGI

18.8

30.9

12.1

VGI

37.2

20.1

−17.1

non-VGII

31.3

16.9

−14.3

non-VGIII

40.0

19.3

−20.7

non-VGIV

VGI

B9009

VGI

21.6

31.0

9.4

VGI

36.5

23.1

−13.4

non-VGII

28.6

19.4

−9.2

non-VGIII

40.0

21.1

−18.9

non-VGIV

VGI

B4501

VGI

16.1

26.7

10.6

VGI

30.5

18.1

−12.4

non-VGII

30.6

17.3

−13.3

non-VGIII

29.4

16.4

−13.0

non-VGIV

VGI

B4503

VGI

15.9

27.2

11.2

VGI

32.7

18.6

−14.1

non-VGII

33.8

17.9

−15.9

non-VGIII

28.7

16.1

−12.6

non-VGIV

VGI

B4504

VGI

15.6

27.2

11.5

VGI

33.1

18.1

−15.1

non-VGII

33.9

17.4

−16.4

non-VGIII

28.7

15.8

−13.0

non-VGIV

VGI

B4516

VGI

15.3

26.8

11.5

VGI

31.5

17.6

−13.9

non-VGII

33.4

16.8

−16.6

non-VGIII

29.7

15.3

−14.3

non-VGIV

VGI

B5765

VGI

17.2

28.0

10.8

VGI

32.8

19.7

−13.0

non-VGII

34.4

19.2

−15.2

non-VGIII

29.0

16.3

−12.7

non-VGIV

VGI

B9018

VGI

17.7

30.0

12.3

VGI

34.6

17.9

−16.7

non-VGII

31.8

18.6

−13.2

non-VGIII

35.0

18.3

−16.8

non-VGIV

VGI

B9019

VGI

16.9

26.1

9.2

VGI

35.4

16.7

−18.7

non-VGII

34.9

16.7

−18.2

non-VGIII

30.5

16.8

−13.7

non-VGIV

VGI

B9021

VGI

21.4

32.9

11.5

VGI

33.4

19.9

−13.5

non-VGII

32.7

20.5

−12.2

non-VGIII

35.5

20.4

−15.2

non-VGIV

VGI

B9142

VGI

16.0

26.3

10.3

VGI

27.8

15.9

−11.9

non-VGII

32.7

16.5

−16.2

non-VGIII

31.7

16.6

−15.1

non-VGIV

VGI

B9149

VGI

17.7

26.8

9.1

VGI

28.5

17.5

−11.0

non-VGII

28.5

18.2

−10.3

non-VGIII

31.0

18.3

−12.6

non-VGIV

VGI

B6864

VGIIa

27.8

17.5

−10.3

non-VGI

19.3

33.1

13.8

VGII

34.7

19.7

−15.0

non-VGIII

40.0

16.1

−23.9

non-VGIV

VGII

B7395

VGIIa

28.9

18.8

−10.1

non-VGI

21.3

32.6

11.3

VGII

40.0

19.2

19.2

non-VGIII

40.0

18.8

−21.2

non-VGIV

VGII

B7422

VGIIa

27.4

17.4

−10.0

non-VGI

19.5

32.3

12.8

VGII

35.4

19.1

−16.3

non-VGIII

40.0

15.6

−24.4

non-VGIV

VGII

B7436

VGIIa

27.8

17.9

−9.9

non-VGI

20.7

35.4

14.7

VGII

36.5

16.9

−19.6

non-VGIII

40.0

15.6

−24.4

non-VGIV

VGII

B7467

VGIIa

30.9

20.7

−10.1

non-VGI

22.7

32.7

9.9

VGII

37.7

23.4

−14.2

non-VGIII

40.0

19.1

−20.9

non-VGIV

VGII

B8555

VGIIa

27.9

17.7

−10.2

non-VGI

19.7

32.1

12.4

VGII

34.6

20.8

−13.8

non-VGIII

40.0

16.6

−23.4

non-VGIV

VGII

B8577

VGIIa

31.1

20.9

−10.2

non-VGI

21.8

34.1

12.3

VGII

33.1

23.4

−9.8

non-VGIII

40.0

19.8

−20.2

non-VGIV

VGII

B8793

VGIIa

27.4

17.4

−10.0

non-VGI

18.9

32.6

13.7

VGII

39.0

24.9

−14.1

non-VGIII

40.0

16.3

−23.7

non-VGIV

VGII

B8849

VGIIa

28.9

18.7

−10.1

non-VGI

22.9

35.1

12.2

VGII

36.0

22.7

−13.3

non-VGIII

40.0

18.4

−21.6

non-VGIV

VGII

CA-1014

VGIIa

20.4

11.6

−8.8

non-VGI

13.6

32.4

18.9

VGII

31.1

12.8

−18.3

non-VGIII

40.0

11.0

−29.0

non-VGIV

VGII

CBS-7750

VGIIa

27.2

17.3

−9.9

non-VGI

18.8

33.1

14.3

VGII

38.0

25.5

−12.5

non-VGIII

40.0

15.8

−24.2

non-VGIV

VGII

ICB-107

VGIIa

28.1

18.2

−9.9

non-VGI

20.0

34.7

14.8

VGII

37.5

25.4

−12.1

non-VGIII

40.0

15.6

−24.4

non-VGIV

VGII

NIH-444

VGIIa

24.9

14.9

−10.0

non-VGI

17.0

33.2

16.2

VGII

34.9

17.7

−17.2

non-VGIII

40.0

13.3

−26.7

non-VGIV

VGII

B8508

VGIIa

23.7

14.8

−8.9

non-VGI

17.4

30.4

13.0

VGII

34.5

16.2

−18.2

non-VGIII

29.1

14.9

−14.2

non-VGIV

VGII

B8512

VGIIa

23.5

14.6

−9.0

non-VGI

16.7

30.6

13.9

VGII

31.4

15.7

−15.6

non-VGIII

29.7

14.8

−14.9

non-VGIV

VGII

B8558

VGIIa

22.5

13.7

−8.8

non-VGI

15.9

29.9

14.0

VGII

30.6

14.9

−15.7

non-VGIII

30.1

14.3

−15.9

non-VGIV

VGII

B8561

VGIIa

26.5

17.7

−8.8

non-VGI

20.3

34.2

14.0

VGII

34.1

19.1

−15.0

non-VGIII

33.2

22.2

−11.0

non-VGIV

VGII

B8563

VGIIa

24.4

16.0

−8.4

non-VGI

18.4

32.8

14.4

VGII

32.8

20.4

−12.4

non-VGIII

32.2

17.3

−14.9

non-VGIV

VGII

B8567

VGIIa

25.6

17.0

−8.6

non-VGI

19.4

34.1

14.7

VGII

33.8

18.2

−15.6

non-VGIII

35.1

16.8

−18.2

non-VGIV

VGII

B8854

VGIIa

24.7

15.8

−8.9

non-VGI

18.1

32.7

14.6

VGII

33.0

17.1

−15.9

non-VGIII

33.2

15.8

−17.4

non-VGIV

VGII

B8889

VGIIa

28.0

17.6

−10.4

non-VGI

20.3

33.1

12.7

VGII

33.7

19.1

−14.6

non-VGIII

32.4

17.5

−15.0

non-VGIV

VGII

B9077

VGIIa

33.6

17.8

−15.9

non-VGI

15.4

28.6

13.2

VGII

40.0

18.6

−21.5

non-VGIII

40.0

18.6

−21.4

non-VGIV

VGII

B9296

VGIIa

27.3

19.8

−7.5

non-VGI

18.6

34.0

15.4

VGII

32.4

20.8

−11.6

non-VGIII

34.9

19.2

−15.7

non-VGIV

VGII

B7394

VGIIb

31.9

22.5

−9.5

non-VGI

23.5

33.5

10.0

VGII

33.7

19.3

−14.4

non-VGIII

40.0

20.2

−19.8

non-VGIV

VGII

B7735

VGIIb

26.9

17.8

−9.1

non-VGI

18.3

33.3

15.0

VGII

0.0

15.8

15.8

non-VGIII

40.0

15.4

−24.6

non-VGIV

VGII

B8554

VGIIb

28.8

18.3

−10.5

non-VGI

20.8

32.2

11.3

VGII

35.5

22.0

−13.4

non-VGIII

40.0

18.3

−21.7

non-VGIV

VGII

B8828

VGIIb

28.8

18.5

−10.3

non-VGI

20.7

32.7

11.9

VGII

35.9

19.2

−16.7

non-VGIII

40.0

31.9

−8.1

non-VGIV

VGII

B8211

VGIIb

22.9

12.8

−10.1

non-VGI

15.1

30.1

15.1

VGII

33.0

13.9

−19.0

non-VGIII

33.8

12.9

−21.0

non-VGIV

VGII

B8966

VGIIb

24.6

15.5

−9.0

non-VGI

17.3

25.9

8.6

VGII

29.3

15.6

−13.7

non-VGIII

28.9

14.7

−14.2

non-VGIV

VGII

B9076

VGIIb

40.0

17.5

−22.5

non-VGI

17.1

27.5

10.5

VGII

40.0

18.4

−21.6

non-VGIII

30.6

18.0

−12.6

non-VGIV

VGII

B9157

VGIIb

25.4

15.3

−10.2

non-VGI

17.6

29.4

11.9

VGII

31.2

16.1

−15.1

non-VGIII

31.6

16.1

−15.5

non-VGIV

VGII

B9170

VGIIb

26.2

16.9

−9.3

non-VGI

17.5

28.7

11.2

VGII

29.5

17.6

−11.9

non-VGIII

31.1

17.7

−13.4

non-VGIV

VGII

B9234

VGIIb

24.7

15.0

−9.6

non-VGI

15.4

30.3

14.9

VGII

30.2

15.7

−14.5

non-VGIII

33.3

15.8

−17.5

non-VGIV

VGII

B9290

VGIIb

24.8

16.0

−8.8

non-VGI

15.9

34.1

18.2

VGII

30.6

20.8

−9.7

non-VGIII

33.2

16.6

−16.6

non-VGIV

VGII

B9241

VGIIb

23.4

13.2

−10.3

non-VGI

15.5

28.0

12.5

VGII

30.0

13.9

−16.0

non-VGIII

34.0

13.5

−20.5

non-VGIV

VGII

B9428

VGIIb

25.2

14.4

−10.7

non-VGI

18.7

28.3

9.6

VGII

30.2

15.5

−14.7

non-VGIII

34.1

15.0

−19.1

non-VGIV

VGII

B6863

VGIIc

28.9

18.6

−10.2

non-VGI

20.7

34.2

13.5

VGII

33.2

22.7

−10.6

non-VGIII

40.0

18.1

−21.9

non-VGIV

VGII

B7390

VGIIc

27.7

18.3

−9.5

non-VGI

19.9

33.9

13.9

VGII

39.5

24.7

−14.8

non-VGIII

40.0

16.9

−23.1

non-VGIV

VGII

B7432

VGIIc

28.2

18.3

−9.9

non-VGI

20.0

32.6

12.7

VGII

34.8

18.0

−16.8

non-VGIII

40.0

17.2

−22.8

non-VGIV

VGII

B7434

VGIIc

25.6

16.2

−9.4

non-VGI

17.7

34.5

16.8

VGII

34.4

17.9

−16.5

non-VGIII

40.0

13.8

−26.2

non-VGIV

VGII

B7466

VGIIc

30.8

20.8

−10.0

non-VGI

22.4

33.6

11.2

VGII

37.4

23.7

−13.7

non-VGIII

40.0

19.5

−20.5

non-VGIV

VGII

B7491

VGIIc

26.9

17.3

−9.6

non-VGI

19.2

33.0

13.8

VGII

0.0

16.8

16.8

non-VGIII

40.0

16.7

−23.3

non-VGIV

VGII

B7493

VGIIc

27.1

17.4

−9.7

non-VGI

18.6

33.6

15.1

VGII

36.6

20.7

−15.8

non-VGIII

40.0

16.1

−23.9

non-VGIV

VGII

B7641

VGIIc

26.0

17.3

−8.7

non-VGI

18.7

32.3

13.7

VGII

34.3

20.0

−14.3

non-VGIII

40.0

15.6

−24.4

non-VGIV

VGII

B7737

VGIIc

28.0

18.5

−9.6

non-VGI

20.1

34.3

14.2

VGII

37.0

23.0

−14.0

non-VGIII

40.0

18.0

−22.0

non-VGIV

VGII

B7765

VGIIc

22.5

13.0

−9.5

non-VGI

14.5

34.1

19.6

VGII

33.1

23.4

−9.7

non-VGIII

40.0

12.9

−27.1

non-VGIV

VGII

B8210

VGIIc

27.8

18.1

−9.7

non-VGI

19.6

33.3

13.7

VGII

33.0

19.4

−13.5

non-VGIII

40.0

16.8

−23.2

non-VGIV

VGII

B8214

VGIIc

27.1

17.7

−9.5

non-VGI

19.8

34.9

15.1

VGII

34.1

20.1

−14.0

non-VGIII

40.0

16.1

−23.9

non-VGIV

VGII

B8510

VGIIc

26.8

17.6

−9.2

non-VGI

18.8

33.2

14.5

VGII

35.2

19.1

−16.1

non-VGIII

40.0

15.6

−24.4

non-VGIV

VGII

B8549

VGIIc

26.8

16.2

−10.6

non-VGI

18.7

33.5

14.8

VGII

37.4

20.5

−16.9

non-VGIII

40.0

29.6

−10.4

non-VGIV

VGII

B8552

VGIIc

27.1

17.0

−10.1

non-VGI

18.6

33.2

14.6

VGII

34.3

19.7

−14.6

non-VGIII

40.0

16.6

−23.4

non-VGIV

VGII

B8571

VGIIc

28.8

19.4

−9.4

non-VGI

21.5

33.4

11.9

VGII

34.5

22.8

−11.8

non-VGIII

40.0

19.5

−20.5

non-VGIV

VGII

B8788

VGIIc

26.0

16.0

−10.0

non-VGI

18.5

29.5

11.0

VGII

38.0

20.4

−17.6

non-VGIII

40.0

16.6

−23.4

non-VGIV

VGII

B8798

VGIIc

36.0

24.7

−11.4

non-VGI

26.5

33.3

6.8

VGII

37.2

19.2

−18.0

non-VGIII

40.0

22.5

−17.5

non-VGIV

VGII

B8821

VGIIc

30.5

20.5

−10.0

non-VGI

22.3

33.0

10.7

VGII

37.0

29.0

−8.0

non-VGIII

40.0

18.7

−21.3

non-VGIV

VGII

B8825

VGIIc

27.4

17.8

−9.6

non-VGI

19.6

33.7

14.1

VGII

36.0

20.5

−15.5

non-VGIII

40.0

17.5

−22.5

non-VGIV

VGII

B8833

VGIIc

29.2

20.7

−8.6

non-VGI

19.5

33.4

13.9

VGII

35.4

19.6

−15.8

non-VGIII

40.0

15.5

−24.5

non-VGIV

VGII

B8838

VGIIc

29.2

19.1

−10.1

non-VGI

21.5

32.8

11.3

VGII

32.9

22.3

−10.6

non-VGIII

40.0

18.5

−21.5

non-VGIV

VGII

B8843

VGIIc

29.5

19.4

−10.1

non-VGI

21.5

33.7

12.2

VGII

37.5

22.1

−15.4

non-VGIII

40.0

19.1

−20.9

non-VGIV

VGII

B8853

VGIIc

33.3

23.1

−10.2

non-VGI

24.8

33.7

8.9

VGII

34.2

27.8

−6.4

non-VGIII

40.0

21.5

−18.5

non-VGIV

VGII

B9159

VGIIc

29.6

17.5

−12.1

non-VGI

19.1

29.9

10.7

VGII

40.0

26.0

−14.0

non-VGIII

40.0

18.0

−22.0

non-VGIV

VGII

B9227

VGIIc

24.4

15.3

−9.1

non-VGI

15.5

28.1

12.6

VGII

27.9

16.1

−11.9

non-VGIII

31.0

16.3

−14.7

non-VGIV

VGII

B9235

VGIIc

24.6

15.1

−9.5

non-VGI

15.3

28.9

13.7

VGII

29.2

16.4

−12.7

non-VGIII

31.2

15.9

−15.3

non-VGIV

VGII

B9244

VGIIc

27.3

18.4

−8.9

non-VGI

18.5

31.8

13.3

VGII

28.2

21.0

−7.2

non-VGIII

30.6

18.8

−11.8

non-VGIV

VGII

B9245

VGIIc

26.8

17.9

−8.9

non-VGI

18.0

33.5

15.5

VGII

31.2

19.3

−11.9

non-VGIII

34.2

18.5

−15.6

non-VGIV

VGII

B9295

VGIIc

28.6

19.5

−9.1

non-VGI

19.9

40.0

20.1

VGII

33.6

25.5

−8.1

non-VGIII

34.4

20.3

−14.2

non-VGIV

VGII

B9302

VGIIc

24.6

14.1

−10.5

non-VGI

16.9

26.7

9.8

VGII

28.8

15.1

−13.7

non-VGIII

31.5

14.1

−17.3

non-VGIV

VGII

B9374

VGIIc

24.8

14.2

−10.6

non-VGI

18.2

27.3

9.1

VGII

29.1

15.2

−13.9

non-VGIII

32.8

14.4

−18.4

non-VGIV

VGII

B7415

VGIII

26.8

15.9

−10.9

non-VGI

35.0

17.7

−17.3

non-VGII

12.4

27.1

14.7

VGIII

30.9

15.9

−15.0

non-VGIV

VGIII

B7495

VGIII

28.1

18.0

−10.1

non-VGI

36.1

18.8

−17.3

non-VGII

14.1

30.1

16.0

VGIII

31.8

17.6

−14.2

non-VGIV

VGIII

B8212

VGIII

26.0

15.7

−10.3

non-VGI

35.3

17.0

−18.3

non-VGII

12.4

28.5

16.1

VGIII

32.5

15.6

−16.9

non-VGIV

VGIII

B8260

VGIII

29.6

19.6

−10.0

non-VGI

36.7

20.8

−15.9

non-VGII

15.9

30.7

14.8

VGIII

36.0

19.1

−16.9

non-VGIV

VGIII

B8262

VGIII

27.2

17.2

−10.0

non-VGI

33.8

18.3

−15.5

non-VGII

13.5

30.0

16.4

VGIII

40.0

16.9

−23.1

non-VGIV

VGIII

B8516/B8616

VGIII

28.4

18.5

−9.9

non-VGI

37.8

19.5

−18.3

non-VGII

14.6

29.1

14.5

VGIII

31.8

18.0

−13.8

non-VGIV

VGIII

B9143

VGIII

28.6

18.3

−10.3

non-VGI

38.3

19.6

−18.7

non-VGII

14.5

30.2

15.7

VGIII

33.3

18.0

−15.3

non-VGIV

VGIII

B9146

VGIII

30.3

19.5

−10.8

non-VGI

38.5

21.2

−17.3

non-VGII

15.8

30.1

14.3

VGIII

31.2

19.3

−11.9

non-VGIV

VGIII

B8965

VGIII

26.2

16.8

−9.4

non-VGI

30.6

17.1

−13.5

non-VGII

16.1

30.6

14.5

VGIII

35.0

17.4

−17.6

non-VGIV

VGIII

B9148

VGIII

26.0

16.6

−9.4

non-VGI

31.0

16.6

−14.4

non-VGII

15.9

30.6

14.7

VGIII

32.8

17.4

−15.4

non-VGIV

VGIII

B9151

VGIII

25.7

16.5

−9.3

non-VGI

30.7

16.2

−14.4

non-VGII

15.4

30.3

14.9

VGIII

34.9

18.0

−17.0

non-VGIV

VGIII

B9163

VGIII

26.9

17.5

−9.4

non-VGI

29.8

17.3

−12.5

non-VGII

16.9

29.7

12.8

VGIII

33.4

18.0

−15.4

non-VGIV

VGIII

B9237

VGIII

26.7

17.9

−8.9

non-VGI

31.6

17.4

−14.2

non-VGII

17.3

35.0

17.7

VGIII

38.1

19.3

−18.9

non-VGIV

VGIII

B9372

VGIII

23.5

12.7

−10.9

non-VGI

29.3

13.1

−16.1

non-VGII

14.8

27.4

12.6

VGIII

32.6

13.0

−19.6

non-VGIV

VGIII

B9422

VGIII

23.9

12.8

−11.1

non-VGI

28.9

12.9

−15.9

non-VGII

14.6

26.8

12.2

VGIII

33.0

13.3

−19.7

non-VGIV

VGIII

B9430

VGIII

23.5

12.9

−10.6

non-VGI

30.1

13.4

−16.8

non-VGII

15.1

28.5

13.4

VGIII

35.5

13.4

−22.0

non-VGIV

VGIII

B7238

VGIV

25.2

16.4

−8.8

non-VGI

33.2

18.5

−14.7

non-VGII

34.6

17.9

−16.7

non-VGIII

16.3

27.4

11.1

VGIV

VGIV

B7240

VGIV

25.8

17.1

−8.8

non-VGI

33.9

19.5

−14.5

non-VGII

34.2

18.5

−15.7

non-VGIII

17.0

28.8

11.8

VGIV

VGIV

B7243

VGIV

26.1

17.3

−8.8

non-VGI

32.0

19.6

−12.4

non-VGII

32.3

18.7

−13.6

non-VGIII

16.8

27.1

10.2

VGIV

VGIV

B7247

VGIV

25.6

16.5

−9.1

non-VGI

33.4

19.2

−14.2

non-VGII

32.0

18.1

−13.9

non-VGIII

16.3

28.4

12.1

VGIV

VGIV

B7249

VGIV

23.4

14.8

−8.6

non-VGI

31.6

16.7

−14.9

non-VGII

32.6

16.0

−16.6

non-VGIII

14.5

31.1

16.5

VGIV

VGIV

B7260

VGIV

26.0

16.5

−9.4

non-VGI

30.9

18.0

−13.0

non-VGII

34.2

17.4

−16.8

non-VGIII

15.7

27.0

11.2

VGIV

VGIV

B7262

VGIV

26.3

16.8

−9.5

non-VGI

31.4

18.7

−12.7

non-VGII

33.4

18.0

−15.4

non-VGIII

15.8

27.5

11.6

VGIV

VGIV

B7263

VGIV

24.5

15.7

−8.9

non-VGI

33.1

17.9

−15.3

non-VGII

37.3

17.0

−20.3

non-VGIII

15.8

28.0

12.2

VGIV

VGIV

B7264

VGIV

24.4

15.0

−9.4

non-VGI

31.2

16.9

−14.3

non-VGII

30.6

16.0

−14.6

non-VGIII

14.8

26.8

12.0

VGIV

VGIV

B7265

VGIV

27.5

17.3

−10.2

non-VGI

34.1

19.6

−14.5

non-VGII

32.1

18.8

−13.3

non-VGIII

16.9

28.8

11.9

VGIV

VGIV

Table 5

VGII subtyping SYBR MAMA Ct values and genotype assignments for VGIIa,b,c

 

VGIIa_Assay_45211

VGIIb_Assay_502129

VGIIc_Assay_257655

Isolate ID

Strain type via MLST

VGIIa Ct Mean

non-VGIIa Ct Mean

Delta Ct

Type call via assay

VGIIb Ct Mean

non-VGIIb Ct Mean

Delta Ct

Type call via assay

VGIIc Ct Mean

non-VGIIc Ct Mean

Delta Ct

Type call via assay

Final Call

B6864

VGIIa

17.2

30.5

13.3

VGIIa

31.0

17.5

−13.5

non-VGIIb

40.0

27.8

−12.2

non-VGIIc

VGIIa

B7395

VGIIa

19.8

33.5

13.7

VGIIa

33.1

20.3

−12.9

non-VGIIb

40.0

30.6

−9.4

non-VGIIc

VGIIa

B7422

VGIIa

18.3

33.6

15.4

VGIIa

26.4

17.6

−8.8

non-VGIIb

39.2

28.6

−10.6

non-VGIIc

VGIIa

B7436

VGIIa

18.6

31.7

13.1

VGIIa

30.1

17.0

−13.2

non-VGIIb

38.0

29.1

−8.9

non-VGIIc

VGIIa

B7467

VGIIa

20.5

37.3

16.8

VGIIa

35.1

20.3

−14.7

non-VGIIb

40.0

30.9

−9.1

non-VGIIc

VGIIa

B8555

VGIIa

17.1

31.2

14.1

VGIIa

30.3

17.5

−12.8

non-VGIIb

40.0

27.7

−12.3

non-VGIIc

VGIIa

B8577

VGIIa

20.8

36.8

16.0

VGIIa

32.8

20.8

−12.1

non-VGIIb

40.0

31.4

−8.6

non-VGIIc

VGIIa

B8793

VGIIa

15.1

29.8

14.7

VGIIa

30.7

18.6

−12.1

non-VGIIb

40.0

29.8

−10.2

non-VGIIc

VGIIa

B8849

VGIIa

19.8

34.4

14.6

VGIIa

33.6

20.2

−13.4

non-VGIIb

40.0

30.6

−9.4

non-VGIIc

VGIIa

CA-1014

VGIIa

13.1

27.3

14.2

VGIIa

27.0

14.0

−13.0

non-VGIIb

34.9

24.2

−10.7

non-VGIIc

VGIIa

CBS-7750

VGIIa

21.8

32.2

10.4

VGIIa

33.4

21.5

−11.9

non-VGIIb

40.0

34.1

−5.9

non-VGIIc

VGIIa

ICB-107

VGIIa

21.8

33.6

11.8

VGIIa

33.2

21.2

−12.0

non-VGIIb

40.0

33.8

−6.2

non-VGIIc

VGIIa

NIH-444

VGIIa

14.8

27.3

12.5

VGIIa

28.5

15.3

−13.1

non-VGIIb

36.1

25.7

−10.3

non-VGIIc

VGIIa

B8508

VGIIa

17.0

27.8

10.8

VGIIa

26.5

17.3

−9.2

non-VGIIb

31.7

22.7

−9.1

non-VGIIc

VGIIa

B8512

VGIIa

17.6

28.1

10.4

VGIIa

26.3

18.0

−8.3

non-VGIIb

33.2

24.2

−9.0

non-VGIIc

VGIIa

B8558

VGIIa

16.3

24.8

8.5

VGIIa

27.3

15.3

−12.0

non-VGIIb

29.4

20.0

−9.4

non-VGIIc

VGIIa

B8561

VGIIa

15.8

27.5

11.8

VGIIa

25.0

16.9

−8.1

non-VGIIb

33.4

23.2

−10.2

non-VGIIc

VGIIa

B8563

VGIIa

14.5

27.3

12.8

VGIIa

23.9

15.6

−8.3

non-VGIIb

31.7

21.7

−10.0

non-VGIIc

VGIIa

B8567

VGIIa

15.0

36.2

21.2

VGIIa

24.5

16.0

−8.5

non-VGIIb

31.8

22.2

−9.5

non-VGIIc

VGIIa

B8854

VGIIa

14.7

26.7

12.0

VGIIa

24.1

15.1

−9.0

non-VGIIb

31.4

22.2

−9.2

non-VGIIc

VGIIa

B8889

VGIIa

17.0

28.1

11.0

VGIIa

25.9

17.3

−8.7

non-VGIIb

33.2

23.8

−9.4

non-VGIIc

VGIIa

B9077

VGIIa

16.7

27.8

11.1

VGIIa

25.6

16.7

−9.0

non-VGIIb

32.9

24.4

−8.4

non-VGIIc

VGIIa

B9296

VGIIa

17.0

27.5

10.5

VGIIa

25.5

17.3

−8.2

non-VGIIb

32.9

24.8

−8.1

non-VGIIc

VGIIa

B7394

VGIIb

40.0

19.0

−21.0

non-VGIIa

17.3

29.6

12.3

VGIIb

40.0

29.0

−11.0

non-VGIIc

VGIIb

B7735

VGIIb

31.0

18.3

−12.8

non-VGIIa

18.7

31.3

12.6

VGIIb

38.1

28.9

−9.3

non-VGIIc

VGIIb

B8554

VGIIb

32.9

21.2

−11.7

non-VGIIa

22.2

35.0

12.8

VGIIb

40.0

30.4

−9.6

non-VGIIc

VGIIb

B8828

VGIIb

31.9

21.1

−10.8

non-VGIIa

19.9

35.1

15.2

VGIIb

40.0

30.5

−9.5

non-VGIIc

VGIIb

B8211

VGIIb

27.8

16.9

−10.9

non-VGIIa

17.4

28.8

11.4

VGIIb

32.3

22.3

−10.0

non-VGIIc

VGIIb

B8966

VGIIb

26.2

14.7

−11.5

non-VGIIa

16.3

24.1

7.9

VGIIb

31.8

23.2

−8.6

non-VGIIc

VGIIb

B9076

VGIIb

30.0

18.8

−11.2

non-VGIIa

19.7

30.9

11.4

VGIIb

39.1

27.0

−12.1

non-VGIIc

VGIIb

B9157

VGIIb

29.1

16.6

−12.4

non-VGIIa

15.4

23.8

8.5

VGIIb

30.3

21.3

−9.0

non-VGIIc

VGIIb

B9170

VGIIb

26.6

15.4

−11.2

non-VGIIa

16.9

24.8

7.9

VGIIb

31.0

22.7

−8.3

non-VGIIc

VGIIb

B9234

VGIIb

26.1

13.9

−12.2

non-VGIIa

15.3

23.8

8.5

VGIIb

30.2

21.2

−9.1

non-VGIIc

VGIIb

B9290

VGIIb

26.1

13.8

−12.3

non-VGIIa

15.1

24.5

9.5

VGIIb

30.6

21.2

−9.5

non-VGIIc

VGIIb

B9241

VGIIb

26.7

20.2

−6.5

non-VGIIa

14.5

24.0

9.4

VGIIb

30.5

21.4

−9.1

non-VGIIc

VGIIb

B9428

VGIIb

27.5

14.8

−12.6

non-VGIIa

16.0

24.3

8.2

VGIIb

32.0

22.4

−9.6

non-VGIIc

VGIIb

B6863

VGIIc

31.9

20.3

−11.5

non-VGIIa

33.4

20.2

−13.2

non-VGIIb

27.5

40.0

12.5

VGIIc

VGIIc

B7390

VGIIc

32.7

18.9

−13.8

non-VGIIa

31.1

17.9

−13.2

non-VGIIb

25.9

40.0

14.1

VGIIc

VGIIc

B7432

VGIIc

40.0

18.5

−21.5

non-VGIIa

30.7

17.6

−13.1

non-VGIIb

25.7

40.0

14.3

VGIIc

VGIIc

B7434

VGIIc

27.5

15.5

−12.0

non-VGIIa

28.5

15.4

−13.1

non-VGIIb

23.3

40.0

16.7

VGIIc

VGIIc

B7466

VGIIc

31.7

20.8

−10.9

non-VGIIa

33.5

20.6

−12.8

non-VGIIb

28.1

40.0

11.9

VGIIc

VGIIc

B7491

VGIIc

28.7

17.4

−11.2

non-VGIIa

30.4

16.9

−13.5

non-VGIIb

24.0

40.0

16.0

VGIIc

VGIIc

B7493

VGIIc

28.8

18.3

−10.6

non-VGIIa

31.1

18.0

−13.1

non-VGIIb

25.5

40.0

14.5

VGIIc

VGIIc

B7641

VGIIc

29.2

17.2

−12.0

non-VGIIa

30.0

17.2

−12.8

non-VGIIb

24.5

40.0

15.5

VGIIc

VGIIc

B7737

VGIIc

32.6

20.1

−12.5

non-VGIIa

30.8

20.5

−10.4

non-VGIIb

28.4

40.0

11.6

VGIIc

VGIIc

B7765

VGIIc

32.2

19.3

−12.8

non-VGIIa

32.3

18.9

−13.3

non-VGIIb

27.5

40.0

12.5

VGIIc

VGIIc

B8210

VGIIc

29.7

17.6

−12.0

non-VGIIa

30.1

17.4

−12.7

non-VGIIb

25.9

40.0

14.1

VGIIc

VGIIc

B8214

VGIIc

30.1

17.5

−12.5

non-VGIIa

30.9

17.5

−13.4

non-VGIIb

26.1

40.0

13.9

VGIIc

VGIIc

B8510

VGIIc

29.6

17.5

−12.0

non-VGIIa

31.0

17.3

−13.7

non-VGIIb

24.5

40.0

15.5

VGIIc

VGIIc

B8549

VGIIc

29.9

17.7

−12.1

non-VGIIa

31.0

17.8

−13.2

non-VGIIb

24.8

40.0

15.2

VGIIc

VGIIc

B8552

VGIIc

29.2

17.1

−12.0

non-VGIIa

30.3

17.2

−13.1

non-VGIIb

24.4

40.0

15.6

VGIIc

VGIIc

B8571

VGIIc

33.0

20.3

−12.7

non-VGIIa

32.6

20.2

−12.5

non-VGIIb

28.1

40.0

11.9

VGIIc

VGIIc

B8788

VGIIc

29.1

17.3

−11.7

non-VGIIa

30.0

17.2

−12.8

non-VGIIb

25.0

40.0

15.0

VGIIc

VGIIc

B8798

VGIIc

36.5

22.8

−13.7

non-VGIIa

34.5

22.2

−12.3

non-VGIIb

31.0

40.0

9.0

VGIIc

VGIIc

B8821

VGIIc

37.7

24.5

−13.2

non-VGIIa

37.1

24.4

−12.7

non-VGIIb

33.0

40.0

7.0

VGIIc

VGIIc

B8825

VGIIc

29.6

17.7

−11.9

non-VGIIa

30.6

17.7

−12.9

non-VGIIb

25.8

40.0

14.2

VGIIc

VGIIc

B8833

VGIIc

29.0

17.0

−12.0

non-VGIIa

30.1

17.0

−13.1

non-VGIIb

25.2

40.0

14.8

VGIIc

VGIIc

B8838

VGIIc

32.0

19.5

−12.5

non-VGIIa

32.9

19.3

−13.7

non-VGIIb

28.7

40.0

11.3

VGIIc

VGIIc

B8843

VGIIc

32.4

19.9

−12.5

non-VGIIa

33.0

19.5

−13.5

non-VGIIb

28.6

40.0

11.4

VGIIc

VGIIc

B8853

VGIIc

32.8

21.5

−11.3

non-VGIIa

36.0

23.4

−12.6

non-VGIIb

33.1

40.0

6.9

VGIIc

VGIIc

B9159

VGIIc

27.4

20.3

−7.1

non-VGIIa

25.8

16.7

−9.1

non-VGIIb

20.5

34.5

14.0

VGIIc

VGIIc

B9227

VGIIc

25.6

13.6

−12.0

non-VGIIa

23.9

14.9

−9.0

non-VGIIb

18.0

31.5

13.4

VGIIc

VGIIc

B9235

VGIIc

25.9

13.7

−12.1

non-VGIIa

24.1

14.9

−9.2

non-VGIIb

18.4

32.4

14.0

VGIIc

VGIIc

B9244

VGIIc

27.2

19.1

−8.1

non-VGIIa

26.2

16.9

−9.2

non-VGIIb

20.2

32.5

12.3

VGIIc

VGIIc

B9245

VGIIc

28.4

22.9

−5.5

non-VGIIa

25.2

17.4

−7.8

non-VGIIb

20.7

34.5

13.8

VGIIc

VGIIc

B9295

VGIIc

21.0

17.1

−3.8

non-VGIIa

26.0

19.6

−6.4

non-VGIIb

22.1

28.1

5.9

VGIIc

VGIIc

B9302

VGIIc

26.7

15.6

−11.1

non-VGIIa

23.7

15.4

−8.3

non-VGIIb

19.4

34.3

15.0

VGIIc

VGIIc

B9374

VGIIc

27.4

21.6

−5.8

non-VGIIa

24.0

15.3

−8.7

non-VGIIb

19.4

33.4

14.0

VGIIc

VGIIc

Table 6

Interassay and Intraassay for MLST and Subtyping MAMA

Assay

interrun CV (%)

intrarun CV (%)

VGI

4.33

1.56

VGII

2.35

0.22

VGIII

0.43

0.60

VGIV

1.37

1.08

VGIIa

0.22

0.50

VGIIb

1.27

0.92

VGIIc

1.61

0.32

Table 7

Lower limit dynamic range for MLST and subtyping MAMA primer sets

Primer set tested

Limit (pg)

Median Ct

VGI

0.5

31.7

non-VGI

0.5

31.1

VGII

0.5

29.5

non-VGII

0.5

28.7

VGIII

0.5

28.5

non-VGIII

0.5

29.9

VGIV

0.5

33.7

non-VGIV

0.5

33.2

VGIIa

0.5

30.2

non-VGIIa

0.5

31.2

VGIIb

0.5

30.1

non-VGIIb

0.5

28.5

VGIIc

0.5

37.4

non-VGIIc

0.05

39.4

Discussion

C. gattii is an emerging pathogen in the US Pacific Northwest and British Columbia. Molecular and epidemiological investigations revealed the Vancouver Island, BC outbreak was attributed to a novel and seemingly hypervirulent VGIIa genotype [7, 20, 22]; moreover, the recent PNW outbreak was attributed to an additional novel genotype, VGIIc [23]. These apparent new genotypes (VGIIa and VGIIc), are responsible for greater than 90% of C. gattii infections in the BC/PNW region [7]. Given the increased virulence, varying antifungal susceptibilities and clinical outcomes caused by these genotypes, as compared to other C. gattii genotypes, it will be useful to conduct regular genotyping of C. gattii isolates for both clinical and epidemiological response purposes [5, 7, 9, 16].

We have developed a MAMA real-time PCR panel for cost-efficient and rapid genotyping of C. gattii molecular types (I-IV) and VGII subtypes (a-c) as a means to better understand genotype distribution of C. gattii in North America. To validate the assays, we screened DNA from a diverse North American and international isolate collection of C. gattii isolates from human, environmental, and animal sources. All DNA had been previously typed by MLST. The assay panel performed with 100% sensitivity and specificity and was 100% concordant with MLST results. The VGII subtype specific assays may be more pertinent to the North American public health and medical communities; the molecular type (I-IV) specific assays will be useful for both North American and global genotyping. The assay is designed for screening in a cost-effective, step-wise manner. The molecular type-specific assays should be performed first on all isolates. In North America, the VGIV assay can be withheld for the first screen, as isolates of this molecular type have not yet been isolated from North America. For those North American isolates that are VGII by molecular type, the subtype-specific assays should be performed for typing VGIIa, VGIIb, or VGIIc. As we further our understanding of C. gattii populations around the world and their genotype-phenotype relationships, additional subtype specific assays can be similarly developed for local and global research purposes.

Conclusions

These PCR-based assays are an affordable, efficient, and sensitive means of genotyping C. gattii isolates. Both the assay methods and results can be easily transferred among laboratories. Assay results are based on real-time PCR cycle threshold values and are therefore objective and straightforward for local analysis. The assay panel presented here is a useful tool for conducting large-scale molecular epidemiological studies by public health and research laboratories.

Ethics statement

This study does not involve subjects or materials that would require approval by an ethics committee.

Abbreviations

MAMA: 

Mismatch amplification mutation assay

MLST: 

Multilocus sequence typing

PCR-RFLP: 

PCR-restriction fragment length polymorphism

AFLP: 

Amplified fragment length polymorphism

MLMT: 

Multilocus microsatellite typing

HRM: 

High resolution melting

MALDI-TOF MS: 

Matrix-assisted laser desorption ionization-time-of-flight mass spectrometry

ASPCR: 

Allele-specific PCR

SNP: 

Single nucleotide polymorphism

Ct: 

Cycle threshold

MPD1: 

Mannitol-1-phosphate dehydrogenase

WGST: 

Whole genome sequence typing.

Declarations

Acknowledgements

The findings and conclusions of this article are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

The authors wish to thank the members of the Cryptococcus gattii Public Health Working Group for submission of many of the isolates used in this study.

This work was supported by funds from the National Institutes of Health: R21AI098059.

Authors’ Affiliations

(1)
The Translational Genomics Research Institute
(2)
Centers for Disease Control and Prevention
(3)
Department of Pathology and Laboratory Medicine, David Geffen School of Medicine at UCLA
(4)
Center for Microbial Genetics and Genomics, Northern Arizona University

References

  1. Bovers M, Hagen F, Boekhout T: Diversity of the Cryptococcus neoformans-Cryptococcus gattii species complex. Rev Iberoam Micol. 2008, 25 (1): S4-S12. 10.1016/S1130-1406(08)70019-6.View ArticlePubMedGoogle Scholar
  2. D’Souza CA, Kronstad JW, Taylor G, Warren R, Yuen M, Hu G, Jung WH, Sham A, Kidd SE, Tangen K, Lee N, Zeilmaker T, Sawkins J, McVicker G, Shah S, Gnerre S, Griggs A, Zeng Q, Bartlett K, Li W, Wang X, Heitman J, Stajich JE, Fraser JA, Meyer W, Carter D, Schein J, Krzywinski M, Kwon-Chung KJ, Varma A, et al: Genome variation in Cryptococcus gattii, an emerging pathogen of immunocompetent hosts. MBio. 2011, 2: e00342-10.PubMed CentralPubMedGoogle Scholar
  3. Lockhart SR, Iqbal N, Bolden CB, DeBess EE, Marsden-Haug N, Worhle R, Thakur R, Harris JR: Epidemiologic cutoff values for triazole drugs in Cryptococcus gattii: correlation of molecular type and in vitro susceptibility. Diagn Microbiol Infect Dis. 2012, 73 (2): 144-148. 10.1016/j.diagmicrobio.2012.02.018.View ArticlePubMedGoogle Scholar
  4. Stephen CSL, Black W, Fyfe M, Raverty S: Multispecies outbreak of cryptococcosis on southern Vancouver Island, British Columbia. Can Vet J. 2002, 43 (10): 792-794.PubMed CentralPubMedGoogle Scholar
  5. Iqbal N, DeBess EE, Wohrle R, Sun B, Nett RJ, Ahlquist AM, Chiller T, Lockhart SR: Correlation of genotype and in vitro susceptibilities of Cryptococcus gattii strains from the Pacific Northwest of the United States. J Clin Microbiol. 2010, 48 (2): 539-544. 10.1128/JCM.01505-09.PubMed CentralView ArticlePubMedGoogle Scholar
  6. Byrnes EJ, Bildfell RJ, Frank SA, Mitchell TG, Marr KA, Heitman J: Molecular evidence that the range of the Vancouver Island outbreak of Cryptococcus gattii infection has expanded into the Pacific Northwest in the United States. J Infect Dis. 2009, 199 (7): 1081-1086. 10.1086/597306.PubMed CentralView ArticlePubMedGoogle Scholar
  7. Byrnes EJ, Li W, Lewit Y, Ma H, Voelz K, Ren P, Carter DA, Chaturvedi V, Bildfell RJ, May RC, Heitman J: Emergence and pathogenicity of highly virulent Cryptococcus gattii genotypes in the northwest United States. PLoS Pathog. 2010, 6 (4): e1000850-10.1371/journal.ppat.1000850.PubMed CentralView ArticlePubMedGoogle Scholar
  8. Walraven CJ, Gerstein W, Hardison SE, Wormley F, Lockhart SR, Harris JR, Fothergill A, Wickes B, Gober-Wilcox J, Massie L, Ku TS, Firacative C, Meyer W, Lee SA: Fatal disseminated Cryptococcus gattii infection in New Mexico. PLoS One. 2011, 6 (12): e28625-10.1371/journal.pone.0028625.PubMed CentralView ArticlePubMedGoogle Scholar
  9. Gillece JD, Schupp JM, Balajee SA, Harris J, Pearson T, Yan Y, Keim P, DeBess E, Marsden-Haug N, Wohrle R, Engelthaler DM, Lockhart SR: Whole genome sequence analysis of Cryptococcus gattii from the Pacific Northwest Reveals unexpected diversity. PLoS One. 2011, 6 (12): e28550-10.1371/journal.pone.0028550.PubMed CentralView ArticlePubMedGoogle Scholar
  10. Hagen F, Illnait-Zaragozi MT, Bartlett KH, Swinne D, Geertsen E, Klaassen CH, Boekhout T, Meis JF: In vitro antifungal susceptibilities and amplified fragment length polymorphism genotyping of a worldwide collection of 350 clinical, veterinary, and environmental Cryptococcus gattii isolates. Antimicrob Agents Chemother. 2010, 54 (12): 5139-5145. 10.1128/AAC.00746-10.PubMed CentralView ArticlePubMedGoogle Scholar
  11. Sidrim JJ, Costa AK, Cordeiro RA, Brilhante RS, Moura FE, Castelo-Branco DS, Neto MP, Rocha MF: Molecular methods for the diagnosis and characterization of cryptococcus: a review. Can J Microbiol. 2010, 56 (6): 445-458. 10.1139/W10-030.View ArticlePubMedGoogle Scholar
  12. Firacative CTL, Meyer W: MALDI-TOF MS enables the rapid identification of the major molecular types within the Cryptococcus neoformans/C. Gattii species complex. PLoS One. 2012, 7 (5): e37566-10.1371/journal.pone.0037566.PubMed CentralView ArticlePubMedGoogle Scholar
  13. Posteraro B, Vella A, Cogliati M, De Carolis E, Florio AR, Posteraro P, Sanguinetti M, Tortorano AM: Matrix-assisted laser desorption ionization-time of flight mass spectrometry-based method for discrimination between molecular types of Cryptococcus neoformans and Cryptococcus gattii. J Clin Microbiol. 2012, 50 (7): 2472-2476. 10.1128/JCM.00737-12.PubMed CentralView ArticlePubMedGoogle Scholar
  14. Hanafy A, Kaocharoen S, Jover-Botella A, Katsu M, Iida S, Kogure T, Gonoi T, Mikami Y, Meyer W: Multilocus microsatellite typing for Cryptococcus neoformans var. grubii. Med Mycol. 2008, 46 (7): 685-696. 10.1080/13693780802027062.View ArticlePubMedGoogle Scholar
  15. Gago S, Zaragoza O, Cuesta I, Rodriguez-Tudela JL, Cuenca-Estrella M, Buitrago MJ: High-resolution melting analysis for identification of the Cryptococcus neoformans-Cryptococcus gattii complex. J Clin Microbiol. 2011, 49 (10): 3663-3666. 10.1128/JCM.01091-11.PubMed CentralView ArticlePubMedGoogle Scholar
  16. Meyer W, Aanensen DM, Boekhout T, Cogliati M, Diaz MR, Esposto MC, Fisher M, Gilgado F, Hagen F, Kaocharoen S, Litvintseva AP, Mitchell TG, Simwami SP, Trilles L, Viviani MA, Kwon-Chung J: Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii. Med Mycol. 2009, 47 (6): 561-570. 10.1080/13693780902953886.PubMed CentralView ArticlePubMedGoogle Scholar
  17. Birdsell DN, Pearson T, Price EP, Hornstra HM, Nera RD, Stone N, Gruendike J, Kaufman EL, Pettus AH, Hurbon AN, Buchhagen JL, Harms NJ, Chanturia G, Gyuranecz M, Wagner DM, Keim PS: Melt analysis of mismatch amplification mutation assays (Melt-MAMA): a functional study of a cost-effective SNP genotyping assay in bacterial models. PLoS One. 2012, 7 (3): e32866-10.1371/journal.pone.0032866.PubMed CentralView ArticlePubMedGoogle Scholar
  18. Cha RS, Zarbl H, Keohavong P, Thilly WG: Mismatch amplification mutation assay (MAMA): application to the c-H-ras gene. Genome Res. 1992, 2 (1): 14-20. 10.1101/gr.2.1.14.View ArticleGoogle Scholar
  19. Li B, Kadura I, Fu D-J, Watson DE: Genotyping with TaqMAMA. Genomics. 2004, 83 (2): 311-320. 10.1016/j.ygeno.2003.08.005.View ArticlePubMedGoogle Scholar
  20. Fraser JA, Giles SS, Wenink EC, Geunes-Boyer SG, Wright JR, Diezmann S, Allen A, Stajich JE, Dietrich FS, Perfect JR, Heitman J: Same-sex mating and the origin of the Vancouver Island Cryptococcus gattii outbreak. Nature. 2005, 437 (7063): 1360-1364. 10.1038/nature04220.View ArticlePubMedGoogle Scholar
  21. Liu CM, Driebe EM, Schupp J, Kelley E, Nguyen JT, McSharry JJ, Weng Q, Engelthaler DM, Keim PS: Rapid quantification of single-nucleotide mutations in mixed influenza A viral populations using allele-specific mixture analysis. J Virol Methods. 2010, 163 (1): 109-115. 10.1016/j.jviromet.2009.09.007.View ArticlePubMedGoogle Scholar
  22. Kidd SE, Hagen F, Tscharke RL, Huynh M, Bartlett KH, Fyfe M, Macdougall L, Boekhout T, Kwon-Chung KJ, Meyer W: A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on Vancouver Island (British Columbia, Canada). Proc Natl Acad Sci U S A. 2004, 101 (49): 17258-17263. 10.1073/pnas.0402981101.PubMed CentralView ArticlePubMedGoogle Scholar
  23. Silva DC, Martins MA, Szeszs MW, Bonfietti LX, Matos D, Melhem MS: Susceptibility to antifungal agents and genotypes of Brazilian clinical and environmental Cryptococcus gattii strains. Diagn Microbiol Infect Dis. 2012, 72 (4): 332-339. 10.1016/j.diagmicrobio.2011.11.016.View ArticlePubMedGoogle Scholar

Copyright

© Kelley et al.; licensee BioMed Central Ltd. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement